ID: 1151903235

View in Genome Browser
Species Human (GRCh38)
Location 17:77031532-77031554
Sequence GCTGCCAAAGTACCACAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151903235_1151903242 19 Left 1151903235 17:77031532-77031554 CCAGCCTGTGGTACTTTGGCAGC No data
Right 1151903242 17:77031574-77031596 CAAGGTCATAAAAGGTACCGTGG No data
1151903235_1151903237 -4 Left 1151903235 17:77031532-77031554 CCAGCCTGTGGTACTTTGGCAGC No data
Right 1151903237 17:77031551-77031573 CAGCCCTAACAAATTAATGCAGG No data
1151903235_1151903240 1 Left 1151903235 17:77031532-77031554 CCAGCCTGTGGTACTTTGGCAGC No data
Right 1151903240 17:77031556-77031578 CTAACAAATTAATGCAGGCAAGG No data
1151903235_1151903241 11 Left 1151903235 17:77031532-77031554 CCAGCCTGTGGTACTTTGGCAGC No data
Right 1151903241 17:77031566-77031588 AATGCAGGCAAGGTCATAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151903235 Original CRISPR GCTGCCAAAGTACCACAGGC TGG (reversed) Intergenic
No off target data available for this crispr