ID: 1151895064

View in Genome Browser
Species Human (GRCh38)
Location 17:76974644-76974666
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151895054_1151895064 20 Left 1151895054 17:76974601-76974623 CCAGATGGCCTGGCGCTGCCATC No data
Right 1151895064 17:76974644-76974666 GGCTGTACACTCTACAGAGCAGG No data
1151895056_1151895064 12 Left 1151895056 17:76974609-76974631 CCTGGCGCTGCCATCATGCTGGG No data
Right 1151895064 17:76974644-76974666 GGCTGTACACTCTACAGAGCAGG No data
1151895060_1151895064 2 Left 1151895060 17:76974619-76974641 CCATCATGCTGGGAGGCATGGCT No data
Right 1151895064 17:76974644-76974666 GGCTGTACACTCTACAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151895064 Original CRISPR GGCTGTACACTCTACAGAGC AGG Intergenic