ID: 1151907258

View in Genome Browser
Species Human (GRCh38)
Location 17:77056584-77056606
Sequence TGAGGGAAGAAACCTGCACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151907244_1151907258 12 Left 1151907244 17:77056549-77056571 CCTACTGATCTTCCTCCCCCCGG No data
Right 1151907258 17:77056584-77056606 TGAGGGAAGAAACCTGCACTTGG No data
1151907243_1151907258 13 Left 1151907243 17:77056548-77056570 CCCTACTGATCTTCCTCCCCCCG No data
Right 1151907258 17:77056584-77056606 TGAGGGAAGAAACCTGCACTTGG No data
1151907241_1151907258 24 Left 1151907241 17:77056537-77056559 CCCGCTTCTGTCCCTACTGATCT No data
Right 1151907258 17:77056584-77056606 TGAGGGAAGAAACCTGCACTTGG No data
1151907253_1151907258 -6 Left 1151907253 17:77056567-77056589 CCCGGAGTCCCGGGTGTTGAGGG No data
Right 1151907258 17:77056584-77056606 TGAGGGAAGAAACCTGCACTTGG No data
1151907248_1151907258 0 Left 1151907248 17:77056561-77056583 CCTCCCCCCGGAGTCCCGGGTGT No data
Right 1151907258 17:77056584-77056606 TGAGGGAAGAAACCTGCACTTGG No data
1151907251_1151907258 -5 Left 1151907251 17:77056566-77056588 CCCCGGAGTCCCGGGTGTTGAGG No data
Right 1151907258 17:77056584-77056606 TGAGGGAAGAAACCTGCACTTGG No data
1151907242_1151907258 23 Left 1151907242 17:77056538-77056560 CCGCTTCTGTCCCTACTGATCTT No data
Right 1151907258 17:77056584-77056606 TGAGGGAAGAAACCTGCACTTGG No data
1151907250_1151907258 -4 Left 1151907250 17:77056565-77056587 CCCCCGGAGTCCCGGGTGTTGAG No data
Right 1151907258 17:77056584-77056606 TGAGGGAAGAAACCTGCACTTGG No data
1151907249_1151907258 -3 Left 1151907249 17:77056564-77056586 CCCCCCGGAGTCCCGGGTGTTGA No data
Right 1151907258 17:77056584-77056606 TGAGGGAAGAAACCTGCACTTGG No data
1151907255_1151907258 -7 Left 1151907255 17:77056568-77056590 CCGGAGTCCCGGGTGTTGAGGGA No data
Right 1151907258 17:77056584-77056606 TGAGGGAAGAAACCTGCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151907258 Original CRISPR TGAGGGAAGAAACCTGCACT TGG Intergenic
No off target data available for this crispr