ID: 1151892558

View in Genome Browser
Species Human (GRCh38)
Location 17:76959198-76959220
Sequence ACACTCACGCAGCCACCGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151892551_1151892558 10 Left 1151892551 17:76959165-76959187 CCCAGGACCAGGAAGCCTCGGCC No data
Right 1151892558 17:76959198-76959220 ACACTCACGCAGCCACCGTCTGG No data
1151892552_1151892558 9 Left 1151892552 17:76959166-76959188 CCAGGACCAGGAAGCCTCGGCCT No data
Right 1151892558 17:76959198-76959220 ACACTCACGCAGCCACCGTCTGG No data
1151892548_1151892558 17 Left 1151892548 17:76959158-76959180 CCTGGACCCCAGGACCAGGAAGC No data
Right 1151892558 17:76959198-76959220 ACACTCACGCAGCCACCGTCTGG No data
1151892553_1151892558 3 Left 1151892553 17:76959172-76959194 CCAGGAAGCCTCGGCCTGCGCTG No data
Right 1151892558 17:76959198-76959220 ACACTCACGCAGCCACCGTCTGG No data
1151892555_1151892558 -5 Left 1151892555 17:76959180-76959202 CCTCGGCCTGCGCTGGCCACACT No data
Right 1151892558 17:76959198-76959220 ACACTCACGCAGCCACCGTCTGG No data
1151892550_1151892558 11 Left 1151892550 17:76959164-76959186 CCCCAGGACCAGGAAGCCTCGGC No data
Right 1151892558 17:76959198-76959220 ACACTCACGCAGCCACCGTCTGG No data
1151892545_1151892558 23 Left 1151892545 17:76959152-76959174 CCAAGCCCTGGACCCCAGGACCA No data
Right 1151892558 17:76959198-76959220 ACACTCACGCAGCCACCGTCTGG No data
1151892547_1151892558 18 Left 1151892547 17:76959157-76959179 CCCTGGACCCCAGGACCAGGAAG No data
Right 1151892558 17:76959198-76959220 ACACTCACGCAGCCACCGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151892558 Original CRISPR ACACTCACGCAGCCACCGTC TGG Intergenic
No off target data available for this crispr