ID: 1151887552

View in Genome Browser
Species Human (GRCh38)
Location 17:76932130-76932152
Sequence CTGTGTAAGAAGAAGAAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1042
Summary {0: 1, 1: 0, 2: 4, 3: 92, 4: 945}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151887552_1151887556 -2 Left 1151887552 17:76932130-76932152 CCTTCTTTCTTCTTCTTACACAG 0: 1
1: 0
2: 4
3: 92
4: 945
Right 1151887556 17:76932151-76932173 AGGGTCTTGCTCTGTTGCCTGGG 0: 296
1: 4879
2: 22458
3: 68241
4: 139318
1151887552_1151887557 2 Left 1151887552 17:76932130-76932152 CCTTCTTTCTTCTTCTTACACAG 0: 1
1: 0
2: 4
3: 92
4: 945
Right 1151887557 17:76932155-76932177 TCTTGCTCTGTTGCCTGGGCTGG 0: 189
1: 1896
2: 26047
3: 77321
4: 164220
1151887552_1151887555 -3 Left 1151887552 17:76932130-76932152 CCTTCTTTCTTCTTCTTACACAG 0: 1
1: 0
2: 4
3: 92
4: 945
Right 1151887555 17:76932150-76932172 CAGGGTCTTGCTCTGTTGCCTGG 0: 132
1: 1066
2: 3475
3: 8409
4: 13770

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151887552 Original CRISPR CTGTGTAAGAAGAAGAAAGA AGG (reversed) Intronic
900870911 1:5302143-5302165 GGGAGAAAGAAGAAGAAAGAAGG + Intergenic
900945875 1:5831105-5831127 CTGTGGAGGAAGAAGACTGATGG - Intergenic
903977372 1:27159677-27159699 CAGTGTAAAAAGAAGAAAAGAGG + Intronic
904758418 1:32782904-32782926 CTGAGTAAGAAGAAAGAGGAAGG + Intronic
904879217 1:33682221-33682243 CTTTGTAAGAAGAAGACAGAGGG - Intronic
905194803 1:36267600-36267622 CTTTGTGGGGAGAAGAAAGAGGG + Intronic
905476961 1:38235741-38235763 CTGTGTTGGGAAAAGAAAGAAGG - Intergenic
906085595 1:43130974-43130996 CTGTGCAAGGAACAGAAAGAAGG - Intergenic
906181866 1:43827950-43827972 CTGATGAAGAAGAAGAAAGTTGG + Intronic
906420770 1:45664986-45665008 CTGTTAAAAAAGATGAAAGATGG + Intronic
906818882 1:48908050-48908072 CTTTGGAGGAAGCAGAAAGAAGG - Intronic
906844336 1:49174888-49174910 CTGAGGATGAAGAAGACAGAAGG + Intronic
906941598 1:50260437-50260459 ATGTGTAAGAAGAAAAACAAGGG + Intergenic
907740150 1:57157609-57157631 CTTTGTAAGAAGAGGAAAGGAGG - Intronic
907965316 1:59323166-59323188 GTATGTTAAAAGAAGAAAGAAGG - Intronic
908016178 1:59839139-59839161 GTGTGCAAGAAGAACAAAGCTGG - Intronic
908343198 1:63203972-63203994 CTGGGCAAGAGAAAGAAAGAAGG + Intergenic
908372181 1:63494142-63494164 CTGTGTCAAAAAAAAAAAGAAGG - Intronic
908376607 1:63548585-63548607 AAGTGGAAGAAGAAGAAAGAGGG - Intronic
908458367 1:64326091-64326113 ATGTCCAAGAAAAAGAAAGAGGG + Intergenic
908593287 1:65656649-65656671 CTAAGTAAGAAGAACAAAGCTGG + Intergenic
908893353 1:68870563-68870585 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
909343414 1:74557117-74557139 CTGGGCAAGAAGAATAAAGCTGG + Intergenic
909549969 1:76887044-76887066 CTGAGAAGGAAGAAAAAAGAGGG - Intronic
909573986 1:77152052-77152074 CTGAGCAAGAAGAACAAAGCTGG + Intronic
910306793 1:85773311-85773333 CTGGGCAAGAAGAATAAAGCTGG - Intronic
910925399 1:92393030-92393052 CTGGGCAAGAAGAACAAAGCTGG + Exonic
911155493 1:94632728-94632750 CTGTTGAAGAAAATGAAAGAAGG - Intergenic
911595664 1:99796059-99796081 CTGGGCAAGAAGAACAAAGCTGG - Intergenic
911634772 1:100222744-100222766 CAGTGAAAGGAGGAGAAAGAGGG - Intronic
911690238 1:100824753-100824775 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
912006456 1:104907536-104907558 ATGTGTATGAACAACAAAGAAGG - Intergenic
912013911 1:105007025-105007047 CTGTGTAAGAAGCATGAAAAAGG - Intergenic
912081172 1:105938278-105938300 GTGAGTAAGAAGAATAAAGCTGG - Intergenic
912743149 1:112221099-112221121 CTGAGCAAAAAGAAGAAAGCTGG + Intergenic
913572280 1:120132466-120132488 CTGTTTAAGAATCAGACAGAAGG + Intergenic
914082975 1:144426538-144426560 CTGTTTAAAAAGAAAAAGGACGG + Intronic
914293202 1:146294110-146294132 CTGTTTAAGAATCAGACAGAAGG + Intergenic
914554246 1:148744893-148744915 CTGTTTAAGAATCAGACAGAAGG + Intergenic
915221776 1:154380293-154380315 CTGTGTCAAAAGAAAAAAAAAGG - Intergenic
915944288 1:160138534-160138556 TTGTGTAAGAATACAAAAGATGG + Intronic
915967334 1:160322160-160322182 CTGAGCAAAAAGAACAAAGATGG + Intronic
915997968 1:160583821-160583843 CTGGGCAAGAAGAACAAAGCTGG - Intergenic
916046005 1:161000349-161000371 CTGTGGAAGAGAAAGACAGAAGG + Intronic
916778488 1:167996007-167996029 CTGTATAAGTAGAACAAAGTAGG + Intronic
916902199 1:169239380-169239402 CAGAGTATGAAGATGAAAGAAGG + Intronic
916986184 1:170193477-170193499 CTGAGCAAAAAGAAGAAAGCTGG - Intergenic
917349409 1:174061708-174061730 CTGTCTAAAAAGAAGAAAGAAGG - Intergenic
917509978 1:175661862-175661884 CTGTGGAGGCAGGAGAAAGAGGG - Intronic
917803253 1:178589943-178589965 CTGAGTAAAAAGAACAAAGCTGG - Intergenic
917888909 1:179417654-179417676 CTGTGCAAAAAGAACAAAGCAGG - Intronic
917959353 1:180129936-180129958 CTGTGTAAGAATCAGGGAGAGGG + Intergenic
918219719 1:182425945-182425967 CTGAAAAAGAAAAAGAAAGAAGG + Intergenic
918264479 1:182828533-182828555 CTGTGTTTGAAGCAGGAAGAGGG + Intronic
918555000 1:185788314-185788336 CTTTGTAAGAAGGAGAAGGTTGG - Intronic
918687290 1:187433668-187433690 CTGTGGAACAAGAAGAAAACTGG + Intergenic
918909975 1:190555107-190555129 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
919034410 1:192288032-192288054 CTGAGTAAAAAGAACAAAGCTGG + Intergenic
919094205 1:193010356-193010378 AAGGGGAAGAAGAAGAAAGAAGG + Intergenic
919270230 1:195332246-195332268 CTGTGGAAGAAGAAAAAAAGTGG + Intergenic
919832119 1:201549212-201549234 CTTTGTCAAAAAAAGAAAGAAGG - Intergenic
920107154 1:203561996-203562018 AAGAGGAAGAAGAAGAAAGAAGG + Intergenic
920127575 1:203705717-203705739 CTCTGTAAGAAGAACAAGGCAGG - Intronic
920240925 1:204549595-204549617 CTGTGCCAGAAGACTAAAGAAGG + Exonic
920494401 1:206444392-206444414 CTGTGGAAGATGAAGAATGTTGG - Intronic
921039237 1:211414496-211414518 CTGAGCAAAAAGAAAAAAGAAGG + Intergenic
921117804 1:212110928-212110950 CTGGGGAAGAAGGAGAAAGGAGG - Intergenic
921252441 1:213310485-213310507 CTGTGAAAGAACCAGAAGGAAGG - Intergenic
921418390 1:214917388-214917410 CTGTGGAGGAGTAAGAAAGAAGG - Intergenic
921555809 1:216597417-216597439 CTGTGCATGAAGAAGATGGAAGG + Intronic
921728851 1:218554211-218554233 GTGAGTATGATGAAGAAAGAAGG - Intergenic
921947832 1:220898906-220898928 CTGGGCAAGAAGAACAAAGCTGG - Intergenic
921952976 1:220951984-220952006 CTGAGTTAGAAGAAGTAAGAAGG + Intergenic
922131991 1:222789014-222789036 CTATGTAAGAGGAGGAAATAGGG + Intergenic
922419665 1:225451061-225451083 CTGAGTGAGCAGAAGGAAGAGGG - Intergenic
922493281 1:226035966-226035988 CTCTGTGAGCAGCAGAAAGAAGG - Intergenic
922680636 1:227592471-227592493 ATGTGTCAGAAAAAGAAAAATGG - Intronic
922779191 1:228237926-228237948 GTGAGAAAGAAGAAGAAACAGGG + Intronic
922957288 1:229613978-229614000 CTGTGCAAGAAGGGGACAGAGGG + Intronic
923186086 1:231574872-231574894 ATGTGTATGATGAAGTAAGAGGG - Intronic
923291027 1:232546353-232546375 CTGTGAAAGTAGATGAAAAATGG - Intronic
923314058 1:232762298-232762320 CTGAGGAAGAGGAAGAAGGATGG - Intergenic
924166624 1:241289844-241289866 CTGAGTGAGAAGAGGAAAGATGG + Intronic
1063299743 10:4840810-4840832 CTGTGTAAGAAACATAAATAAGG - Intronic
1063895341 10:10675577-10675599 ATGTGTAAAAAGAAATAAGAAGG - Intergenic
1064134526 10:12739230-12739252 CTGTCTCAGAAAAAGAAAAAAGG + Intronic
1064358322 10:14639885-14639907 CTTTGTTAGACAAAGAAAGAAGG - Intronic
1064489211 10:15832341-15832363 AACTGGAAGAAGAAGAAAGACGG + Intronic
1064836845 10:19542324-19542346 CTCTGTAAGGAAAATAAAGATGG - Intronic
1064884038 10:20089873-20089895 CTGTGTTAAAATAAAAAAGATGG - Intronic
1064971679 10:21072984-21073006 CTGTCTCAGAAAAAGAAAAAGGG + Intronic
1065021893 10:21508566-21508588 GTGTGTAAGAGGGAGAGAGAGGG + Intergenic
1065050324 10:21785423-21785445 CTGTGGAAGAAGAAAACTGAAGG + Intronic
1066033513 10:31454962-31454984 CTGGGCAAGAAGAACAAAGCTGG + Intronic
1066134553 10:32431456-32431478 ATATGGAAGAAGAATAAAGATGG - Intergenic
1066454117 10:35558289-35558311 CTGGGAAAGAAGAAGCCAGAAGG + Intronic
1066541784 10:36455292-36455314 CTCTGGCAGAAGATGAAAGAGGG - Intergenic
1067230721 10:44407148-44407170 CTGGGCAAGAAGAACAAAGCTGG - Intergenic
1067524491 10:47029899-47029921 CTGTGTAAGAAGAGGAGACAAGG - Intergenic
1067983055 10:51109277-51109299 ATGTTTAAAAAGAAGAAAAAAGG + Intronic
1068068873 10:52170186-52170208 CTGAGGACAAAGAAGAAAGAAGG + Intronic
1068625845 10:59245595-59245617 CTGAGTAAGAATAAGAAAAGTGG - Exonic
1068629066 10:59281153-59281175 TTGTGTAAGATGAACACAGATGG - Intronic
1068646603 10:59475068-59475090 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
1069021767 10:63496472-63496494 CTTTGGAAGAAGAAGAGAGTGGG - Intergenic
1069195301 10:65544130-65544152 CTGATTAAGAATAAGAAGGAGGG - Intergenic
1070060245 10:72975546-72975568 CTGAGCAAAAAGAAGAAAGCTGG - Intergenic
1070226374 10:74511303-74511325 CTGAGTAAAAAGAACAAAGCTGG - Intronic
1070235525 10:74621511-74621533 CTGAGCAAGAAGAACAAAGCTGG - Intronic
1070782344 10:79145014-79145036 CTGGGCAAGAGGAAGAAAGAAGG - Intronic
1070872960 10:79773985-79774007 CTCTGTAAGAAGAACAATGCCGG + Intergenic
1071002727 10:80848881-80848903 CTGTGTAAAAAGAATAAAGCTGG + Intergenic
1071095407 10:81968472-81968494 CTGTGCAAGAGGAACAAAAAGGG - Intronic
1071176565 10:82932996-82933018 TTCTGGAAGAAGAATAAAGAGGG - Intronic
1071193147 10:83125945-83125967 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
1071639886 10:87296135-87296157 CTCTGTAAGAAGAACAATGCCGG + Intergenic
1071655348 10:87441817-87441839 CTCTGTAAGAAGAACAATGCCGG - Intergenic
1071672761 10:87624960-87624982 GTGTGCAAGAAAAAGAAAGGGGG - Intergenic
1072015966 10:91346862-91346884 CTTTGTAAGAACAGGAAATATGG - Intergenic
1072123200 10:92422260-92422282 CCATGTAAGAAGAAAAAAGTCGG + Intergenic
1072203891 10:93185391-93185413 CTAAGCAAGAAGAAGAAAGCTGG - Intergenic
1072245448 10:93539942-93539964 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
1073309106 10:102526861-102526883 GTGTTTAAGGAAAAGAAAGAAGG + Intronic
1073576047 10:104624721-104624743 CTTTGTAACATCAAGAAAGAAGG + Intergenic
1073642939 10:105271277-105271299 CTTTATAAGAAGAAGAAACTAGG + Intergenic
1073944253 10:108731659-108731681 CTACGTAAGAAGAAGCAAGGAGG + Intergenic
1073959602 10:108911706-108911728 GTGTGTAAACAGATGAAAGATGG - Intergenic
1074269546 10:111940106-111940128 CTGTTTAATAAAAAGAAAAAAGG - Intergenic
1074301350 10:112235749-112235771 TTGTGTTACAAGATGAAAGAGGG - Intergenic
1074605490 10:114960246-114960268 CTATGTAAAAAGAGGACAGAGGG + Intronic
1075476754 10:122742152-122742174 CAGAGTAAGAAGAAAAGAGATGG + Intergenic
1076107041 10:127831913-127831935 CTTTATAAGAAGAAGAAATTAGG + Intergenic
1076148679 10:128145644-128145666 CAGAGTAGGAAGAAGAGAGAAGG - Intergenic
1076164064 10:128268075-128268097 CTGAGTGAGAGAAAGAAAGAAGG + Intergenic
1076169530 10:128307913-128307935 GTGAGCAAGAAGAAGAGAGAAGG - Intergenic
1076286764 10:129306979-129307001 GTGGGGAAGAAGAAGAAAGCAGG - Intergenic
1076448472 10:130536844-130536866 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
1076716920 10:132370781-132370803 CTGTGTAGGCAGCAGAAAAAGGG - Intronic
1077849691 11:6063477-6063499 TTGTTTAAGATGAAGAAAGGGGG - Intergenic
1078283114 11:9922767-9922789 CTAAGTAAGAAGTGGAAAGAGGG - Intronic
1079139403 11:17798017-17798039 GTGTGTAAGAAAGAGAAGGAAGG + Intronic
1079310219 11:19358740-19358762 CTGTGTAAGAGGTGGGAAGAGGG - Intronic
1079378410 11:19914989-19915011 CTGTATAAAAAGAGGAGAGAAGG - Intronic
1079652879 11:22951763-22951785 CTGAGAAAGAAGAAAGAAGATGG - Intergenic
1079766335 11:24397794-24397816 ATGTTAAAGAAGAAGAAAGAGGG + Intergenic
1080092730 11:28367648-28367670 CTGGGCAAGAAGAACAAAGTTGG + Intergenic
1080257673 11:30309460-30309482 CTGGCTGAGAAAAAGAAAGAAGG - Intergenic
1080313531 11:30922940-30922962 TTGTTTAAGAAGAAGAGGGAAGG + Intronic
1080489051 11:32743097-32743119 CTGGGCAAGAAGAACAAAGCTGG - Intronic
1080737111 11:35027053-35027075 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
1080969244 11:37250513-37250535 CAGTGCAACATGAAGAAAGATGG - Intergenic
1081023968 11:37985034-37985056 CTGTGTCAGAAGATGCAACATGG - Intergenic
1081135075 11:39430642-39430664 CTAAGTAAAAAGAACAAAGATGG + Intergenic
1081148737 11:39599766-39599788 CTGTGAAAGAAAAACAAAGCTGG - Intergenic
1082742810 11:56929557-56929579 CTGTGTAATCTGAAGAAAGTTGG + Intergenic
1082820038 11:57538505-57538527 CTGTGCACCTAGAAGAAAGAGGG + Intergenic
1083948631 11:65941218-65941240 CTGTGGACAAAGAAGACAGACGG + Intergenic
1084096674 11:66915862-66915884 CTGTAAAGGACGAAGAAAGAAGG - Intronic
1085003826 11:73066054-73066076 CTGGGCAAGAAGAACAAAGCTGG + Intronic
1085013604 11:73158123-73158145 CTTTGGAAGAAGAAGAAGTATGG + Intergenic
1085577370 11:77618776-77618798 CTGTATCAGAAGAAAAGAGAAGG + Intronic
1085594556 11:77797210-77797232 CTGGGCAAGAAGAACAAAGCTGG + Intronic
1085849764 11:80106456-80106478 CTGGGGAAGAATAAGAAAGAGGG + Intergenic
1086243843 11:84727535-84727557 CTGGACAAGAAGAAGAAAGCTGG - Intronic
1086781925 11:90917619-90917641 CTTTGTAGGAAGAAGATATATGG + Intergenic
1087063481 11:94005888-94005910 CTGGGCAAGAAGAACAAAGCTGG - Intergenic
1087128729 11:94651100-94651122 CTGTCTAAGGACAAGATAGAGGG + Intergenic
1087209121 11:95428269-95428291 CTGTGAGGGAAGAAGAAAAATGG - Intergenic
1087677673 11:101181388-101181410 CTGTGGAAGATGGTGAAAGAAGG + Intergenic
1088003801 11:104916024-104916046 CAGTGTGAGAAGAAGCAAAAAGG + Intergenic
1088382562 11:109211064-109211086 TTGAGTAAGAAGAATAAAGCTGG - Intergenic
1088483642 11:110320343-110320365 CTTAGAAAGAAGAAGAAAGCTGG - Intergenic
1089279958 11:117366996-117367018 CTGTGAAAGGAGGAGACAGAAGG + Intronic
1089766228 11:120767988-120768010 CTGAGAAAGAAAAAGAAAGTTGG - Intronic
1090591404 11:128274056-128274078 CTGTGAAAGAACAAAAAGGAAGG + Intergenic
1090719894 11:129461928-129461950 CTGAGCAAAAAGAACAAAGATGG - Intergenic
1090936511 11:131347705-131347727 TTGTGTAGGAAGAAGAGAGAAGG + Intergenic
1091519923 12:1228084-1228106 GTGAGTAAGAAGAACAAAGCTGG - Intronic
1091572497 12:1700525-1700547 ATGTGTAAAAAGAAGAAATCAGG + Intronic
1091593112 12:1857098-1857120 ATGTGTAGGAAGAAGGAAGAAGG + Intronic
1091834059 12:3572081-3572103 TTGAGAAAGAAGAAGAAAGGAGG - Intronic
1091964695 12:4728797-4728819 TTGAGAAAGAAGAAGAAAGTTGG - Intronic
1092509326 12:9137466-9137488 TTGAGAAAGAAGAAGAAAGCTGG - Intergenic
1093662230 12:21770517-21770539 CTGTGAAAGAAGCAGAGGGAAGG + Intronic
1094570516 12:31637466-31637488 CTGTCTAAGAAAAAAAAAAAAGG - Intergenic
1095394323 12:41744731-41744753 CTATTAAAGAAGAAGAAAGTAGG + Intergenic
1095501304 12:42841905-42841927 TTGAGTAAGAAGAATAAAGCTGG - Intergenic
1095803933 12:46297317-46297339 CTGTCTAAAAAAAAAAAAGAAGG + Intergenic
1096437918 12:51610902-51610924 CTTTGAAAAAAGAACAAAGATGG - Intronic
1097242368 12:57584195-57584217 CTGGGAAAGAAAGAGAAAGAGGG - Intronic
1097274208 12:57800908-57800930 CTGTGTAAAAACAACAAAAATGG - Intronic
1097289509 12:57902585-57902607 CTGTGTAAGTAGGAGCAATAGGG + Intergenic
1097413531 12:59284391-59284413 CTTTGTAAGAAGAGGAAACTTGG - Intergenic
1097514424 12:60586749-60586771 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
1098095051 12:66946001-66946023 CTGTGTAGCAGGAAGAAGGAAGG - Intergenic
1098170853 12:67745426-67745448 CTGTGAAGGAAGATGAAGGAAGG - Intergenic
1098780785 12:74683906-74683928 CAGTGAAAGAAGAAAAAAGGTGG + Intergenic
1099217061 12:79866018-79866040 CTGGGCAAGAAGAACAAAGCTGG + Intronic
1099354840 12:81621264-81621286 GTGTGACTGAAGAAGAAAGAGGG + Intronic
1099570301 12:84309221-84309243 CTGGGTAAGAAGGAGAATAATGG + Intergenic
1099978487 12:89571223-89571245 ACCTGTAAGAGGAAGAAAGATGG - Intergenic
1100374721 12:94003752-94003774 CTGGGTAAGAAGAACAAAGCTGG - Intergenic
1100414803 12:94360800-94360822 CTGTGTAAAAAGAACAAAGTTGG + Intronic
1100776635 12:97982124-97982146 CTGAGTAAAAAGAATAAAGTTGG + Intergenic
1101600822 12:106208223-106208245 CTGGGCAAGAAGAATAAAGCTGG - Intergenic
1101628191 12:106466893-106466915 CTGGGCAAGAAGAACAAAGCTGG - Intronic
1102095570 12:110237926-110237948 CTGAGAAAGAAGAACAAAGTTGG - Intergenic
1102266089 12:111486626-111486648 CCATGTAAAAAAAAGAAAGAAGG + Intronic
1103219489 12:119231949-119231971 AGGAGGAAGAAGAAGAAAGAAGG - Intergenic
1103533266 12:121617332-121617354 CTGTGAAAAAAAAAGAAGGAAGG + Intergenic
1103834395 12:123807565-123807587 CAGTGGAAGAAACAGAAAGAAGG + Intronic
1104382525 12:128319873-128319895 CTGTTCAAGAAGATGCAAGATGG - Intronic
1105543890 13:21338006-21338028 CTGTGTAAGTAGAAGTATGAAGG + Intergenic
1105752447 13:23433751-23433773 CTCTTTAAGAAGAAAAAAAAAGG - Intergenic
1105883677 13:24624740-24624762 CTGTGAAAGAAAAAGGAACATGG + Intergenic
1106368049 13:29103054-29103076 CTTTCCAAGAAGAAGAAAAAAGG - Intronic
1106472734 13:30072054-30072076 CTGTGTAGGAAGAATAAACATGG + Intergenic
1106915283 13:34507208-34507230 CAGAGAAAGAAGAAGAAAAATGG - Intergenic
1107023052 13:35771673-35771695 ATGTGTCAGTAAAAGAAAGACGG + Exonic
1107153076 13:37134268-37134290 CTCTGGAAGAAGAAAAAAAAGGG + Intergenic
1107167869 13:37303952-37303974 CAGTGGAAAATGAAGAAAGAAGG - Intergenic
1107243734 13:38267572-38267594 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
1107287940 13:38817260-38817282 CTGTGCAAAAAGAACAAAGCTGG + Intronic
1107386861 13:39919769-39919791 CTTTGAAAGAAGAACAAAGCTGG + Intergenic
1107745731 13:43506193-43506215 CTGCATAAGAAGAACAAAGCTGG - Intronic
1108181182 13:47841469-47841491 GTGTCATAGAAGAAGAAAGAAGG - Intergenic
1108443495 13:50480926-50480948 CTTTGCAAGAAGCAGAGAGAAGG + Intronic
1108475499 13:50812089-50812111 ATCTGTAAGATGAAGAAAGTTGG + Intronic
1108854132 13:54772695-54772717 CTGTGGAAAAATAAGAATGATGG + Intergenic
1109290038 13:60462817-60462839 CTGAGTAAAAAGAACAAAGCTGG + Intronic
1109365628 13:61352493-61352515 TTATGTAAGAAAAAGAAGGAAGG - Intergenic
1109741286 13:66559298-66559320 CTTTGTAAGCATAGGAAAGAAGG - Intronic
1109923197 13:69097998-69098020 GTGTGTGAGAGGGAGAAAGAGGG + Intergenic
1110066893 13:71119487-71119509 CTGTTTAATTAAAAGAAAGAAGG - Intergenic
1110199277 13:72829720-72829742 CTGGGCAAGAAGAAGAAAGCTGG - Intronic
1110326805 13:74225838-74225860 CAGTCTAAGAAGAGGAAAGAGGG + Intergenic
1110550041 13:76801755-76801777 CTGTCTCAGAAGAAAAAAAATGG + Intergenic
1110560767 13:76908770-76908792 CTGGGGAAGCAGAAAAAAGATGG - Intergenic
1110679367 13:78290325-78290347 CTGGGCAAAAAGAACAAAGACGG - Intergenic
1110700387 13:78540626-78540648 CTCTGCAAGAAGAAGGAGGATGG - Intergenic
1110988396 13:82004570-82004592 TAGTGTAAGAAAATGAAAGATGG - Intergenic
1111359853 13:87162075-87162097 CTATGCAAAAAGAACAAAGATGG + Intergenic
1111484538 13:88879581-88879603 CTGTCTAAAAAAAAGAAAAAAGG - Intergenic
1112218194 13:97458195-97458217 CTGTGTGAAAAGATGAATGAGGG + Intronic
1112244195 13:97714562-97714584 CTCTGTAATAAGAAGATACAGGG - Intergenic
1112707149 13:102083337-102083359 CTGGGCAAGAAGAAAAAAAACGG - Intronic
1112757609 13:102655788-102655810 CAGTGTACGACGAAGAAGGAAGG - Intronic
1113039860 13:106092741-106092763 CTGTGAAAGAATAAGGTAGAGGG - Intergenic
1113102921 13:106739796-106739818 TTTTTTAAGAAGAAGAAAGGGGG + Intergenic
1114058042 14:18992022-18992044 CTTTCTAAGAAGAAGAAAAAGGG + Intronic
1114104506 14:19409732-19409754 CTTTCTAAGAAGAAGAAAAAGGG - Intronic
1114486545 14:23066007-23066029 CTCTGTATGAAGAAGAAAAAGGG + Exonic
1114578142 14:23731662-23731684 CTTTATGAGCAGAAGAAAGAAGG - Intergenic
1114713139 14:24798448-24798470 CTGGTCATGAAGAAGAAAGAAGG - Intergenic
1114716854 14:24835647-24835669 CTCTGTAAGAACAAAAAAGTAGG + Intronic
1114902236 14:27077615-27077637 CTGTGTTGGAAGCAGAAAGCAGG + Intergenic
1115030502 14:28787834-28787856 GTGTGTAAGAAGAATAAAGGGGG + Intronic
1115151566 14:30292331-30292353 CTGGGAAAGAGGAAGAGAGAAGG + Intergenic
1115209960 14:30957151-30957173 CTGTCTCAAAAGAAAAAAGAGGG + Intronic
1116417634 14:44697933-44697955 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
1116508482 14:45714790-45714812 CTATGTAAGAAGAAGCGAGGAGG - Intergenic
1116554362 14:46284614-46284636 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
1116569571 14:46498430-46498452 CTGGGCAAGAAGAACAAAGCTGG - Intergenic
1116779837 14:49224902-49224924 CTGTGGAAGAAGAGAAAAGATGG + Intergenic
1116891188 14:50270355-50270377 CTCTGTAAGAAGTAAAGAGATGG - Intronic
1117883766 14:60337787-60337809 CTGGGCAAGAAGAACAAAGCCGG - Intergenic
1117916916 14:60687448-60687470 CAGGGCAAGAAGGAGAAAGAAGG + Intergenic
1117917690 14:60694990-60695012 CTGTGTAAAAAGAACAAAGCTGG - Intergenic
1118210048 14:63757551-63757573 CTGTGTAAGCAACAGAAAGAGGG - Intergenic
1118529079 14:66682212-66682234 TTGAGTTAGAAAAAGAAAGATGG - Intronic
1118557565 14:67042670-67042692 CTGGGCAAGAAGAACAAAGCTGG - Intronic
1118628297 14:67679117-67679139 CTGTGTAATAACAAGATGGAAGG + Intronic
1118669479 14:68107520-68107542 CTTTTAAAGAAGAAGAAAGTTGG + Intronic
1119405957 14:74399835-74399857 CTCTGTAGGAAGAATAAACAAGG - Intergenic
1119627739 14:76195851-76195873 AGATGTAAGAAGAAGAAAAATGG - Intronic
1119963983 14:78892549-78892571 CTGGGTAAGAAAAAAAAAAAAGG - Intronic
1120381965 14:83791962-83791984 CTCTGAAAGAACAAGAAATAAGG + Intergenic
1121086685 14:91151936-91151958 CTGTCTATAAAGAAAAAAGAAGG - Intronic
1121612389 14:95290429-95290451 CTTTATAAGAGGAAGACAGAGGG + Intronic
1123779415 15:23611172-23611194 ATGAGTAAGAAGATGAAAGCTGG + Intronic
1123894273 15:24812934-24812956 ATGTGTATGAACAGGAAAGATGG - Intergenic
1124078324 15:26467446-26467468 CTAAGTAAAAAGAAGAAAGCTGG + Intergenic
1124408357 15:29412697-29412719 ATGTGTAAGAACAAAAAAGAAGG - Intronic
1124947997 15:34288424-34288446 CTGTGCAAGAAGAACAAAGCTGG - Intronic
1125207717 15:37173677-37173699 CTGGGCAAGAAGAACAAAGCTGG - Intergenic
1125317983 15:38452911-38452933 CGGAGTAAGAGGAAGAGAGAGGG - Intergenic
1125786263 15:42320994-42321016 CTGAGTAAAGAGAAGAAAAAAGG - Intronic
1125918810 15:43512167-43512189 CTGTGGGAGAAAAACAAAGAAGG - Intronic
1126075586 15:44905993-44906015 CTGGCAAAGAAAAAGAAAGAAGG - Intergenic
1126332411 15:47547602-47547624 CTATTAAAGAAGAACAAAGATGG - Intronic
1126416973 15:48427883-48427905 CTGGGTGAGAAGAAGCAAGAGGG + Intronic
1126505020 15:49395260-49395282 TTTTGTAAGAAGAATAAAGATGG + Intronic
1126742485 15:51791555-51791577 CTGGGCAAGAAGAACAAAGCTGG + Intronic
1126787992 15:52194397-52194419 CCATGAATGAAGAAGAAAGATGG - Intronic
1127069787 15:55277668-55277690 GTGTGTAAAATGAAGAAAAATGG + Intronic
1127168875 15:56277610-56277632 CTGGGCAAGAAGAACAAAGCTGG - Intronic
1128040554 15:64568999-64569021 ATGTTTGAGAAAAAGAAAGAAGG - Intronic
1128066103 15:64765572-64765594 CTGTGTCAGAATAAAAAAAAGGG + Intronic
1128095707 15:64953287-64953309 AAGTAAAAGAAGAAGAAAGAAGG - Intronic
1128508720 15:68300301-68300323 GGCTGTAAGATGAAGAAAGAGGG - Intronic
1128520134 15:68369725-68369747 CCCTGTAAGATGAAGAATGAGGG - Intronic
1128789286 15:70421075-70421097 CTATTTAAGGAGATGAAAGAAGG - Intergenic
1129052450 15:72793799-72793821 CTGTGTAAGAAAAAAAAAAATGG - Intergenic
1129067149 15:72914802-72914824 CTGTGGAAGGAGAAGGCAGAAGG - Intergenic
1129168738 15:73794883-73794905 CTGGGCAAGAAGCAGAAATAAGG - Intergenic
1129180532 15:73871782-73871804 ATCTGAAAAAAGAAGAAAGAGGG + Intergenic
1129338621 15:74870103-74870125 CTGGGTGGGAAGAAGAAAGCTGG - Intronic
1129507515 15:76094557-76094579 CTGGGCAAGAAGAACAAAGCTGG - Intronic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1130199859 15:81814992-81815014 CTGTGAAAAAAGAAAAAAAAGGG + Intergenic
1130897865 15:88184638-88184660 CTGAATAGGAAAAAGAAAGAAGG - Intronic
1131082248 15:89546454-89546476 TTGTGAAAGGAGAAGAAAAAGGG - Intergenic
1131287047 15:91068754-91068776 CTGTCTCAGAAAAAAAAAGAAGG - Intergenic
1131329209 15:91480661-91480683 CTGTGTAAGCAGGAGACAGAAGG + Intergenic
1133983104 16:10648155-10648177 CTGTGTAAGCAGAGGAACAAGGG + Intronic
1135294832 16:21270163-21270185 ATCTGTAAGAAGAAGATAGTAGG - Intronic
1135347923 16:21705146-21705168 CTGTGTGAGAAGAGGAGGGATGG - Intronic
1135765557 16:25175144-25175166 CTGTCTCAAAACAAGAAAGAAGG - Intronic
1136144951 16:28311078-28311100 GTGTGGAAGGAGAAGAAGGAGGG + Intronic
1137054790 16:35739425-35739447 CTGTGTAAGAATAAGAAGAAAGG + Intergenic
1137524193 16:49219487-49219509 CTGTGTTGTAAGAAGAAAAATGG - Intergenic
1137607808 16:49798205-49798227 ATCTGTTAAAAGAAGAAAGAAGG + Intronic
1137936531 16:52640229-52640251 GTCTGTGAGAAGAAGGAAGAGGG + Intergenic
1137984611 16:53097403-53097425 CTGTGAAAGAAAGAGAAAGAAGG - Intronic
1138002423 16:53295646-53295668 CTGGGTAATAAGAATAAAAATGG - Intronic
1138329465 16:56201997-56202019 CTGAGTGAGAAGGAGAGAGAAGG + Intronic
1138637671 16:58354753-58354775 CTGAGTAAAAAGAACAAAGCTGG - Intronic
1138938393 16:61759324-61759346 TTTTTTAAAAAGAAGAAAGAAGG + Intronic
1139712691 16:68788694-68788716 ATGTGAAATAAGAAGAAAGTTGG + Intronic
1140058469 16:71546410-71546432 ATGTGATAGAAGAGGAAAGACGG - Intronic
1140376989 16:74452545-74452567 CTGTCTCAGCAGAAGAAAGCAGG + Intronic
1140852366 16:78947096-78947118 CTGTGGAAAAAAAAAAAAGAGGG + Intronic
1140882929 16:79215244-79215266 CTGTTTAAAAGGAAAAAAGATGG - Intergenic
1140986548 16:80163381-80163403 CTGTGTACGCAGAATAACGACGG + Intergenic
1140986644 16:80164228-80164250 GTTTGTAAAATGAAGAAAGATGG - Intergenic
1141090228 16:81125122-81125144 CTGTCTCAAAAGAAGAAAAAAGG + Intergenic
1141266479 16:82502399-82502421 ACGTGTGAGAATAAGAAAGAGGG + Intergenic
1141757998 16:86006010-86006032 CTGGGAAAGAAGAAGATAGCTGG - Intergenic
1142025187 16:87808981-87809003 CTGTACACAAAGAAGAAAGAAGG + Intergenic
1142548941 17:725873-725895 CTGTGTCAGAAGAACAAAGGTGG - Intergenic
1142972453 17:3621953-3621975 CTGTCTCAAAAAAAGAAAGAAGG - Intronic
1143652711 17:8273756-8273778 TTGTGGATAAAGAAGAAAGATGG - Intergenic
1143864702 17:9915742-9915764 ATGGGAAAGATGAAGAAAGATGG + Exonic
1145278985 17:21454936-21454958 AGGAGGAAGAAGAAGAAAGAAGG - Intergenic
1145738940 17:27255892-27255914 CTGTGAAAGAGACAGAAAGAGGG + Intergenic
1146533475 17:33630070-33630092 CTGTGTGAAAAGTAGAGAGATGG - Intronic
1146683130 17:34822840-34822862 GACTGTAAGAAGAAGAAATATGG - Intergenic
1146747018 17:35340573-35340595 TTGAGTAAGAAGAACAAAGCAGG - Intergenic
1147305786 17:39563537-39563559 GAGTGGAAGAAGAAGAGAGAGGG - Intronic
1147759962 17:42791155-42791177 CTGGGTAAGGAGAGAAAAGAGGG - Intronic
1148464775 17:47858213-47858235 CTGGGCAAGGAGGAGAAAGATGG - Intergenic
1149002664 17:51773414-51773436 CTGTCTGAGAAGCAGAGAGAAGG + Intronic
1149226350 17:54475959-54475981 CTTTGAAAGAACAAGAAAGATGG - Intergenic
1149623969 17:58066689-58066711 CTGTGAAAGGAAAAGAAAGAAGG + Intergenic
1150151649 17:62814232-62814254 CTGTGCAAAAAGAACAAAGCTGG - Intergenic
1150417057 17:64996237-64996259 CTCTGTAAGAGGGAGACAGAGGG + Intergenic
1150794609 17:68227686-68227708 CTCTGTAAGAGGGAGACAGAGGG - Intergenic
1150862187 17:68812034-68812056 CTGTGTAAGATAAATAAATATGG - Intergenic
1151887552 17:76932130-76932152 CTGTGTAAGAAGAAGAAAGAAGG - Intronic
1153112430 18:1608201-1608223 CTGGGCAAGAAGAACAAAGCTGG - Intergenic
1153311472 18:3680939-3680961 TCGTGAAAGATGAAGAAAGAAGG + Intronic
1153776706 18:8460829-8460851 GTGTGTAAGGAGAAGAGAGGAGG + Intergenic
1153828428 18:8898426-8898448 CTTTGGAAGGAGGAGAAAGATGG + Intergenic
1153882884 18:9435940-9435962 CTGTCTAAAAAAAAAAAAGAAGG + Intergenic
1154282770 18:13021222-13021244 TTGTGAAAGAAAAAGAAAAAAGG + Intronic
1154285456 18:13051921-13051943 CTTTGTACAAAAAAGAAAGATGG + Intronic
1154381822 18:13858731-13858753 CTGGGCAAGAAGAACAAAGCTGG - Intergenic
1155141641 18:23049675-23049697 CTGTCTCAAAAGAAAAAAGAAGG + Intergenic
1155424964 18:25697348-25697370 CTGTGTAGGAAGGAGAAACATGG + Intergenic
1155514673 18:26612472-26612494 CTTTGTAAGAAGAGGAAACTTGG + Intronic
1155872720 18:31047186-31047208 CTGAGTAAAAAGAAGACTGATGG - Intergenic
1156013559 18:32522302-32522324 CTTTGTAAGAAGAAGAGATTAGG - Intergenic
1156093124 18:33495208-33495230 CTGTAATAAAAGAAGAAAGAGGG + Intergenic
1156126594 18:33913247-33913269 TTGTGTGATAAGAAGAAACAGGG - Intronic
1156135924 18:34037463-34037485 CTGAGTAAAAAGAACAAAGCTGG + Intronic
1156354009 18:36325706-36325728 CAGAGTAAGAAGAAAAGAGAGGG - Intronic
1156606662 18:38674375-38674397 CTTTGTAACAAGAATAAAGGTGG + Intergenic
1156689429 18:39688958-39688980 CTCTAGAAGAAAAAGAAAGAAGG + Intergenic
1156711427 18:39951159-39951181 TTGTTTTAGAAAAAGAAAGAGGG + Intergenic
1156811103 18:41252800-41252822 ATGTGTAATGAGAAGGAAGAAGG + Intergenic
1157104857 18:44764443-44764465 CGAAGAAAGAAGAAGAAAGAAGG - Intronic
1157131494 18:45011810-45011832 CAGTCTCAGAAGATGAAAGATGG + Intronic
1157826993 18:50821286-50821308 CTCTGGAGGAGGAAGAAAGATGG + Intronic
1158060921 18:53340416-53340438 CTGCAAAAGAAGATGAAAGAAGG + Intronic
1158621686 18:59038123-59038145 CTTATTAAGGAGAAGAAAGAAGG + Intergenic
1159248334 18:65839325-65839347 CTGTGTATGAACCAGAAAGAGGG - Intronic
1159472710 18:68878623-68878645 CTGTGTATGAACCAGAAAGCAGG + Intronic
1160264594 18:77329314-77329336 TTGAGAAAGAAAAAGAAAGATGG + Intergenic
1160303143 18:77704712-77704734 CTTGGTAAGAGGAAGAAATAGGG - Intergenic
1160695079 19:479851-479873 GTGGGGAAGAAGAAGAGAGAAGG - Intergenic
1160702673 19:515730-515752 CTGTCTCAAAAAAAGAAAGAGGG + Intronic
1161571433 19:5032843-5032865 CTGTGGAGGAAGACGAGAGAGGG - Intronic
1162113522 19:8414272-8414294 CTGTCTAAAAAAAAAAAAGACGG - Intronic
1162262861 19:9546708-9546730 CTGTGTAAGAGCAGGAAAAAAGG - Intergenic
1162456381 19:10787464-10787486 CTGTTTAAAAAAAAGAAAAAAGG + Intronic
1162906864 19:13829288-13829310 TTGTTTAACAAAAAGAAAGAGGG + Intronic
1163199318 19:15752719-15752741 CTGTCAGAGAAGCAGAAAGAAGG - Intergenic
1164035174 19:21447710-21447732 CTGGGCAAGAAGAACAAAGCTGG - Intronic
1164441199 19:28282077-28282099 TCGGGGAAGAAGAAGAAAGAAGG - Intergenic
1164500342 19:28814455-28814477 CTTTATAAGAAGAGGAGAGAGGG - Intergenic
1164728545 19:30483562-30483584 TTGTTTAAGAAGCAGAAAGAGGG - Intronic
1164773632 19:30833051-30833073 GGATGTAAGAAGAAGAAAAAAGG + Intergenic
1165312487 19:35037249-35037271 CTGTGTTAGGAGAAGGCAGATGG + Intronic
1165332403 19:35147986-35148008 CTGTCTCAAAAAAAGAAAGAAGG + Intronic
1165438777 19:35812115-35812137 CTGTGTAAGGAGTGCAAAGACGG - Exonic
1166887719 19:45972168-45972190 GTGTGTAAAAAGGAGAAGGAAGG - Intronic
1167357716 19:49014461-49014483 CTGAGGAAGAGGCAGAAAGAGGG - Intronic
1167696904 19:51020094-51020116 CTGTGGAAGAGGAAGGAGGAAGG + Intronic
1167853321 19:52218228-52218250 CTGTGTATAAAAAAGAAAGAAGG - Intronic
1168050444 19:53825760-53825782 CTTTATAAGAAGAAGACAGGAGG + Intergenic
1168341455 19:55625580-55625602 CTATAAAAGAAGAAGAAAGGAGG - Intergenic
927235592 2:20871590-20871612 CTGATGAAGAAGGAGAAAGAAGG + Intergenic
927510907 2:23643075-23643097 CGGGGTAAGAAGAGGAAGGAAGG + Intronic
927579428 2:24228730-24228752 CTGTGTCAGCAGAACAAAAAGGG + Intronic
927815205 2:26209801-26209823 CTGTGCAAGAAGAATAAATTTGG - Exonic
928773290 2:34728165-34728187 ATTTTTAAAAAGAAGAAAGATGG + Intergenic
929259072 2:39844690-39844712 CTGCCTATGAAGATGAAAGAAGG - Intergenic
929897263 2:45972953-45972975 CTGAGTTAAAAGAACAAAGATGG + Intronic
929948031 2:46384958-46384980 GTGTGTGAGAAGGAGAAGGAGGG - Exonic
930323748 2:49886879-49886901 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
930532008 2:52600334-52600356 CTGTGTAAGAAAAAGCTACATGG - Intergenic
930535268 2:52637988-52638010 AAGTGGAAGAAGAAGGAAGAAGG - Intergenic
930926664 2:56826563-56826585 CTGAATTAGAAGAATAAAGATGG + Intergenic
931594934 2:63931204-63931226 CTGGGCAAGAAGAACAAAGCTGG + Intronic
931675355 2:64689499-64689521 AGGAATAAGAAGAAGAAAGAGGG + Intronic
931795529 2:65705678-65705700 TTGAGAAAGAAGAAGAAAGTGGG + Intergenic
932006777 2:67935232-67935254 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
932288803 2:70557854-70557876 CTGTGTATGAGAAAGAAAGAGGG + Intergenic
932327625 2:70873537-70873559 CTGTTAAAGAAGGAGACAGAAGG - Intergenic
932752627 2:74380947-74380969 TTGTGCTACAAGAAGAAAGAAGG - Intronic
932911886 2:75814996-75815018 CTTTATAAGAGGAAGACAGAGGG - Intergenic
933203791 2:79481799-79481821 CTTTAAAAGAAGAAGACAGACGG + Intronic
933323546 2:80807566-80807588 CTGAGTAAAAAGAACAAAGCTGG + Intergenic
933642108 2:84774504-84774526 CCGTGTAAAAAGAACAAAGCTGG - Intronic
933693184 2:85195549-85195571 CTGTCTCAAAAAAAGAAAGAAGG - Intronic
934126235 2:88893701-88893723 CTGTGGAAAAGGAAGTAAGAGGG + Intergenic
935021244 2:99234520-99234542 CTGGGCAAGAAGAACAAAGCTGG + Intronic
935567533 2:104625174-104625196 CTGGGCAAGAAGAACAAAGCTGG - Intergenic
936281955 2:111149330-111149352 TTTTGAAAGGAGAAGAAAGAGGG - Intronic
936690492 2:114882499-114882521 CTATGGAAGAAGAAGAAAGGTGG + Intronic
937129430 2:119496568-119496590 AAGTGGAAGAAGAAGACAGATGG + Intronic
937773978 2:125753899-125753921 AGATGTAAGAAGAAGAAAGTGGG - Intergenic
938283177 2:130082204-130082226 CTTTCTAAGAAGAAGAAAAAGGG - Intronic
938333810 2:130470770-130470792 CTTTCTAAGAAGAAGAAAAAGGG - Intronic
938356007 2:130649897-130649919 CTTTCTAAGAAGAAGAAAAAGGG + Intronic
938432433 2:131256696-131256718 CTTTCTAAGAAGAAGAAAAAGGG + Intronic
938476453 2:131618960-131618982 CTTTCCAAGAAGAAGAAAAAGGG + Intergenic
939073620 2:137573025-137573047 CTTTGGAAGAAGTAGAAACATGG - Intronic
939290561 2:140188917-140188939 CTGTGTGAGAAGATAAAATATGG - Intergenic
939673458 2:145042542-145042564 CTGCCTAAGAAGAAGATAAAAGG + Intergenic
939706822 2:145465172-145465194 CAGGAAAAGAAGAAGAAAGAAGG + Intergenic
939932140 2:148248692-148248714 CTGAGGAAGAAGAATAAAGTAGG + Intronic
940425159 2:153523264-153523286 ATATGTAAGAAGAACAAAGTTGG - Intergenic
940461877 2:153974836-153974858 ATGTGTAAGGAAAAGAAAGTTGG + Intronic
940663146 2:156572758-156572780 AGGTGTAAGAAGATGCAAGAGGG + Intronic
940730909 2:157390158-157390180 CTAAGCAAAAAGAAGAAAGATGG - Intergenic
940923949 2:159342965-159342987 CTGAGTAACAAGAACAAAGCTGG + Intronic
940964949 2:159826656-159826678 CTGGACAAGAAGAACAAAGATGG + Intronic
941041037 2:160624034-160624056 CTGGGCAAGAAGAACAAAGCTGG - Intergenic
941368359 2:164634215-164634237 CTTTGTGAGAAGAAGAAATTTGG + Intergenic
941584764 2:167343828-167343850 CTGTATTAGAAGGGGAAAGATGG + Intergenic
941595838 2:167475979-167476001 CTTTGTAAAAAGAAGAAATGTGG - Intergenic
941729890 2:168905825-168905847 CTTTGAAAGAAGAAGTAAGTGGG - Intronic
941801254 2:169662403-169662425 ATGAGGAAGAAGAGGAAAGAAGG - Exonic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942271587 2:174280981-174281003 CTTAGTTAGAAAAAGAAAGAAGG - Intergenic
942566534 2:177269688-177269710 TTTTATAAGAAGAAGAAAAAAGG + Intronic
942706498 2:178778778-178778800 TTGTGTAAGAAGAAAATCGAGGG - Intronic
942722664 2:178970320-178970342 CTGGGCAAGAAGAACAAAGCTGG + Intronic
942766602 2:179464789-179464811 CTGGGCAAGAAGAACAAAGCTGG - Intronic
942981225 2:182084704-182084726 CTGTGTAAGATGAACAAATCTGG - Intronic
943569784 2:189559737-189559759 CTGTGTAGGAAGAAGAAGCATGG - Intergenic
943612291 2:190047286-190047308 ATGGGAAAGAAGAAGGAAGAAGG - Intronic
943712934 2:191117940-191117962 CTGTTCAAGAGGAAGATAGATGG + Intronic
943954457 2:194170281-194170303 CTGTGTAGAAAGAATAAAAATGG - Intergenic
944008451 2:194941174-194941196 CTGGGCAAGAAGAACAAAGTTGG + Intergenic
944180729 2:196889936-196889958 CTGTCTCAGAAGAAAAAAAAGGG - Intronic
944452491 2:199857191-199857213 CTGTGGAAGAAGTAGATACAGGG - Intergenic
944616571 2:201466042-201466064 CTTTGTAAGAATAAAAAATAAGG - Intronic
945110990 2:206359481-206359503 CTGAGTAAAAAGAACAAAGATGG + Intergenic
945161439 2:206895656-206895678 CTGGGCAAGAAGAACAAAGCTGG - Intergenic
945347442 2:208734761-208734783 CTGAGCAAGAAGAAAAAAGCTGG - Intronic
945586637 2:211673186-211673208 CAGTGTGAGAAGATGGAAGATGG - Exonic
945974839 2:216262337-216262359 ATGTGGAAGAAGAAGAAACCTGG + Intronic
946013486 2:216585190-216585212 CTTTATAAGAAGAAGAAATGAGG + Intergenic
946467593 2:219925788-219925810 CCTTGTAAGAAGAAGAAAGTTGG + Intergenic
946528534 2:220546604-220546626 CTGCTGGAGAAGAAGAAAGAAGG - Intergenic
946594058 2:221286415-221286437 CTTTGTAAGAAGAGGAAATTTGG - Intergenic
947045073 2:225972661-225972683 GTCTGTAAGTAGAAGAAAGCAGG - Intergenic
947072458 2:226305655-226305677 ATGTGTAACAAGAAAGAAGAGGG + Intergenic
947105411 2:226663356-226663378 GTTTATAAGATGAAGAAAGAAGG - Intergenic
947280654 2:228450021-228450043 CTTTATAAGAAGAAGAAATTTGG + Intergenic
947341177 2:229141371-229141393 CTCTGGAAGGAGAATAAAGAGGG + Intronic
1168967934 20:1910914-1910936 TTTTGTAAGAAAAAAAAAGATGG - Intronic
1169852782 20:10070678-10070700 CAGAGTAGGAAGAAGAGAGAGGG + Intergenic
1169985414 20:11437933-11437955 CTTTGTAAAATGAAGGAAGAAGG + Intergenic
1170596033 20:17806634-17806656 CAGGGTAAGGAGGAGAAAGAAGG + Intergenic
1171308235 20:24124246-24124268 CTGTGAGATAAGAAGAGAGATGG + Intergenic
1172875097 20:38159204-38159226 GAGTGAAAGAAGAGGAAAGAAGG + Intronic
1173141119 20:40483905-40483927 CTCTGAGAGAAGCAGAAAGAAGG - Intergenic
1173146016 20:40524949-40524971 ATGTGCATGAAGAAGAAAGCAGG - Intergenic
1173162605 20:40663785-40663807 GTGTGTTGGAAGAAGAGAGAAGG + Intergenic
1174962593 20:55175077-55175099 GTGTGTAATAAGAAAAAAGGGGG + Intergenic
1175055572 20:56194415-56194437 CTGAGAAAAAAGAAAAAAGAGGG - Intergenic
1175534849 20:59702374-59702396 CTGAATAAAAAGAAGAAAAAAGG - Intronic
1175613159 20:60368985-60369007 CTGGGCAAGAAGAACAAAGCTGG - Intergenic
1175671940 20:60910806-60910828 CTGTATAAAAAGAAGAAAGTTGG - Intergenic
1176778713 21:13166755-13166777 CAGGCTAAGAAGAACAAAGAAGG + Intergenic
1176925857 21:14748075-14748097 ATGTTTAAGAATAAGAAAAATGG + Intergenic
1177071142 21:16510074-16510096 CTGTGAAATAAGACAAAAGAGGG + Intergenic
1177077903 21:16600553-16600575 ATGTGTAGGAAGAACAAAAATGG + Intergenic
1177390382 21:20461031-20461053 TTGAGTAAGAAGAACAAAGCTGG + Intergenic
1177558540 21:22721039-22721061 CTGGGTTAGAAGAATAAGGATGG + Intergenic
1177854836 21:26388896-26388918 GTGTATAACAGGAAGAAAGAAGG + Intergenic
1178160132 21:29902831-29902853 CTGGGCAAGAAGAACAAAGCTGG + Intronic
1178382075 21:32118938-32118960 ATGCGAAAGAAGAAGAAAGTAGG - Intergenic
1178716911 21:34973327-34973349 CTGTGAATGGAGAAGAACGAGGG + Intronic
1178897216 21:36568760-36568782 GTCTGTGAGAAGAGGAAAGAGGG - Intronic
1179567999 21:42261139-42261161 CCGTACTAGAAGAAGAAAGAGGG - Intronic
1180476527 22:15714638-15714660 CTTTCTAAGAAGAAGAAAAAGGG + Intronic
1181405008 22:22678088-22678110 CTGAGTGAGAACAAGAAAAATGG + Intergenic
1181408162 22:22699736-22699758 CTGAGTGAGAACAAGAAAAATGG + Intergenic
1181413482 22:22743041-22743063 CTGAGTGAGAACAAGAAAAACGG + Intronic
1181780706 22:25190896-25190918 CTGTGTAAGGGGAAGAATGAGGG + Intronic
1182018860 22:27064032-27064054 CAGGGTGAGAAGAAGAAAGAAGG + Intergenic
1182178101 22:28314413-28314435 CTGGGCAAGAAGAACAAAGCTGG + Intronic
1183108010 22:35628501-35628523 CTGTGTTAGCAGAATAAGGATGG - Intronic
1183245898 22:36693139-36693161 CTGTCTAAAAAAAAGAAAAAAGG + Intronic
1183291956 22:37008147-37008169 CTGTGTAGGAAAAAGGAGGAAGG + Intergenic
1184925976 22:47637686-47637708 CTAGGGGAGAAGAAGAAAGATGG + Intergenic
949111825 3:270253-270275 CTGTGTTTGAAGAAAAAAAATGG + Intronic
949147878 3:725463-725485 TTGTGTCAGAAGAAAAAAGCAGG - Intergenic
949217498 3:1587341-1587363 CTCTGCAAGAAGAAAAAATATGG - Intergenic
949721142 3:6991560-6991582 TTGAGAAAGAAGAAGAAAAATGG + Intronic
949839932 3:8308936-8308958 TTGAGCAAGAAGAAGAAAGCTGG + Intergenic
950214816 3:11151983-11152005 TTGTGGAAGAAGCAGAAAAAAGG - Intronic
950248971 3:11448249-11448271 CTGTGTAGCAAGGAGAAAGGAGG - Intronic
950383593 3:12638037-12638059 CTGAGTAAAGAGAAGAATGATGG - Intronic
950417922 3:12879146-12879168 CTGTTCCAGATGAAGAAAGAAGG + Intergenic
950951230 3:17001797-17001819 CTGAGTAAAAAGAACAAAGCTGG - Intronic
951117934 3:18886901-18886923 ATGTGTAAGATGGAGAGAGATGG - Intergenic
951282362 3:20767774-20767796 CTGAGTAAAAAGAACAAAGCTGG - Intergenic
951810967 3:26699549-26699571 TTGTGTAAGAAGGATAAAGCAGG + Intronic
951977656 3:28530897-28530919 CTGAGTAAAAAGAACAAAGCTGG + Intronic
952162128 3:30704518-30704540 CTGTATAAGAAAGAGAAAGATGG - Intergenic
952405024 3:32997792-32997814 CTGGGAAAGGAGAACAAAGAAGG - Intronic
952683903 3:36128465-36128487 CTAAGTAAGAAGAACAAAGCTGG + Intergenic
952773532 3:37023028-37023050 CAATCTAAGAAGCAGAAAGATGG - Intronic
952864882 3:37848323-37848345 CTGTGTAAGAAGGAGAAGCCAGG + Intergenic
953529699 3:43729229-43729251 ATGTGTGAGAAGTGGAAAGAAGG + Intronic
953896584 3:46807845-46807867 CTGATGAGGAAGAAGAAAGAAGG + Intronic
954055113 3:48016694-48016716 CTGTGTTAGAGGAAGGAAGTGGG - Intronic
954280353 3:49572868-49572890 CTGTGTGTGCAGAAGAAAGGAGG + Intronic
954534466 3:51348829-51348851 CTGTGTCAGAAACAGAAACAGGG - Intronic
955303322 3:57805532-57805554 CAGTGTTAGAAGTAGTAAGAGGG - Intronic
955305299 3:57824690-57824712 CTGAGAAAGAAGAACAAAGTTGG - Intronic
955365127 3:58304303-58304325 CTCTGAAGGAAGAAGAAAGTAGG + Intergenic
955572095 3:60319021-60319043 CTTTGTAAGAAGAGGAAGGCAGG - Intronic
955742726 3:62109486-62109508 CTGGGCAAGAAGAACAAAGCTGG - Intronic
955897061 3:63711694-63711716 ATGTGAAAGATGAAGACAGAAGG - Intergenic
956034372 3:65074322-65074344 CTCTGTGAAACGAAGAAAGAAGG + Intergenic
956668283 3:71662604-71662626 CTCAGGTAGAAGAAGAAAGAAGG + Intergenic
957144054 3:76398869-76398891 CTGAGTATGAAGATGGAAGAAGG + Intronic
957404665 3:79762205-79762227 CTGTCTATGAAGCAGAAAGTGGG - Intronic
957450733 3:80378605-80378627 CTGTCTATGAATCAGAAAGAAGG - Intergenic
957767636 3:84647089-84647111 CAGTGTAAAAACAAGAAAGCTGG - Intergenic
957773941 3:84730781-84730803 CTGTGTGAGAAGAAAGAGGAAGG - Intergenic
958122512 3:89309838-89309860 TTGTGAAAAGAGAAGAAAGAAGG - Intronic
958621675 3:96570733-96570755 CTGGGCAAGAAGAACAAAGCTGG - Intergenic
959314727 3:104788830-104788852 TTGTACAAAAAGAAGAAAGAAGG + Intergenic
959568011 3:107852535-107852557 CTGTGTATGAACCAGGAAGAGGG + Intergenic
959836418 3:110923675-110923697 CTGGGTCCGAAGAAGACAGAAGG + Intergenic
959933457 3:112006528-112006550 CTCTGTAAGTCCAAGAAAGATGG + Intronic
959935000 3:112020117-112020139 CTGTGTAAAAGGAATAAAGATGG + Intergenic
960265664 3:115618376-115618398 CTTTCTAAGAAAGAGAAAGATGG + Intergenic
960656333 3:120008408-120008430 CTGGGCAAGAAGAACAAAGCTGG + Intronic
960812148 3:121635669-121635691 CTGGGGAAGAAAAAGAATGAGGG + Intronic
961323822 3:126097926-126097948 CTGTGTAAGGGGGAGACAGAGGG - Intronic
961625950 3:128263912-128263934 AAGTGAAAGAAGAAGAAACAAGG - Intronic
962018707 3:131473111-131473133 CTGAGTAAGAATAAAAAAGCTGG + Intronic
962096626 3:132299169-132299191 ATGTGTCAGAAAAAGAAAAATGG - Intergenic
963332005 3:143924976-143924998 ATGTGTTAGAAAATGAAAGAAGG - Intergenic
963358809 3:144244542-144244564 TTGTGGAAGAAGAAGGAAGCAGG + Intergenic
963489351 3:145979751-145979773 CTCTGTATGAAGAAGAAATGGGG - Intergenic
963923642 3:150929020-150929042 CTGTGGAAAAACAAGAAAGAGGG + Intronic
964114808 3:153124693-153124715 CTGAGTAAAAAGAACAAAGCTGG - Intergenic
964264574 3:154879677-154879699 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
964265948 3:154895630-154895652 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
964426166 3:156555728-156555750 CTCTGTAGGAAGAAGAAAATGGG + Intergenic
964635729 3:158856812-158856834 CTGTGTAAGGAGGCTAAAGATGG + Intergenic
965654637 3:170970897-170970919 CTGGGCAAGAAGAACAAAGCTGG - Intergenic
966138189 3:176725041-176725063 CTGAGTAAAAAGAACAAAGCTGG - Intergenic
966255925 3:177916989-177917011 CCGTGTTAAAAGAAGAGAGATGG + Intergenic
966292613 3:178378016-178378038 CCCAGAAAGAAGAAGAAAGAAGG + Intergenic
966421153 3:179735701-179735723 TTATGTTAAAAGAAGAAAGAAGG - Intronic
966521895 3:180882295-180882317 CGGAGGAAGAAGAAGGAAGAAGG - Intronic
966527186 3:180931982-180932004 CTTTGGAAGAACAAGAAAGGCGG - Intronic
966571690 3:181451263-181451285 CTGTCTAAAAAGGAGAAAGAGGG + Intergenic
966637496 3:182152139-182152161 CTGGGCAAGAAGAACAAAGCTGG - Intergenic
967054303 3:185815512-185815534 TTGTGTAAGAAGGATAAAGACGG + Intronic
967232684 3:187355215-187355237 GAGAGAAAGAAGAAGAAAGAAGG - Intergenic
967489820 3:190077433-190077455 GTGTGTAAAAAAGAGAAAGAAGG - Intronic
967640875 3:191861710-191861732 CTGTGTGAAAAGAAAAAACAGGG + Intergenic
968000510 3:195202572-195202594 CAGTGAAAGCTGAAGAAAGATGG - Intronic
968075825 3:195815767-195815789 CTGTGTAAGAAGAAGGAGGCCGG - Intergenic
968075957 3:195816262-195816284 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076144 3:195816953-195816975 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
969007871 4:4036294-4036316 CTGTCTAAGAAAAAAAAAAAAGG - Intergenic
969030664 4:4210519-4210541 CTTTATAAGAAGAGGAGAGAAGG - Intronic
969305913 4:6326247-6326269 GTGTGTAAGAAGAAGCAGGGAGG + Intronic
969309065 4:6341697-6341719 CTGTATAGGAGGAAGAAGGAAGG + Intronic
970027996 4:11644376-11644398 ATGAAAAAGAAGAAGAAAGAAGG - Intergenic
970076661 4:12229635-12229657 CTGTCTATGAATAAGAAAGCAGG + Intergenic
970115752 4:12694298-12694320 CTGTGTAAGAACAGGAACTATGG + Intergenic
970251241 4:14118187-14118209 CTGTGAAAGAAGAAGACTAAAGG + Intergenic
970274658 4:14385495-14385517 AAGTGGAAGAAGAAGACAGAAGG + Intergenic
971100122 4:23457203-23457225 CTGTTTAAGAAAAAGAATGCAGG - Intergenic
971659161 4:29389810-29389832 CTGTGTAGCTAGAAGCAAGATGG - Intergenic
971806650 4:31367007-31367029 CTCTGTAAGATGAAGGAGGAAGG + Intergenic
971885072 4:32434446-32434468 CTGTGGTAAAAGAATAAAGAAGG - Intergenic
971970975 4:33620027-33620049 TTGTGGAAGAAGCAGACAGAGGG + Intergenic
972103926 4:35459122-35459144 CTGTGTAAAATGAAGATAAAAGG - Intergenic
972147741 4:36049053-36049075 CTGAGAAAGAAGAACAAAGCTGG - Intronic
972183175 4:36494994-36495016 CTGTGTAGGAAGAATATAAACGG + Intergenic
972983957 4:44740985-44741007 TTGTGTAATAAGAAAAGAGATGG - Intergenic
973313205 4:48731483-48731505 CTGGGCAAGAAGAACAAAGCTGG + Intronic
973595780 4:52488010-52488032 CTGTCAAAAAAGAAGAAAAAAGG + Intergenic
973670035 4:53207766-53207788 CCGAGAAAGAAGAAGAGAGAAGG - Intronic
974243149 4:59278668-59278690 CTGAGTAAAAAGAAGACAGCTGG + Intergenic
974248411 4:59353448-59353470 CTGTGTAAGAAGAACAAAGCTGG - Intergenic
974618525 4:64323571-64323593 CTGTGTGAAAAATAGAAAGAAGG + Intronic
974641138 4:64632274-64632296 CTGGGCAAGAAGAACAAAGCTGG - Intergenic
974720293 4:65729291-65729313 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
975501956 4:75096445-75096467 CTGGGAAAGAAGAACAAAGCTGG - Intergenic
975712940 4:77178660-77178682 CTGTGGAAGGAGAAGGAAGAGGG + Intronic
975796644 4:78012922-78012944 CTGTGTACCAAGAAGAATGATGG - Intergenic
975807035 4:78123418-78123440 CTGGGCAAGAAGAACAAAGCTGG - Intronic
976093213 4:81478644-81478666 CTGGGCAAGAAGAACAAAGCTGG + Intronic
976159982 4:82188819-82188841 TTGGGTAAGAAGAACAAAGCTGG + Intergenic
976229937 4:82832107-82832129 CTGGGCAAGAAGAACAAAGCTGG + Intronic
976862003 4:89676640-89676662 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
976895160 4:90100398-90100420 CTGTGAAATTAGAAGCAAGATGG + Intergenic
977015344 4:91685319-91685341 CTGTGTTAGTAGAGAAAAGAAGG - Intergenic
977052622 4:92148760-92148782 CTGAGCAAGAAGAACAAAGCTGG + Intergenic
977057655 4:92213758-92213780 CTGAGCAAGAAGAACAAAGCTGG + Intergenic
977145263 4:93431778-93431800 CTAAGGAAGAAAAAGAAAGAAGG + Intronic
977177730 4:93836590-93836612 CTCTGAAAGAAATAGAAAGATGG + Intergenic
977232598 4:94469483-94469505 GTGTTTAAGAAATAGAAAGAAGG + Intronic
977314899 4:95433868-95433890 CTGTGTGAGAAAAAGAGAGAAGG - Intronic
977385924 4:96339077-96339099 CTGTGCAAAAAGAACAAAGCTGG + Intergenic
977407941 4:96623825-96623847 CTGAGAAAGAAGAACAAAGCTGG - Intergenic
978119869 4:105065518-105065540 CTGTGAAAGATGAAGAAGGAAGG + Intergenic
978303648 4:107297839-107297861 TTGTAGAAGAAGAACAAAGATGG + Intergenic
978312844 4:107404702-107404724 CTGTCTAGGAAGAGGAAAAATGG - Intergenic
978915925 4:114125858-114125880 CAGTGCCAGAAGAAGAAAGCAGG + Intergenic
979173485 4:117631920-117631942 TTGAGCAAGAAGAATAAAGATGG + Intergenic
980088735 4:128418979-128419001 CTGAGTAATAAGAAAAAATAAGG + Intergenic
980803962 4:137788343-137788365 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
981189424 4:141843471-141843493 CTGTGTAAGAATAAACAAAAAGG + Intergenic
981194986 4:141908903-141908925 CTTTATGAGAAGCAGAAAGAAGG + Intergenic
982336777 4:154248636-154248658 CTAAGTAAAAAGAAGAAAGCCGG + Intronic
982523695 4:156451878-156451900 CTGTTTATGAACAAGAAAGCAGG - Intergenic
983196340 4:164811036-164811058 CTGTCTAAAAAGAAGGAAGGAGG + Intergenic
983566790 4:169161842-169161864 CAGAGTAAGAAGTAGAAAAATGG + Intronic
983788471 4:171763620-171763642 CTGGGCAAGAAGAACAAAGTTGG + Intergenic
983795160 4:171853356-171853378 GAGTGTAAGAAGGGGAAAGAAGG - Intronic
983905541 4:173177507-173177529 GTGTGTATTAAGAAGAAACATGG + Intronic
984079038 4:175219840-175219862 CTGAGAAAGAAAAAGAAAGCTGG - Intergenic
984445864 4:179834565-179834587 CTGTGAAAGACAAACAAAGATGG - Intergenic
984660567 4:182369871-182369893 CTGTCTCAAAAAAAGAAAGAAGG + Intronic
984929498 4:184834310-184834332 CTGTGTAATATAAAGAAATAAGG - Intergenic
985253809 4:188049651-188049673 CTTTGTAAGAAGAGGAAATTGGG + Intergenic
985257896 4:188087679-188087701 GTGTGTCAGATGGAGAAAGAGGG + Intergenic
986012209 5:3726283-3726305 CTGTGTGAGAATCGGAAAGAAGG + Intergenic
986087964 5:4471335-4471357 ATAGGTAAGAATAAGAAAGAGGG - Intergenic
986148236 5:5100934-5100956 TTGAGCAAGAAGAAGAAAGCTGG - Intergenic
986179368 5:5379085-5379107 CTGTGTGGGAACAAAAAAGAAGG - Intergenic
986468506 5:8050689-8050711 CTGTATAAGAAGGAGAAGGAAGG + Intergenic
986933742 5:12857774-12857796 CTGTGTAACAAAAAGAGAGAGGG - Intergenic
987165424 5:15193352-15193374 CTGTTTATGAAGGAGCAAGAAGG - Intergenic
987229859 5:15882534-15882556 CTGTGTAAGAAGAATGGGGAAGG - Intronic
987272680 5:16328186-16328208 ATGGATAATAAGAAGAAAGATGG + Intergenic
987569828 5:19642376-19642398 TTGAGTAAGAAGAACAAAGGTGG + Intronic
987643261 5:20638308-20638330 CTGAGTTAGAAGAATAAAGCTGG + Intergenic
987665150 5:20927688-20927710 CTGAGCAAAAAGAAGAAAGATGG - Intergenic
987908522 5:24111070-24111092 TTGTGTAAGAAAAGGAAAGGAGG + Intronic
988235162 5:28533943-28533965 TTGAGCAAGAAGAAGAAAGTTGG - Intergenic
988757537 5:34274494-34274516 CTGAGCAAAAAGAAGAAAGATGG + Intergenic
988921244 5:35944947-35944969 CCATGTAAGAAGCAGAGAGAAGG + Intergenic
989239755 5:39190308-39190330 ATGAGAAAGAAGAAGAAAGTGGG + Intronic
989543422 5:42644447-42644469 TTATGTAATAAGAAGAGAGAGGG + Intronic
989704454 5:44311902-44311924 CTGTGAAGGAATAGGAAAGAAGG - Intronic
990023130 5:51153288-51153310 CTGAGCAAGAAGAACAAAGCTGG + Intergenic
990351606 5:54922654-54922676 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
990513781 5:56513682-56513704 ATGGGTAAGAAGAGGAAAAATGG + Intronic
990703629 5:58502306-58502328 CTGTGTATGTAGCAGCAAGAAGG + Intergenic
990928005 5:61051556-61051578 ATGTGGGAGAAAAAGAAAGAAGG - Intronic
991202891 5:64014769-64014791 GTGTCTATGAAGAAGGAAGAGGG - Intergenic
991506832 5:67333809-67333831 CTGAGTAAGAATAATAAAGGAGG - Intergenic
991644579 5:68788882-68788904 TAGTGTAAGAAGAACAAAAATGG + Intergenic
991961933 5:72053641-72053663 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
992240072 5:74759048-74759070 CTGTGTAAAAACTAGAAAAATGG + Intronic
992378550 5:76214467-76214489 TTGAGCAAGAAGAAGAAAGCTGG - Intronic
992756895 5:79915646-79915668 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
992789805 5:80203093-80203115 CTGTGATAGAATAAGAAACATGG + Intronic
993354755 5:86892235-86892257 TTGTGTGAGAAGGAGAAGGAAGG - Intergenic
993791315 5:92215057-92215079 CTAAGTAAAAAGAAGAAAGCTGG - Intergenic
993819650 5:92599351-92599373 CTCAGTAAGAAGAAGGAACAGGG + Intergenic
993907225 5:93636524-93636546 CTGTCTATGAAAAAGAAAGCAGG + Intronic
994110765 5:96001357-96001379 CTGGGGAAGAAGAATCAAGAAGG + Intergenic
994178146 5:96734465-96734487 CTGTGATAGAATAAGAAAGTGGG + Intronic
994248135 5:97504439-97504461 CTAAGTAAGTAGAAGAAATAAGG + Intergenic
994820503 5:104644782-104644804 AAGTATAAGATGAAGAAAGAGGG - Intergenic
995093498 5:108208752-108208774 CTGTGCAAGAAGAACAAAGCTGG - Intronic
995112497 5:108443194-108443216 CTGGGCAAGAAGAACAAAGATGG + Intergenic
995291707 5:110463889-110463911 CTGTGTAAGGGGTAGAAATAAGG - Intronic
995642555 5:114274278-114274300 CTGGGCAAGAAGAACAAAGCTGG - Intergenic
995774432 5:115710525-115710547 ATGTGGGAGAACAAGAAAGAGGG - Intergenic
996054779 5:118970419-118970441 CTGTCTCAGAAAAAGAAAAAAGG + Intronic
996106214 5:119507029-119507051 CTCTTTAAGAAAAATAAAGAAGG + Intronic
996146777 5:119986594-119986616 CTGGGCAAGAAGAACAAAGTTGG - Intergenic
996181747 5:120427849-120427871 CTAAGTAAGAAGAACAAAGCTGG - Intergenic
996242472 5:121220964-121220986 CTGGGTTTCAAGAAGAAAGATGG + Intergenic
996281056 5:121729355-121729377 TTGTTTAATAAAAAGAAAGAAGG + Intergenic
996370344 5:122746672-122746694 ATGTGTAAGAAAAGGAAAGAGGG + Intergenic
997303416 5:132822796-132822818 CTATGTAAGGAGAAGAGGGAAGG + Exonic
997378589 5:133418210-133418232 CTGATCAAGAAGAAAAAAGATGG + Intronic
997454849 5:134008888-134008910 CTGGGTAGGAAGAATCAAGATGG + Intergenic
997566275 5:134889227-134889249 CTGTGTCAAAAAAAGAAAAAGGG - Intronic
997587784 5:135053941-135053963 CTGGGAAAGAATAAGAAACAAGG - Intronic
997792632 5:136774891-136774913 CTGTGTAGGAATAAGAAAATTGG - Intergenic
998138546 5:139687315-139687337 CTGTGCAGGAAGAAGGAAGAAGG + Intergenic
998196445 5:140076937-140076959 CTGCCCAAGAAGAAGAAAGCAGG - Intergenic
998250871 5:140551342-140551364 CAGTGTCAGAAGAAGACAGCAGG - Intronic
998304800 5:141063150-141063172 ATGTGTATGAAGAAGAGACATGG - Intergenic
998411898 5:141917564-141917586 CTGTGTCAGAAGAAAAGGGATGG + Intergenic
998422627 5:142001464-142001486 CTGTGAAAGTGGAAGAAGGAAGG + Exonic
998456490 5:142277857-142277879 CTGTGAATGAAGAACAAAGAGGG - Intergenic
998676224 5:144411234-144411256 CTGAGTAAAAAGAACAAAGCTGG + Intronic
998723974 5:144987832-144987854 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
999651106 5:153768243-153768265 GTGAGAAAGAAGAAGAAAGAAGG - Intronic
1000819004 5:165960410-165960432 CTGTCTCAAAAGAAGAAAAAAGG - Intergenic
1001012972 5:168115286-168115308 CTGTCTCAAAAAAAGAAAGAAGG + Intronic
1001956601 5:175851972-175851994 CTGTGTAGAAAAAAGAAACACGG - Intronic
1002412489 5:179093589-179093611 CTGAGCAAGAAGAACAAAGCTGG - Intergenic
1002625102 5:180521178-180521200 GTGTGAAAGAGGAGGAAAGAGGG + Intronic
1002686279 5:181013195-181013217 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
1002836989 6:873334-873356 CTGTGTAAGAAGAGGAGATTAGG + Intergenic
1003206081 6:4013463-4013485 CTGAGCAAGAAGAACAAAGCTGG + Intergenic
1003408204 6:5840378-5840400 CTGTGTAAGTAGAAGTATGAAGG - Intergenic
1003668363 6:8132417-8132439 CTTTGTAAGAAGAGGAAATGTGG - Intergenic
1004743448 6:18486508-18486530 ATGTGTTAGAAGAGGGAAGATGG + Intergenic
1005364762 6:25065762-25065784 ATGTTTAATAAGAATAAAGATGG - Intergenic
1005713653 6:28526189-28526211 CTGGCAAAGAAGAAGAAAGCAGG - Intronic
1005890176 6:30130976-30130998 CTGTGTAAGAGGAAGAGGGGTGG - Intergenic
1006041992 6:31263842-31263864 CTGGGCAAGAAGAAAAAATATGG + Intergenic
1006279247 6:33035093-33035115 TTGAGGAAGAAGAAGAAAAATGG - Intergenic
1006762879 6:36478888-36478910 TTGTGTACAAAGAAGAATGAAGG - Intronic
1006958171 6:37896171-37896193 CTGTAAAAGAAAAAGAAAAAAGG - Intronic
1007067079 6:39001621-39001643 GAGTGTGGGAAGAAGAAAGAAGG + Intronic
1007298609 6:40848536-40848558 CCGTCTAAGAAGAGGAAATAAGG - Intergenic
1007498435 6:42277839-42277861 ATAAATAAGAAGAAGAAAGAAGG + Intronic
1007724132 6:43904275-43904297 CTGTAGAAGAACAAGAAAGAAGG - Intergenic
1007898369 6:45385921-45385943 CTGAGTAGAAAGAAGAAAAAGGG - Intronic
1008069874 6:47088553-47088575 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
1008191716 6:48466670-48466692 CTGAGTAAGAAGAACAAAACTGG + Intergenic
1008234785 6:49031311-49031333 CTGTGTAAAAAAAAAAAAAATGG + Intergenic
1008251427 6:49244875-49244897 CTGTTAAAGATGAAGAGAGAAGG + Intergenic
1008321938 6:50125056-50125078 CTAAGTAAGAAGAAGAAATCAGG + Intergenic
1008638581 6:53437371-53437393 CTATGCAAAAAGAAGAAAGAAGG - Intergenic
1008698694 6:54072907-54072929 CTGAGGCAGAAGAAGAAAAAAGG - Intronic
1008761608 6:54858810-54858832 CTTTGTCAGAAGAAGAAAGGTGG - Intronic
1009001562 6:57723092-57723114 CTGGGGAGGAAGAAGATAGATGG + Intergenic
1009053067 6:58301663-58301685 CGTGGTAAGGAGAAGAAAGATGG - Intergenic
1009238041 6:61148897-61148919 CGTGGTAAGGAGAAGAAAGATGG + Intergenic
1009313718 6:62190571-62190593 GTGTCTAAAAAGATGAAAGATGG - Intronic
1009550368 6:65084878-65084900 TTGTGGAGGAATAAGAAAGAGGG + Intronic
1009577734 6:65488676-65488698 CTGGGCAAGAAGAACAAAGCTGG + Intronic
1010077206 6:71813166-71813188 CTAAGAAAGAAAAAGAAAGAAGG + Intergenic
1010158877 6:72828170-72828192 CTGAGCAAAAAGAACAAAGATGG - Intronic
1010260395 6:73808840-73808862 GTGTGTAAGAAAGAGAGAGATGG + Intronic
1010355528 6:74928227-74928249 CTGTAAAAGAATAAGAAAAATGG - Intergenic
1010537640 6:77050684-77050706 CTGGGCAAGAAGAATAAAGCTGG + Intergenic
1010681370 6:78803034-78803056 CTATGTAAAAAGAACAAAGCTGG - Intergenic
1010838314 6:80616752-80616774 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
1010865581 6:80973424-80973446 CTGTCTATGAAGATGAAGGAAGG - Intergenic
1010907713 6:81512479-81512501 AAGTGTAAGAAGTAAAAAGAGGG + Intronic
1010928358 6:81770663-81770685 CTTTATAAGAAGAAGAGTGAGGG - Intergenic
1011062593 6:83288596-83288618 CTGGGCAAGAAGAACAAAGCTGG - Intronic
1011116812 6:83902461-83902483 CTGAGCAAAAAGAACAAAGATGG - Intronic
1011199441 6:84819012-84819034 CTGGGCAAGAAGAACAAAGCTGG - Intergenic
1011211551 6:84960866-84960888 CTGCCTAAGTAGAAGAAAGCTGG + Intergenic
1011474614 6:87739097-87739119 CTATCTCAGCAGAAGAAAGAGGG - Intergenic
1011535649 6:88373278-88373300 CTGTGTTAAAAGAAGAAATCAGG + Intergenic
1011985243 6:93435604-93435626 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
1012348476 6:98221649-98221671 CTCCAGAAGAAGAAGAAAGATGG + Intergenic
1012363881 6:98416283-98416305 AGATGTTAGAAGAAGAAAGAAGG - Intergenic
1012603331 6:101126181-101126203 CTCTGTGAATAGAAGAAAGAAGG - Intergenic
1012670294 6:102036567-102036589 ATGTGAAAGAAGTAGAGAGAGGG + Intronic
1012766386 6:103371585-103371607 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
1012878841 6:104761248-104761270 CTGGGCAAGAAGAACAAAGCTGG + Intronic
1012979725 6:105816733-105816755 CTTTGAAGGAAGAAGGAAGAGGG - Intergenic
1012995758 6:105971772-105971794 CTGATAAAGAAGAACAAAGATGG - Intergenic
1013233962 6:108180973-108180995 CTGGGGAAGGAGAAGAAACAGGG - Intronic
1013450724 6:110277915-110277937 ATGTGTAAGAAGCAAAAAGAAGG + Intronic
1013760515 6:113512136-113512158 CTGGAAAAGAGGAAGAAAGAGGG - Intergenic
1013869116 6:114735623-114735645 TTATGTGAGAAGAACAAAGACGG - Intergenic
1014875904 6:126658890-126658912 ATGTGTAGGAAGAAGACAGGTGG + Intergenic
1015046893 6:128787072-128787094 CTAAGTAAAAAGAAGAAAGCTGG - Intergenic
1015727839 6:136317708-136317730 CTGTGTAAGTATGTGAAAGAAGG - Intergenic
1015739598 6:136439617-136439639 GTTTGTAAGATGAAAAAAGAGGG - Intronic
1015757788 6:136625485-136625507 CTGTGAAACAAAAAGAAAGCTGG + Intronic
1016405799 6:143728535-143728557 CTGAGCAAAAAGAAGAAAGCTGG + Intronic
1016544139 6:145201704-145201726 CTGGGAAAGAAGAAAGAAGAAGG - Intergenic
1016763527 6:147767257-147767279 CTGTGGAGGAAGAAGGAAGCAGG + Intergenic
1016857227 6:148683350-148683372 CTGTGTAAACAGGAGACAGATGG - Intergenic
1016948667 6:149559073-149559095 CTGAGCAAGAAGAATAAAGCTGG + Intergenic
1017153821 6:151305064-151305086 CTGTGTAAGAAAAGGATAAACGG - Intronic
1017377871 6:153791572-153791594 CTTTGTAAGAAAATGAGAGATGG + Intergenic
1017418445 6:154246670-154246692 CTGTATAAGAAAAAGGAAAAGGG - Exonic
1017438736 6:154442772-154442794 CTGTGGAAGGAGCAGAGAGAAGG - Intronic
1017964501 6:159252243-159252265 CTGTGTAAGAGGAAGAAGTATGG + Intronic
1018309606 6:162494202-162494224 CTGTGTAAGCTGCAGAATGAAGG - Intronic
1018641873 6:165911478-165911500 CTGTGTAACCAGATGAAAGTTGG - Intronic
1019006526 6:168802286-168802308 CTGAGCAAGAAGAACAAAGCTGG + Intergenic
1020342563 7:7127912-7127934 CTGGGAAAGAAGAAGAAAAGAGG - Intergenic
1020429053 7:8100826-8100848 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
1020574004 7:9902545-9902567 CTGGGCAAGAAGAACAAAGCTGG - Intergenic
1020692209 7:11369482-11369504 CTATGGAAGAAGATGAAAGGGGG + Intergenic
1020802576 7:12749761-12749783 CTGTGGGAGAAGAAGAAAACAGG + Intergenic
1020810394 7:12844228-12844250 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
1020878685 7:13730648-13730670 GTGTATAAGAAAAAGAAGGAGGG - Intergenic
1021224140 7:18008377-18008399 CTGGGAAAGAAGAACAAAGCTGG - Intergenic
1021618269 7:22524651-22524673 CTATGAAAGAGGAAGAAAGCGGG + Intronic
1022346638 7:29522140-29522162 CTGAGTAAAAAGAACAAAGCTGG - Intergenic
1022488420 7:30798341-30798363 CTGTGTTAGAGAAAGAAAGGAGG + Intronic
1022694679 7:32692622-32692644 CTATGAAAGAGGAAGAAAGCAGG + Intergenic
1022927862 7:35074122-35074144 CTATGAAAGAGGAAGAAAGCGGG + Intergenic
1023824770 7:44001647-44001669 CTGTGTCAAAAGAAAAACGAAGG + Intronic
1024150144 7:46563190-46563212 CTAAGTAAAAAGAAGAAAGCTGG + Intergenic
1024533462 7:50411265-50411287 CTGTGGAGCAAGTAGAAAGATGG - Intergenic
1024773488 7:52754360-52754382 CTCTGCAAGAAGAAAAAATATGG + Intergenic
1025011923 7:55404307-55404329 ATTTAAAAGAAGAAGAAAGAAGG - Intronic
1025048985 7:55718171-55718193 CTGAGAAAGAAGAACAAAGCTGG + Intergenic
1026088320 7:67280399-67280421 CTGTGTCAAAAGAAAAACGAAGG + Intergenic
1026658078 7:72274903-72274925 TTGTGTAAAGAGAAGAAATAGGG + Intronic
1026905086 7:74058244-74058266 AGGAGAAAGAAGAAGAAAGAAGG - Intronic
1026934025 7:74241656-74241678 CTGTGTCAGAAAGAGAAGGATGG + Intronic
1027117924 7:75495737-75495759 CTGTGTCAAAAGAAAAACGAAGG + Intergenic
1027273885 7:76539743-76539765 CTGTGTCAAAAGAAAAACGAAGG - Intergenic
1027327331 7:77058795-77058817 CTGTGTCAAAAGAAAAACGAAGG - Intergenic
1027727448 7:81825520-81825542 CTAAGCAAAAAGAAGAAAGATGG - Intergenic
1028084027 7:86614890-86614912 CTGAGAAAGAAGAACAAAGCTGG + Intergenic
1028140201 7:87265050-87265072 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
1028193696 7:87880206-87880228 CTGTGGAGATAGAAGAAAGAAGG - Intronic
1028374413 7:90131469-90131491 CTATGAAAGAGGAAGAAAGCAGG - Intergenic
1028492035 7:91423368-91423390 CTGTGGAAGATGAAGAGAGGGGG - Intergenic
1028817858 7:95168092-95168114 CTGTGCAAAAAGAACAAAGTTGG + Intronic
1029004221 7:97190642-97190664 CTGTGCAAAAAGAACAAAGCTGG + Intergenic
1029119472 7:98257347-98257369 CTGTCTCAAAAGAAAAAAGAAGG + Intronic
1029719580 7:102354318-102354340 CTGTGTCAAAAGAAAAACGAAGG - Intergenic
1029753035 7:102554940-102554962 CTGTGTCAAAAGAAAAACGAAGG + Intronic
1029770986 7:102654032-102654054 CTGTGTCAAAAGAAAAACGAAGG + Intronic
1030294866 7:107913236-107913258 CTGAATAAAAAGAAGAAAGCTGG - Intronic
1030389796 7:108912941-108912963 CGATGTAATATGAAGAAAGATGG - Intergenic
1030429282 7:109421494-109421516 CTGTGGAAGATGAACAAAGCTGG - Intergenic
1031055396 7:116987726-116987748 CCGTGTCAAAAGAAGAAAAAAGG - Intronic
1031096801 7:117429724-117429746 CTGAAAAAGAAGAATAAAGAAGG + Intergenic
1032205254 7:129858656-129858678 CTGGGTAACAAGAAAAATGAAGG + Intronic
1032810847 7:135415263-135415285 CTATAAAAGAAGAAGAAATAAGG + Intronic
1033389430 7:140912453-140912475 CTGTCTTAGAAGAGGTAAGAGGG - Intronic
1033638905 7:143241606-143241628 CTGTGTAGGAAGTAAAAGGAAGG - Intergenic
1033889226 7:145988304-145988326 TTGTGTGTGGAGAAGAAAGAGGG - Intergenic
1034695761 7:153051886-153051908 CTCTGCAGGAAGAAGAGAGACGG + Intergenic
1035105279 7:156436771-156436793 CCATGTAAGAAAAATAAAGATGG - Intergenic
1035626414 8:1074570-1074592 CTTGGTAAGAAGCAAAAAGAGGG - Intergenic
1036521456 8:9495165-9495187 ATGAGTTTGAAGAAGAAAGAGGG - Intergenic
1037107215 8:15123947-15123969 TTGGGCAAGAGGAAGAAAGAGGG + Intronic
1037149366 8:15617029-15617051 CTGTGTAATCAGCAGACAGAGGG + Intronic
1037563613 8:20097389-20097411 CTGAATAAGAAGAATAAGGAGGG - Intergenic
1037606250 8:20439861-20439883 CTGTGGAAGAGGAAGAAACATGG - Intergenic
1037946312 8:22991698-22991720 CTGTGTACCAAGAAGGCAGAGGG + Intronic
1038046546 8:23770046-23770068 ATGTCTCAGAAGTAGAAAGAAGG + Intergenic
1038375227 8:27033539-27033561 CTGGGTAAGAGGAAGCAGGATGG - Intergenic
1039145596 8:34443047-34443069 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
1039146736 8:34455675-34455697 CCTTATAAGAAGAAGAAATATGG + Intergenic
1039280238 8:35976693-35976715 CTATGAAGGTAGAAGAAAGAGGG + Intergenic
1039895140 8:41711927-41711949 CTGTCTAAAAAAAAAAAAGATGG - Intronic
1040355374 8:46612578-46612600 CTGGGTAAGAAGAACAAAGCTGG + Intergenic
1040742347 8:50593326-50593348 CTGTGTCTGAAGAAGAGAGTTGG + Intronic
1040884079 8:52240464-52240486 CTGTTAAACCAGAAGAAAGAAGG - Intronic
1041241983 8:55855991-55856013 CAGTGGCAAAAGAAGAAAGAGGG + Intergenic
1041306011 8:56461735-56461757 CTGTGAAAGTAGAAGGAAGTGGG - Intergenic
1041575139 8:59385529-59385551 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
1041618588 8:59937321-59937343 CTTTGTAATAAAAAGTAAGAAGG - Intergenic
1042038267 8:64562240-64562262 CTAAGTAAAAAGAATAAAGATGG - Intergenic
1042409068 8:68441493-68441515 ATTTTAAAGAAGAAGAAAGAAGG - Intronic
1042553401 8:70014098-70014120 CTGTCTCAGAAAAAGAAAAAAGG + Intergenic
1042831846 8:73038729-73038751 CTGACTATGAATAAGAAAGAAGG + Intronic
1043033204 8:75164844-75164866 ATGAGGAAGAAGAAAAAAGATGG + Intergenic
1043129012 8:76437863-76437885 CTGGGTAAGAAGAACAAAGCTGG - Intergenic
1043325970 8:79051542-79051564 ATGTGTTGGAAGGAGAAAGAAGG + Intergenic
1043636506 8:82390784-82390806 TTGTGGAAGAAGAAGAAGGCTGG + Intergenic
1043929925 8:86079028-86079050 CTGGGCAAGAAGAACAAAGCTGG + Intronic
1044864042 8:96551894-96551916 CTGTTTAAGAAAAAGGAAGAAGG - Intronic
1044884576 8:96763101-96763123 CTTTATAAGAAGAGGAAAGTTGG - Intronic
1045572721 8:103386182-103386204 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
1045592791 8:103617068-103617090 CTGAGTAAAAAGAACAAAGCTGG + Intronic
1045730603 8:105234900-105234922 CCTTGTAAGATGAAGCAAGAAGG + Intronic
1045767155 8:105686958-105686980 CTGTGTGCGTAGAAGGAAGAGGG - Intronic
1046344134 8:112900724-112900746 CTTTAAAAGAAGAAGAATGAGGG + Intronic
1046887283 8:119381361-119381383 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
1047057670 8:121184517-121184539 CGATGGAAGAAGAAGAAAAAGGG - Intergenic
1047225794 8:122954630-122954652 CTTTGAAAAAAGAAGAAAAATGG + Intronic
1047312420 8:123703879-123703901 CAGTGTGCGAATAAGAAAGACGG + Intronic
1047604540 8:126461952-126461974 CTGGGCAAGAAGAATAAAGCTGG + Intergenic
1047607890 8:126492806-126492828 CTAACTAAGAAGAAGAAAGCAGG - Intergenic
1047641592 8:126827030-126827052 ATGTGTAAGAACATGAGAGAAGG + Intergenic
1047647686 8:126886163-126886185 GTGTTTAAGAAGAGGGAAGAAGG - Intergenic
1047675911 8:127201417-127201439 TGGAGTTAGAAGAAGAAAGAAGG + Intergenic
1047983244 8:130205174-130205196 CTATGTGAGAGGAAGGAAGAAGG - Intronic
1048244859 8:132782852-132782874 CTTTGGAAGAACAAGACAGATGG - Intronic
1048919268 8:139213225-139213247 CTGTGTTATGAGATGAAAGAAGG - Intergenic
1049341431 8:142114646-142114668 CTTTGAGAGAAGAAGGAAGAAGG + Intergenic
1049391448 8:142373631-142373653 CTGTGTCAGAGGTAGAAGGAGGG - Intronic
1049483072 8:142836397-142836419 ATGTGTAAGAGGCAGAAATAAGG - Intronic
1050105450 9:2161521-2161543 CAGTGGAGGAAGAAGAAAAAAGG - Intronic
1050322252 9:4465104-4465126 TTTTGTAAGAGGAAGAGAGAGGG - Intergenic
1050489833 9:6176837-6176859 GCTTGTAAGAAGGAGAAAGAGGG + Intergenic
1050791340 9:9474383-9474405 CTGTGTAAAAAGAATAAAGCTGG - Intronic
1050796779 9:9556286-9556308 CTGAGTAAGTTGAAGAAAGGAGG + Intronic
1051179575 9:14396189-14396211 ATGTGTAAAAAGAAAAAAAAAGG - Intronic
1051214257 9:14779398-14779420 CAGAGAAGGAAGAAGAAAGAAGG + Intronic
1051354360 9:16228016-16228038 CTGGGCAAGAAGAACAAAGCTGG + Intronic
1051475795 9:17507823-17507845 CTGTGTCTGCTGAAGAAAGAAGG - Intergenic
1051590112 9:18769107-18769129 CTGAGTAAGAAGGTGAAAGCTGG + Intronic
1051844143 9:21432751-21432773 CTGGCAAAGAAGAAGAATGAAGG - Intronic
1051972123 9:22901608-22901630 CCTTATAAGAAGAAGAAAGAGGG + Intergenic
1052090028 9:24316588-24316610 CTGTTTAAGACCCAGAAAGAAGG + Intergenic
1052103848 9:24486830-24486852 CAGTGTAGGAAAAAAAAAGAAGG + Intergenic
1052405218 9:28051086-28051108 CTGTGTAGGAAAAGGAAAGCAGG - Intronic
1052456040 9:28699633-28699655 CTCTGCAAGAAGAAAAAATATGG - Intergenic
1052562147 9:30099041-30099063 CTGAGCAAGAAGAACAAAGCTGG - Intergenic
1052697746 9:31899849-31899871 CTGGGCAAGAAGAACAAAGCTGG - Intergenic
1055217649 9:73886002-73886024 CTAAGCAAAAAGAAGAAAGATGG - Intergenic
1055424611 9:76181370-76181392 TTGTGAAACAATAAGAAAGAAGG - Intronic
1055527783 9:77152745-77152767 CTCTCAAAGAAGAAGAAAGAAGG - Intergenic
1055576586 9:77666031-77666053 CTATGTACCAAGAAGAAGGAAGG - Intergenic
1056102182 9:83310566-83310588 CTGGGTAAGAAGAAAAAAAGTGG + Intronic
1056422892 9:86446874-86446896 GTGTGTATGAAGGAGAAGGATGG + Intergenic
1056513373 9:87327203-87327225 AGGAGAAAGAAGAAGAAAGAAGG + Intergenic
1057112056 9:92482374-92482396 CTGTGTAAGAAGAAAAGATGAGG + Exonic
1058791808 9:108454474-108454496 CTGTGGGACAAGAAGCAAGATGG + Intergenic
1058818147 9:108704459-108704481 CTTTGAAAGAAGAAGAGATATGG - Intergenic
1059132457 9:111767627-111767649 CTGAGCAAAAAGAAGAAAGCTGG - Intronic
1059356107 9:113700705-113700727 CTGTGTGCCAAGAAGAAAGATGG + Intergenic
1059645321 9:116260538-116260560 CTGAGTTAGAAGATGTAAGATGG - Intronic
1059650991 9:116315719-116315741 AGGAGTAAGAGGAAGAAAGATGG + Intronic
1059885253 9:118738227-118738249 CTTAGAAAGAATAAGAAAGAGGG + Intergenic
1060205346 9:121679654-121679676 GTGTGCAAGCAGAGGAAAGAAGG + Intronic
1060313990 9:122491398-122491420 CTGAGGAAAAAGAAGAAGGAGGG + Intergenic
1061228607 9:129297542-129297564 CTGGGCAAGAAGAACAAAGCCGG - Intergenic
1061600259 9:131664941-131664963 ATTTGTAAGAAGAGGAAATAAGG - Intronic
1062257031 9:135630975-135630997 CTGTGTAAAAAAAAAAAAGACGG + Intronic
1186140665 X:6568477-6568499 CTGTGTTAGGAGGAGAAAGCAGG + Intergenic
1186370516 X:8942100-8942122 CTTAGTAGGAAGAAGAAAAATGG - Intergenic
1186588878 X:10906987-10907009 TTGAGAAAGAAGAAGAAAGCAGG - Intergenic
1186607147 X:11104206-11104228 CTGTTAAATAAAAAGAAAGATGG + Intergenic
1186614951 X:11176582-11176604 CTGTGTGAGAAGGAGAAAATTGG - Intronic
1186684133 X:11906811-11906833 GAGTGCTAGAAGAAGAAAGAAGG - Intergenic
1187247945 X:17570110-17570132 CTGGGCAAGAAGAACAAAGCTGG - Intronic
1187305620 X:18092967-18092989 CTGAGCAAAAAGAAGAAAGCTGG - Intergenic
1187729993 X:22242980-22243002 CTGGGCAAGAAGAACAAAGCTGG + Intronic
1187924741 X:24239324-24239346 GTGTTTAAGTAGAAGGAAGAAGG + Intergenic
1187992639 X:24892064-24892086 CAGAGTTAGAAGAAGAAAGCCGG + Intronic
1188713151 X:33427049-33427071 GAGTGTAAGAGGAAGAGAGAAGG + Intergenic
1188730132 X:33635679-33635701 CTGCGTAAAAAGAACAAAGCTGG - Intergenic
1189581004 X:42406368-42406390 CCGTCTCAGAAAAAGAAAGAAGG + Intergenic
1190164363 X:48060202-48060224 GTCTGAAGGAAGAAGAAAGAGGG + Exonic
1190693180 X:52929302-52929324 CTGGGCAAGAAGAACAAAGCTGG + Intronic
1190718748 X:53129010-53129032 CTGAGGTAAAAGAAGAAAGATGG - Intergenic
1190992950 X:55571218-55571240 CTGAGCAAAAAGAACAAAGATGG + Intergenic
1191054557 X:56228793-56228815 CTGTGGAATAAGAAGAAAAGTGG + Intergenic
1191701923 X:64051855-64051877 CTGTGAAAGAAGAATAAAGTTGG + Intergenic
1191776837 X:64823750-64823772 ATGTGTAGAAAGAAGACAGATGG + Intergenic
1191824587 X:65351022-65351044 CTGGGCAAGAAGAAAAAAGCTGG + Intergenic
1191951821 X:66601203-66601225 CTGCCTCAGAAGAAGAGAGATGG - Intronic
1192006661 X:67221255-67221277 CTGAGTAAAAAGAACAAAGCTGG + Intergenic
1192016739 X:67339413-67339435 CTGGGGAAGCAGAAGAGAGAGGG + Intergenic
1192072748 X:67958433-67958455 CACTGTAGGAAAAAGAAAGAAGG - Intergenic
1192957212 X:76084932-76084954 CTGGGCAAGAAGAACAAAGCTGG - Intergenic
1193079769 X:77394893-77394915 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
1193160829 X:78227372-78227394 CTGTGCAAGAAGAAGAAAGCTGG - Intergenic
1193477656 X:81986291-81986313 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
1193622280 X:83770298-83770320 CTGTAGGAGAAGAAGAAAGAAGG - Intergenic
1193970439 X:88044474-88044496 CTGAGTAAAAAGAACAAAGATGG + Intergenic
1194118508 X:89932935-89932957 CTGGGCAAGAAGAACAAAGCTGG - Intergenic
1194196162 X:90895247-90895269 CTGTCTAACAACAAGAAAAATGG + Intergenic
1194212868 X:91089946-91089968 CTAATTAAGAAGAAGAGAGAGGG - Intergenic
1194527403 X:94994317-94994339 TTGTGAAAGAAGAATAAAGTTGG - Intergenic
1195414648 X:104606938-104606960 CTGGGCAAGAAGAATAAAGTTGG + Intronic
1195475465 X:105279978-105280000 CTGGGTGAGAAGAACAAAGCTGG + Intronic
1195622470 X:106971015-106971037 CTGGGCAAGAAGAACAAAGCTGG + Intronic
1195837722 X:109137661-109137683 CTGAATAAGAAGAATAAAGTAGG + Intergenic
1195976080 X:110528545-110528567 CTGAGTAAAAAGAATAAAGCTGG + Intergenic
1196111607 X:111952559-111952581 CTTTGTAAGCGGAAAAAAGACGG - Intronic
1196159431 X:112466517-112466539 CTGGGCAAGAAGAACAAAGATGG + Intergenic
1196161068 X:112483164-112483186 CTGTGAAAGAAAAACAAAGTTGG - Intergenic
1196161620 X:112490767-112490789 CTATGCAAAAAGAAGAAAGCTGG - Intergenic
1196312803 X:114188169-114188191 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
1196473367 X:116053917-116053939 CTAAGTAAAAAGAACAAAGAAGG - Intergenic
1196476629 X:116093717-116093739 CTATCCAAGAAGAAGAAAGCTGG - Intergenic
1197096467 X:122602604-122602626 CTGTGTGAAAAGAACAAAGCTGG + Intergenic
1197594033 X:128445231-128445253 CTGGGCAAGAAGAACAAAGCTGG - Intergenic
1197637579 X:128932371-128932393 CTCTGGAAGAAGAAAGAAGAGGG - Intergenic
1197825591 X:130587090-130587112 CAGTGTAAGAAGAAGAGATTAGG + Intergenic
1198072575 X:133164054-133164076 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
1198490384 X:137134161-137134183 CTGGGTAAGAAGAACAAAGTTGG + Intergenic
1198703032 X:139417609-139417631 CTTTGTAAGAAGAGGAAATTTGG + Intergenic
1199058975 X:143330513-143330535 CTGGGCAAAAAGAAAAAAGAGGG - Intergenic
1199323154 X:146464588-146464610 CTGTTTAAGGAGGATAAAGATGG + Intergenic
1199599764 X:149534993-149535015 ATGAGGAGGAAGAAGAAAGAAGG - Intergenic
1199713996 X:150492936-150492958 ATGGGTCAGAAGAAGACAGAAGG + Intronic
1199904955 X:152216635-152216657 CTGGGGAAGGAGAAGAGAGAGGG + Intronic
1200376715 X:155788559-155788581 ATGTTTAAGAAAATGAAAGAAGG - Intergenic
1200471389 Y:3590501-3590523 CTGGGCAAGAAGAACAAAGCTGG - Intergenic
1200542006 Y:4469439-4469461 CTGTCTAACAACAAGAAAAATGG + Intergenic
1200674464 Y:6134460-6134482 CTCTGTAAGAAGCACCAAGATGG + Intergenic
1200685615 Y:6255491-6255513 CTGTCCAAGAAGGAGAAACAGGG + Intergenic
1200991146 Y:9346732-9346754 CTGTCCAAGAAGGAGAAACAGGG + Intergenic
1200993804 Y:9367025-9367047 CTGTCCAAGAAGGAGAAACAGGG + Intronic
1200996467 Y:9387343-9387365 CTGTCCAAGAAGGAGAAACAGGG + Intergenic
1200998982 Y:9455898-9455920 CTGTCCAAGAAGGAGAAACAGGG + Intergenic
1201001635 Y:9476207-9476229 CTGTCCAAGAAGGAGAAACAGGG + Intronic
1201004302 Y:9496509-9496531 CTGTCCAAGAAGGAGAAACAGGG + Intergenic
1201006955 Y:9516821-9516843 CTGTCCAAGAAGGAGAAACAGGG + Intergenic
1201009610 Y:9537127-9537149 CTGTCCAAGAAGGAGAAACAGGG + Intergenic
1201792509 Y:17857768-17857790 CTATGTAAGAAGAAAAAAATTGG + Intergenic
1201809045 Y:18048218-18048240 CTATGTAAGAAGAAAAAAATTGG - Intergenic
1201904048 Y:19071767-19071789 CTGTGTAAGTGGAAAAAAAAGGG + Intergenic
1202354046 Y:24027013-24027035 CTATGTAAGAAGAAAAAAATTGG + Intergenic
1202516733 Y:25643099-25643121 CTATGTAAGAAGAAAAAAATTGG - Intergenic