ID: 1151907248

View in Genome Browser
Species Human (GRCh38)
Location 17:77056561-77056583
Sequence ACACCCGGGACTCCGGGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151907248_1151907258 0 Left 1151907248 17:77056561-77056583 CCTCCCCCCGGAGTCCCGGGTGT No data
Right 1151907258 17:77056584-77056606 TGAGGGAAGAAACCTGCACTTGG No data
1151907248_1151907260 27 Left 1151907248 17:77056561-77056583 CCTCCCCCCGGAGTCCCGGGTGT No data
Right 1151907260 17:77056611-77056633 TTTTCACCGAGCTGAGCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151907248 Original CRISPR ACACCCGGGACTCCGGGGGG AGG (reversed) Intergenic
No off target data available for this crispr