ID: 1151895056

View in Genome Browser
Species Human (GRCh38)
Location 17:76974609-76974631
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151895056_1151895066 21 Left 1151895056 17:76974609-76974631 CCTGGCGCTGCCATCATGCTGGG No data
Right 1151895066 17:76974653-76974675 CTCTACAGAGCAGGGCCTCCTGG No data
1151895056_1151895068 25 Left 1151895056 17:76974609-76974631 CCTGGCGCTGCCATCATGCTGGG No data
Right 1151895068 17:76974657-76974679 ACAGAGCAGGGCCTCCTGGTGGG No data
1151895056_1151895070 29 Left 1151895056 17:76974609-76974631 CCTGGCGCTGCCATCATGCTGGG No data
Right 1151895070 17:76974661-76974683 AGCAGGGCCTCCTGGTGGGGCGG No data
1151895056_1151895069 26 Left 1151895056 17:76974609-76974631 CCTGGCGCTGCCATCATGCTGGG No data
Right 1151895069 17:76974658-76974680 CAGAGCAGGGCCTCCTGGTGGGG No data
1151895056_1151895063 -9 Left 1151895056 17:76974609-76974631 CCTGGCGCTGCCATCATGCTGGG No data
Right 1151895063 17:76974623-76974645 CATGCTGGGAGGCATGGCTGGGG No data
1151895056_1151895067 24 Left 1151895056 17:76974609-76974631 CCTGGCGCTGCCATCATGCTGGG No data
Right 1151895067 17:76974656-76974678 TACAGAGCAGGGCCTCCTGGTGG No data
1151895056_1151895062 -10 Left 1151895056 17:76974609-76974631 CCTGGCGCTGCCATCATGCTGGG No data
Right 1151895062 17:76974622-76974644 TCATGCTGGGAGGCATGGCTGGG No data
1151895056_1151895065 13 Left 1151895056 17:76974609-76974631 CCTGGCGCTGCCATCATGCTGGG No data
Right 1151895065 17:76974645-76974667 GCTGTACACTCTACAGAGCAGGG No data
1151895056_1151895064 12 Left 1151895056 17:76974609-76974631 CCTGGCGCTGCCATCATGCTGGG No data
Right 1151895064 17:76974644-76974666 GGCTGTACACTCTACAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151895056 Original CRISPR CCCAGCATGATGGCAGCGCC AGG (reversed) Intergenic