ID: 1151893359

View in Genome Browser
Species Human (GRCh38)
Location 17:76964099-76964121
Sequence GGCTAACGAAAGCTCCATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151893354_1151893359 -4 Left 1151893354 17:76964080-76964102 CCCTTTGTATCCCAAACAAGGCT No data
Right 1151893359 17:76964099-76964121 GGCTAACGAAAGCTCCATGAGGG No data
1151893355_1151893359 -5 Left 1151893355 17:76964081-76964103 CCTTTGTATCCCAAACAAGGCTA No data
Right 1151893359 17:76964099-76964121 GGCTAACGAAAGCTCCATGAGGG No data
1151893353_1151893359 -3 Left 1151893353 17:76964079-76964101 CCCCTTTGTATCCCAAACAAGGC No data
Right 1151893359 17:76964099-76964121 GGCTAACGAAAGCTCCATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151893359 Original CRISPR GGCTAACGAAAGCTCCATGA GGG Intergenic
No off target data available for this crispr