ID: 1151900845

View in Genome Browser
Species Human (GRCh38)
Location 17:77013152-77013174
Sequence GGCGATAAGAATAATGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151900841_1151900845 0 Left 1151900841 17:77013129-77013151 CCCTCGCGTGGGATACAGCTAAA No data
Right 1151900845 17:77013152-77013174 GGCGATAAGAATAATGAGGCTGG No data
1151900842_1151900845 -1 Left 1151900842 17:77013130-77013152 CCTCGCGTGGGATACAGCTAAAG No data
Right 1151900845 17:77013152-77013174 GGCGATAAGAATAATGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151900845 Original CRISPR GGCGATAAGAATAATGAGGC TGG Intergenic
No off target data available for this crispr