ID: 1151895060

View in Genome Browser
Species Human (GRCh38)
Location 17:76974619-76974641
Sequence AGCCATGCCTCCCAGCATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151895060_1151895067 14 Left 1151895060 17:76974619-76974641 CCATCATGCTGGGAGGCATGGCT No data
Right 1151895067 17:76974656-76974678 TACAGAGCAGGGCCTCCTGGTGG No data
1151895060_1151895065 3 Left 1151895060 17:76974619-76974641 CCATCATGCTGGGAGGCATGGCT No data
Right 1151895065 17:76974645-76974667 GCTGTACACTCTACAGAGCAGGG No data
1151895060_1151895068 15 Left 1151895060 17:76974619-76974641 CCATCATGCTGGGAGGCATGGCT No data
Right 1151895068 17:76974657-76974679 ACAGAGCAGGGCCTCCTGGTGGG No data
1151895060_1151895064 2 Left 1151895060 17:76974619-76974641 CCATCATGCTGGGAGGCATGGCT No data
Right 1151895064 17:76974644-76974666 GGCTGTACACTCTACAGAGCAGG No data
1151895060_1151895070 19 Left 1151895060 17:76974619-76974641 CCATCATGCTGGGAGGCATGGCT No data
Right 1151895070 17:76974661-76974683 AGCAGGGCCTCCTGGTGGGGCGG No data
1151895060_1151895069 16 Left 1151895060 17:76974619-76974641 CCATCATGCTGGGAGGCATGGCT No data
Right 1151895069 17:76974658-76974680 CAGAGCAGGGCCTCCTGGTGGGG No data
1151895060_1151895066 11 Left 1151895060 17:76974619-76974641 CCATCATGCTGGGAGGCATGGCT No data
Right 1151895066 17:76974653-76974675 CTCTACAGAGCAGGGCCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151895060 Original CRISPR AGCCATGCCTCCCAGCATGA TGG (reversed) Intergenic