ID: 1151887739

View in Genome Browser
Species Human (GRCh38)
Location 17:76933070-76933092
Sequence TCCACCGAAGACGCCCTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 35
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 34}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151887739_1151887747 -7 Left 1151887739 17:76933070-76933092 CCAGCAAGGGCGTCTTCGGTGGA 0: 1
1: 0
2: 0
3: 0
4: 34
Right 1151887747 17:76933086-76933108 CGGTGGATGGGGGGGTGGTCAGG 0: 1
1: 0
2: 5
3: 41
4: 570
1151887739_1151887750 23 Left 1151887739 17:76933070-76933092 CCAGCAAGGGCGTCTTCGGTGGA 0: 1
1: 0
2: 0
3: 0
4: 34
Right 1151887750 17:76933116-76933138 TGGGAGTTCTGTGAGATTAGAGG 0: 1
1: 0
2: 1
3: 20
4: 599
1151887739_1151887749 4 Left 1151887739 17:76933070-76933092 CCAGCAAGGGCGTCTTCGGTGGA 0: 1
1: 0
2: 0
3: 0
4: 34
Right 1151887749 17:76933097-76933119 GGGGTGGTCAGGCTAGACTTGGG 0: 1
1: 0
2: 0
3: 12
4: 130
1151887739_1151887748 3 Left 1151887739 17:76933070-76933092 CCAGCAAGGGCGTCTTCGGTGGA 0: 1
1: 0
2: 0
3: 0
4: 34
Right 1151887748 17:76933096-76933118 GGGGGTGGTCAGGCTAGACTTGG 0: 1
1: 0
2: 0
3: 15
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151887739 Original CRISPR TCCACCGAAGACGCCCTTGC TGG (reversed) Intronic
900463569 1:2812949-2812971 TCCACGGAAAATGCACTTGCAGG - Intergenic
901493947 1:9610765-9610787 TCCCCGGAAGCCGCCCCTGCAGG + Exonic
908068200 1:60430820-60430842 TCCACCAAAGACGGTTTTGCAGG - Intergenic
919939207 1:202274943-202274965 TCCACCCATGGCCCCCTTGCTGG + Intronic
1077008663 11:370444-370466 TTCACCGAAGGCGCCCCCGCCGG - Intronic
1077195108 11:1275798-1275820 TCCACAGAAGACCCACTTGTGGG + Exonic
1083648180 11:64185330-64185352 TCCACTGAGGACGCCCAAGCGGG + Exonic
1089452372 11:118607490-118607512 GCCAAAGAAGACGCCCTTGTGGG - Intronic
1113263782 13:108594078-108594100 GCTACCCAAGACACCCTTGCTGG + Intergenic
1120686467 14:87543524-87543546 TCCACCCATCAGGCCCTTGCTGG - Intergenic
1121712080 14:96045994-96046016 TCACCTGAAGAAGCCCTTGCAGG - Intronic
1148795126 17:50193220-50193242 TCCTCCCAAGATGCCCTTCCAGG + Intronic
1151010225 17:70484630-70484652 TCCACTGAAGATGCCCTGGTGGG - Intergenic
1151429338 17:74051840-74051862 TCCACCGCAGAGGCCCCTGGGGG + Intergenic
1151887739 17:76933070-76933092 TCCACCGAAGACGCCCTTGCTGG - Intronic
1159371387 18:67531442-67531464 TCCTCAGAAGAAGCCCTTTCAGG - Intergenic
932137013 2:69240260-69240282 TCCACAGGAGAAGCCCTTGAGGG + Intronic
1176005928 20:62862087-62862109 TCCAGCGCAGCCGCCCTCGCCGG - Intergenic
1176011830 20:62901199-62901221 TACAGCCAGGACGCCCTTGCAGG + Intronic
959488350 3:106955623-106955645 TCCACTGATAACTCCCTTGCTGG + Intergenic
969575187 4:8032545-8032567 GCCACCGAGGAGGCCCTTCCCGG + Intronic
973820277 4:54657282-54657304 TCCGCCCAAGAAGCCCCTGCCGG - Intergenic
974020598 4:56688711-56688733 TCAACCCAAGACCCTCTTGCAGG - Intergenic
980267967 4:130544313-130544335 TCCACTAAAGACGTTCTTGCCGG - Intergenic
1002326067 5:178407166-178407188 TCCACTGATGCCACCCTTGCTGG - Intronic
1002887890 6:1312265-1312287 TGCCCCGAAGACGCCCGCGCGGG + Intergenic
1011779910 6:90776429-90776451 TACACTGAAGACACCTTTGCTGG + Intergenic
1029158045 7:98531277-98531299 CCCACCAAAGACGGCTTTGCAGG + Intergenic
1050165108 9:2757382-2757404 TCCACCAAAGACAGCTTTGCAGG - Intronic
1051407524 9:16754916-16754938 TCCACCCAAGAAGCACTTGAGGG + Intronic
1056880985 9:90393579-90393601 TCCTCCAAATAAGCCCTTGCTGG + Intergenic
1061966622 9:134018110-134018132 CCCACAGAAGACGGCTTTGCAGG + Intergenic
1062000039 9:134211359-134211381 TCCACGGAGGCCTCCCTTGCTGG + Intergenic
1188663500 X:32790449-32790471 TTCACGGAAGAAGCCCATGCTGG + Intronic
1190538656 X:51455425-51455447 TCCACCAAAGATGGCTTTGCAGG + Intergenic