ID: 1151904507

View in Genome Browser
Species Human (GRCh38)
Location 17:77038972-77038994
Sequence TTGCATCTTGATTTGGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151904503_1151904507 -5 Left 1151904503 17:77038954-77038976 CCACGACCAGCCTTAATATTGCA No data
Right 1151904507 17:77038972-77038994 TTGCATCTTGATTTGGAGCCTGG No data
1151904500_1151904507 26 Left 1151904500 17:77038923-77038945 CCCAAATTGCTGGGGTTACAGGT 0: 31
1: 2486
2: 87554
3: 344667
4: 357510
Right 1151904507 17:77038972-77038994 TTGCATCTTGATTTGGAGCCTGG No data
1151904502_1151904507 -2 Left 1151904502 17:77038951-77038973 CCACCACGACCAGCCTTAATATT No data
Right 1151904507 17:77038972-77038994 TTGCATCTTGATTTGGAGCCTGG No data
1151904498_1151904507 29 Left 1151904498 17:77038920-77038942 CCTCCCAAATTGCTGGGGTTACA 0: 74
1: 7961
2: 319773
3: 327006
4: 297806
Right 1151904507 17:77038972-77038994 TTGCATCTTGATTTGGAGCCTGG No data
1151904501_1151904507 25 Left 1151904501 17:77038924-77038946 CCAAATTGCTGGGGTTACAGGTG 0: 29
1: 2341
2: 81932
3: 250765
4: 341552
Right 1151904507 17:77038972-77038994 TTGCATCTTGATTTGGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151904507 Original CRISPR TTGCATCTTGATTTGGAGCC TGG Intergenic
No off target data available for this crispr