ID: 1151907201

View in Genome Browser
Species Human (GRCh38)
Location 17:77056363-77056385
Sequence AAAATGATGTTCTCATAGCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151907201_1151907205 13 Left 1151907201 17:77056363-77056385 CCTCGCTATGAGAACATCATTTT No data
Right 1151907205 17:77056399-77056421 GCCCACGAAGGAGCTCCTCGCGG No data
1151907201_1151907208 19 Left 1151907201 17:77056363-77056385 CCTCGCTATGAGAACATCATTTT No data
Right 1151907208 17:77056405-77056427 GAAGGAGCTCCTCGCGGTGCCGG No data
1151907201_1151907204 1 Left 1151907201 17:77056363-77056385 CCTCGCTATGAGAACATCATTTT No data
Right 1151907204 17:77056387-77056409 CTTCTTTTTCAGGCCCACGAAGG No data
1151907201_1151907202 -9 Left 1151907201 17:77056363-77056385 CCTCGCTATGAGAACATCATTTT No data
Right 1151907202 17:77056377-77056399 CATCATTTTCCTTCTTTTTCAGG No data
1151907201_1151907209 20 Left 1151907201 17:77056363-77056385 CCTCGCTATGAGAACATCATTTT No data
Right 1151907209 17:77056406-77056428 AAGGAGCTCCTCGCGGTGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151907201 Original CRISPR AAAATGATGTTCTCATAGCG AGG (reversed) Intergenic
No off target data available for this crispr