ID: 1151889048

View in Genome Browser
Species Human (GRCh38)
Location 17:76941450-76941472
Sequence CTTGGCTGGTTCCTTCATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 205}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151889044_1151889048 17 Left 1151889044 17:76941410-76941432 CCGCAGTGGACATGTTTGTGGCT 0: 1
1: 0
2: 1
3: 18
4: 169
Right 1151889048 17:76941450-76941472 CTTGGCTGGTTCCTTCATTCTGG 0: 1
1: 0
2: 2
3: 17
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151889048 Original CRISPR CTTGGCTGGTTCCTTCATTC TGG Intronic
902105066 1:14028226-14028248 GCTGGCTCGTTTCTTCATTCTGG + Intergenic
905549272 1:38823154-38823176 CTGGGCTGGATCCTGCTTTCGGG + Intergenic
908014602 1:59817703-59817725 GTTGGCTGCTTCCGTCATTCAGG + Intronic
908594165 1:65668136-65668158 CTTAGCTGTGTCCTTCACTCAGG + Intergenic
908886127 1:68791000-68791022 CATGGCTGGTTACTTCATGAAGG + Intergenic
909959311 1:81819300-81819322 CTTGGCTGGAACCTTGGTTCTGG - Intronic
910162318 1:84287037-84287059 TTCAGCTGGTCCCTTCATTCAGG - Intergenic
910446114 1:87300282-87300304 CTTGGCTGGATCACTAATTCCGG + Intergenic
912902008 1:113661236-113661258 CATGACTGGCTCCCTCATTCAGG + Intronic
915377308 1:155408172-155408194 CTCGGATGGTACCTTGATTCTGG + Intronic
917472036 1:175334203-175334225 CATGGCTGATTCCTTGCTTCTGG + Intronic
917720383 1:177781323-177781345 CTTGGCCAGTGCCATCATTCTGG - Intergenic
918081668 1:181212474-181212496 GTTGGATTGTTCATTCATTCAGG - Intergenic
918081784 1:181213490-181213512 GTTGGATTGTTCATTCATTCAGG + Intergenic
918744383 1:188181715-188181737 TTCAGCTGGTCCCTTCATTCGGG - Intergenic
919062960 1:192657611-192657633 CTTGTCTGGTCCCTTATTTCTGG + Intronic
919865890 1:201782650-201782672 CTTGGTAGGCTCCTTCAGTCTGG - Exonic
922665772 1:227467202-227467224 CTTACCTGGCTCCTTCATTTAGG - Intergenic
923262504 1:232281045-232281067 CTTTCCAGGTTCCTGCATTCTGG - Intergenic
924523487 1:244826232-244826254 CTTGGCTTACTCCTTCATTTTGG - Intergenic
1063790304 10:9437338-9437360 CTTGGCTGGAACCTTCACTAGGG + Intergenic
1066422991 10:35279079-35279101 CTTGACTGGTGCTTTCATTTTGG - Intronic
1066984534 10:42453719-42453741 CTTACCTGGTTCCTTCACTTAGG + Intergenic
1067370777 10:45679631-45679653 CTTACCTGGTTCCTTCACTTAGG - Intergenic
1067388999 10:45846512-45846534 CTTACCTGGTTCCTTCACTTAGG + Intronic
1067417064 10:46110435-46110457 CTTACCTGGTTCCTTCACTTAGG - Intergenic
1067445261 10:46338037-46338059 CTTACCTGGTTCCTTCACTTAGG - Intergenic
1067502477 10:46817328-46817350 CTTACCTGGTTCCTTCACTTAGG - Intergenic
1067592112 10:47522691-47522713 CTTACCTGGTTCCTTCACTTAGG + Intronic
1067639229 10:48030763-48030785 CTTACCTGGTTCCTTCACTTAGG + Intergenic
1067874257 10:49989529-49989551 CTTACCTGGTTCCTTCACTTAGG - Intronic
1067967455 10:50928565-50928587 CTTGGCTAGTTTTTTCATTTTGG - Intergenic
1068857605 10:61813403-61813425 TTGGGCTGTTTCCTTCTTTCTGG - Intergenic
1070136221 10:73696920-73696942 CTTACCTGGTTCCTTCACTTAGG + Intronic
1071286251 10:84148817-84148839 CTTGCTTGGTTGCTACATTCTGG + Exonic
1072615746 10:97048018-97048040 CCTGGCTGATTCCTGCATTATGG - Intronic
1073690402 10:105801871-105801893 CATCTCTGCTTCCTTCATTCAGG - Intergenic
1074472963 10:113744085-113744107 CTTGGCTGGGTCCTACAGGCTGG - Intergenic
1074701941 10:116100154-116100176 CTTTGCTGCTTCCTTCTGTCTGG - Intronic
1075075662 10:119348716-119348738 CTTGGCTGGTTCCTCCAGAATGG - Intronic
1077300170 11:1843074-1843096 CTTGCCTGGTCCCATCATTCTGG - Intergenic
1079469864 11:20768045-20768067 CATGGCTGGCTCCTTCATTTAGG - Intronic
1080212414 11:29801691-29801713 CTTGGCTGTGTCATTCAGTCTGG - Intergenic
1081232764 11:40606303-40606325 ATTAGCTGGTTTCTTCATTCAGG - Intronic
1082616775 11:55370944-55370966 TTTGGCTGATTTCTTCATTTTGG - Intergenic
1082733470 11:56828138-56828160 TTCAGCTGGTTCCTCCATTCAGG + Intergenic
1084190600 11:67497061-67497083 CTTGGCGAGTCCCTTCTTTCTGG + Intronic
1085351660 11:75801756-75801778 CTTGGCTTGGTCCTCCACTCAGG + Intergenic
1087086534 11:94224903-94224925 CTTGCCTGGTACCTTGATTTTGG - Intergenic
1087369076 11:97258298-97258320 AATGACTGGTTCCTTCAATCTGG - Intergenic
1087450363 11:98313642-98313664 CTTTGCTGTCTCCTTCATTATGG - Intergenic
1087511810 11:99103935-99103957 CTTGGCTGAATCCTTCATTTTGG + Intronic
1098331571 12:69359173-69359195 CTTGGCTTATTCCCTCATTTTGG + Intergenic
1100206065 12:92351031-92351053 ATCTGCTGGTTCCTTGATTCCGG + Intergenic
1100755814 12:97749951-97749973 GTTGGCTGGTTGATTCCTTCTGG + Intergenic
1100844341 12:98644369-98644391 CTGGGCTGTTTCCTTCCTTTGGG + Intronic
1102281436 12:111621910-111621932 CATGGCTCAGTCCTTCATTCAGG + Intergenic
1103360488 12:120350699-120350721 CCTGGCTGGCACCTTCACTCGGG - Intronic
1105758706 13:23493659-23493681 CATGACTGGTCCCTTCTTTCTGG + Intergenic
1105758981 13:23495623-23495645 CTTGGCTGGCTCTTTCCATCTGG - Intergenic
1108563863 13:51674899-51674921 CTTGGCTGGTTCTGTCAGTATGG - Intronic
1112386773 13:98946945-98946967 CTGGGCTAGTGCCTTCATTTAGG - Intronic
1112473811 13:99712908-99712930 CTTGGCTTATTTCCTCATTCAGG + Intronic
1114174158 14:20304287-20304309 CTAGTCTGTTCCCTTCATTCTGG - Intronic
1115166642 14:30455614-30455636 CCTGGCAAGTTCCTTCATTAGGG + Intergenic
1115756461 14:36531219-36531241 CTTGGCTGGACCCTTCCTTCTGG + Intergenic
1118120694 14:62838215-62838237 CTAGGCTAGTTCCTGTATTCCGG - Intronic
1120221866 14:81743463-81743485 CTTCACTGGTGCATTCATTCAGG - Intergenic
1124085962 15:26550769-26550791 CTTGGCTGGGTCCTTCCCTTAGG - Intronic
1124642013 15:31401605-31401627 CTGGGCTGGTCCCTTCATGTGGG + Intronic
1128361821 15:66967355-66967377 CTTGGCTGGTTGCTGTATTATGG + Intergenic
1129753540 15:78082472-78082494 CCTGGGTGGTTACTTCCTTCTGG - Intronic
1129995834 15:80004269-80004291 CTTGGCTGGTACCTGGATGCAGG - Intergenic
1130536583 15:84789874-84789896 CTTCGCTGGTGCCTGCATGCTGG - Intronic
1131227105 15:90633610-90633632 TTTGGTGGGTTCCTTCAATCTGG + Intronic
1132629522 16:910423-910445 CTTGGCTGCGTCCTTCCTCCCGG - Intronic
1133639990 16:7707495-7707517 CCAGCCTTGTTCCTTCATTCAGG + Intronic
1135026325 16:19002075-19002097 CTTGGCTGGTGCCCACATCCTGG + Intronic
1135976557 16:27112163-27112185 CTTGGCTGGATTGTTCATTTGGG + Intergenic
1136010553 16:27360788-27360810 CTTGGCTGGTTCCTGGCCTCGGG - Exonic
1139735668 16:68985956-68985978 CCTGACAGGTTCCTTGATTCTGG - Intronic
1141577970 16:84976929-84976951 GTTTGCTGTTTCTTTCATTCTGG - Intronic
1146089514 17:29862202-29862224 ATTGACTGGTTCCTTCTTCCAGG + Intronic
1147390282 17:40105077-40105099 CATGGCTGGTTCCCTGATTCAGG - Intergenic
1147974889 17:44241475-44241497 CGTGGCAGCTTCCTTCATGCGGG - Intergenic
1150010329 17:61496882-61496904 CTTGGCTGATTCCTCCTTTTGGG + Intergenic
1151889048 17:76941450-76941472 CTTGGCTGGTTCCTTCATTCTGG + Intronic
1153081225 18:1227596-1227618 CTTGGCTTGTTTCTTCTTTTTGG + Intergenic
1155073097 18:22333241-22333263 CTTAGCTGGATCCATCCTTCAGG - Intergenic
1156245838 18:35297217-35297239 CTTTGCTGGTCCCTTGATTTGGG - Intergenic
1158013641 18:52758373-52758395 CTTGACTTGTTATTTCATTCAGG + Intronic
1158235163 18:55304184-55304206 CTTGGCCACTTCCTTCCTTCTGG - Intronic
1160610095 18:80077973-80077995 CTTGGCTGAATTCTTCATGCTGG - Intronic
1162294221 19:9802121-9802143 CTTGGGTGGGTCCTCCATTCTGG - Intergenic
1162950101 19:14066307-14066329 CATGGCTGGTTCCTCTATTCAGG - Intergenic
1165085900 19:33347339-33347361 CTTGGCCAGTTTCTTCTTTCTGG - Intergenic
1166845068 19:45722252-45722274 CTTGGATGATTCCTGCCTTCAGG - Intronic
1167985467 19:53311055-53311077 CTTGGCTGTGTCCTCCACTCAGG + Intergenic
1168690573 19:58374268-58374290 CTTGGCTTGTTTCTCCATTTTGG - Intronic
1168704664 19:58462974-58462996 GTTTGTAGGTTCCTTCATTCAGG - Intergenic
929509697 2:42556920-42556942 CTTGGCTGGCTCCTGAAATCTGG - Intronic
932471631 2:71963076-71963098 CTTGGCTGGTTGCTTCAGCTAGG - Intergenic
933374269 2:81459402-81459424 CTTAGCTGGGTCCTTTGTTCAGG - Intergenic
936004918 2:108877124-108877146 CTTGGCCTGTTCTTTCATTATGG - Intronic
937540620 2:122947891-122947913 CATGGCTAATTCCTTAATTCAGG - Intergenic
939684984 2:145188335-145188357 CTCTGCTGGTGCCTTCATTTTGG - Intergenic
944677086 2:202042669-202042691 CCTGGGTGGATCCTTCATTGTGG - Intergenic
945245455 2:207712530-207712552 CTTACCTGGTTCCTTCACTTAGG - Intronic
945252786 2:207778460-207778482 CTGGGCTGATTCCTCCATCCAGG - Intergenic
945446688 2:209946788-209946810 CTTGGCTCCTTCCTTCTTCCTGG - Intronic
948320789 2:237067383-237067405 CTTGGCTGACTCCTTGATTTTGG - Intergenic
1169208347 20:3752377-3752399 CTTGGCGGGTCCCTTCAGCCTGG - Exonic
1171252810 20:23662426-23662448 CTTGGCTTGTGTCTTCATGCTGG + Intergenic
1171259290 20:23717743-23717765 CTTGGCTTGTGTCTTCATGCTGG + Intergenic
1171268383 20:23793316-23793338 CTTGGCTTGTGTCTTCATGCTGG + Intergenic
1171457246 20:25278958-25278980 CTGGGCTGGCTCCTTCACTTGGG + Intronic
1176288127 21:5029682-5029704 CTCGGGTGGTTCCTACCTTCTGG - Intronic
1177688440 21:24470953-24470975 CTGGGCTAGTTCCTTTATTGAGG + Intergenic
1177802165 21:25838767-25838789 ATTGGCTGGATCCATCATCCTGG - Intergenic
1177921238 21:27155080-27155102 CTTGGCTGATACCTTAATTTTGG + Intergenic
1178439934 21:32590532-32590554 CTTGGCAGGCTCATTCGTTCTGG - Intronic
1179163735 21:38918788-38918810 CTTGGCTGGTGCCATCACCCAGG + Intergenic
1179869054 21:44233793-44233815 CTCGGGTGGTTCCTACCTTCTGG + Intronic
1181549826 22:23631504-23631526 CTTAGCTGGTTCCTTCATTTAGG + Intronic
1181765930 22:25092267-25092289 CGTGGCTGGCTCCTTCCCTCAGG - Intronic
1181798567 22:25328023-25328045 CTTAGCTGGTTCCTTCATTTAGG - Intergenic
1181942409 22:26488622-26488644 ATTGGCTGGTTACATCGTTCAGG - Intronic
1182052994 22:27327591-27327613 CATGGTTTGCTCCTTCATTCAGG - Intergenic
1182809835 22:33106357-33106379 CTTGTCCGGATCATTCATTCAGG - Intergenic
949638842 3:6012979-6013001 CTTAGCAGGTCCCTCCATTCAGG - Intergenic
957502781 3:81078241-81078263 TTTGGCTGGTTGCTACATCCAGG + Intergenic
957810988 3:85222474-85222496 CGTGGCTGTTTCCTTCACTCAGG + Intronic
961429842 3:126873713-126873735 CATGGCTGGTCCCTCCATGCAGG - Intronic
961550727 3:127669324-127669346 CTGGGCAGGTTCCTTGCTTCAGG + Intronic
962323370 3:134409608-134409630 CTCGGTTGGTTCATTTATTCTGG - Intergenic
964495993 3:157290357-157290379 CTTAGCTGGGTCCTCCATTCAGG - Intronic
968519755 4:1030052-1030074 CTTGGCTGGTCCCTGCGTCCTGG - Intergenic
968885697 4:3330443-3330465 CTTGCCTTCTTCCTTCACTCAGG + Intronic
969544352 4:7814985-7815007 CTTGGGTGGTTCCCACCTTCGGG - Intronic
972038281 4:34554744-34554766 TTCAGCTGGTCCCTTCATTCAGG + Intergenic
972492253 4:39599001-39599023 CTTGGCTTATGCCTTCATTTCGG + Intronic
972746054 4:41933928-41933950 CCTGACTGGTACCATCATTCTGG + Intergenic
973573155 4:52260910-52260932 CTTGGCTAGTTTCTTTACTCTGG - Intergenic
974273973 4:59690843-59690865 CTTTCCTGCTTCCCTCATTCTGG + Intergenic
974895123 4:67928641-67928663 CTTGTCAGGTTCCTCCCTTCTGG + Intronic
975587452 4:75964680-75964702 TTCAGCTGGTTCCTCCATTCGGG - Intronic
975859003 4:78656090-78656112 CTTGGGTTGTTCCTTAATTCTGG + Intergenic
976960515 4:90965886-90965908 CTTTGCTGATTTCTTTATTCAGG - Intronic
979172242 4:117615792-117615814 CTTGTTTGGGTTCTTCATTCTGG - Intergenic
979186000 4:117793995-117794017 CTTGGCTGTTTCTGTCTTTCAGG - Intergenic
979871533 4:125828931-125828953 GCTGGCTGGTTCCTTAATTAGGG + Intergenic
981343928 4:143653452-143653474 CATGGCTGTTTCCTTCTTTAAGG + Intronic
981893748 4:149771574-149771596 CTTGGTTGGTTACTTGGTTCAGG + Intergenic
983039379 4:162906809-162906831 TTTGGCTGATTCCTTCCTTCTGG + Intergenic
986572124 5:9176457-9176479 CTTAGCTGGGTCCTCCGTTCAGG - Intronic
987236923 5:15951957-15951979 CTTGTCTGGATCGTTCACTCTGG - Intergenic
987528676 5:19086108-19086130 CTTGGCTGGTTGCTTCAGGCTGG + Intergenic
988054538 5:26076650-26076672 CTTTGCTGCTACTTTCATTCTGG + Intergenic
989166548 5:38438280-38438302 CATGGATGGTTCGGTCATTCAGG - Exonic
990514291 5:56517527-56517549 CTTGGCTGAGACCTTCATTGTGG + Intronic
993474917 5:88352621-88352643 CTTGGTTTGTTCCCTCATTTTGG - Intergenic
994126620 5:96174221-96174243 CTTGCCAGTTTCCTTCTTTCTGG + Intergenic
997091498 5:130864122-130864144 CTTGGATGGCCCCTTTATTCTGG - Intergenic
997304745 5:132829217-132829239 CCTCTCTGGCTCCTTCATTCAGG - Intronic
998549846 5:143066966-143066988 CGTGGCTTGTTCCTTCAAACAGG - Intronic
998795670 5:145815818-145815840 ATTGGCTTGTTTCTACATTCTGG + Intronic
1001941299 5:175741688-175741710 CTTGCCTGCTTCCTTAACTCTGG - Intergenic
1001957320 5:175856904-175856926 CTTGCCTGGATCCTTCACTGCGG + Intronic
1005369745 6:25119673-25119695 CTTGTCTGGTTCCTGCTTTTAGG - Intergenic
1005567853 6:27114500-27114522 TTTTGATGGTTCCTTCCTTCAGG + Intergenic
1005596808 6:27387430-27387452 CTTGGGTGGTTCCTGCCTTTTGG - Intronic
1005861639 6:29907007-29907029 CTTGGCTGGTTCATGCACCCTGG + Intergenic
1006661107 6:35645538-35645560 CTTGGCTGGATCCTGGATTAGGG + Intronic
1008536474 6:52509752-52509774 CTTGGCTGGTTTCTTTACTGTGG + Intronic
1009468134 6:63999302-63999324 CTTGGCTGGGTCCATATTTCAGG - Intronic
1011536124 6:88378243-88378265 CTTGCCTGCTTCAGTCATTCTGG - Intergenic
1011846305 6:91567314-91567336 TTTGGCTGATTTCTTCATTTGGG + Intergenic
1012168520 6:95989475-95989497 CCTAGCTGGTCCCTCCATTCAGG - Intergenic
1013374976 6:109505898-109505920 ATTTGCTGGTACCTTGATTCTGG - Intronic
1013468390 6:110438005-110438027 CATGGCTGCCTCCCTCATTCAGG + Intronic
1014448190 6:121553458-121553480 CAGGGCTGGTTCCTTCTTACAGG - Intergenic
1017652192 6:156593899-156593921 CTTAGCTGGTTTCTCCACTCAGG + Intergenic
1017841429 6:158225821-158225843 CTTGTCTGCTTCCCCCATTCGGG - Intergenic
1019364286 7:623878-623900 CTTGGCTTGTACCTCCCTTCTGG - Intronic
1019684527 7:2373629-2373651 ATTGGCTGTTTCATTAATTCTGG + Intronic
1019929499 7:4214449-4214471 AAGGGCTGGTTCCTTCATCCTGG + Intronic
1020340130 7:7101068-7101090 CTTGACTTGTTCTTTCATTAAGG + Intergenic
1020439387 7:8201420-8201442 CTGGGCTGGGGCCTTCAATCAGG + Intronic
1021867018 7:24968313-24968335 CTTGGCTGATTACTTCATGTTGG - Intronic
1021961267 7:25875376-25875398 CTCTGCTGACTCCTTCATTCTGG - Intergenic
1023681809 7:42695085-42695107 CTTGCCAGGTCCCTTCATTGAGG + Intergenic
1028129391 7:87152477-87152499 CGTGGCTGCTTCCTCCATCCTGG + Intronic
1029353218 7:100030269-100030291 CATGGCTGTGTCCCTCATTCTGG + Exonic
1032344796 7:131107750-131107772 CTTGCCTCGTTCCTTCCTCCCGG + Intergenic
1032814957 7:135463606-135463628 CTTTGCCGGTTCCTACATCCAGG - Intronic
1033461667 7:141551810-141551832 GTTGGTTGGTTCATTCATTCTGG + Intronic
1033718627 7:144032004-144032026 TTTGACTGGTTACTTCATCCTGG + Intergenic
1035717679 8:1766340-1766362 CTCATCTGGTTCTTTCATTCTGG - Intronic
1037914198 8:22762539-22762561 CTTGGCTTTTTCCTTTCTTCAGG - Intronic
1038399574 8:27272724-27272746 CTGGGATGTTTCCTACATTCTGG - Intergenic
1039155482 8:34552066-34552088 TTTTGCTGGTTTCTTTATTCAGG + Intergenic
1040032244 8:42835638-42835660 CTTACCTGGATTCTTCATTCTGG + Intergenic
1042426218 8:68651404-68651426 CTTTGCTGTGGCCTTCATTCAGG + Intronic
1044222566 8:89686422-89686444 CTTGGATGGTTGCTTCTCTCTGG - Intergenic
1046267151 8:111846064-111846086 TTTGGCTGATTTCTTCATTTTGG - Intergenic
1046418552 8:113947997-113948019 CTTGACTGTTACTTTCATTCTGG - Intergenic
1047976295 8:130133796-130133818 CATGGCAGTTTCCTTCCTTCAGG + Intronic
1049311665 8:141936863-141936885 CTTGGCAGCTTCCCCCATTCGGG + Intergenic
1049795961 8:144497356-144497378 CTTGGCTGGCTGCCTCCTTCCGG - Exonic
1054930013 9:70626434-70626456 CCTGGGTGGGTCCTTCATTAAGG - Intronic
1055015710 9:71615784-71615806 ATTGGCTGGCACCTTCATTTTGG - Intergenic
1055400950 9:75923395-75923417 CTAGGCAGATTCCTTCATTTTGG + Intronic
1056304421 9:85275138-85275160 CTTAGCTGATTCCTTTATTCAGG - Intergenic
1057448924 9:95139030-95139052 CTTCGGCGATTCCTTCATTCAGG - Intronic
1059403413 9:114084960-114084982 CTCGGCTGGCTCCTTCCTCCAGG - Intergenic
1059524806 9:114980727-114980749 CTTTGCTGGTACCTTGATTTTGG + Intergenic
1059852132 9:118354006-118354028 CCTGGCTGGCTCTTTCAATCTGG + Intergenic
1186527772 X:10265204-10265226 CATGGCTGCTCACTTCATTCAGG - Intergenic
1186581461 X:10824334-10824356 CTTTGCTGGGACCTTCACTCTGG + Intronic
1186808146 X:13160796-13160818 CTTGGATGGTCCCTCCAATCAGG + Intergenic
1188451946 X:30316655-30316677 CTTTCCTGCTTCCCTCATTCAGG - Intergenic
1195844572 X:109212130-109212152 CTGGGTTGGTTCTTTCTTTCTGG - Intergenic
1198422435 X:136481163-136481185 CTTGGCTGTTGCCTTCCGTCAGG - Intergenic
1198429308 X:136549549-136549571 CTTGGCTTGCTCCTGCACTCTGG + Intronic
1200724401 Y:6649171-6649193 TTTGGCTGGGTCCTTGATTCAGG + Intergenic