ID: 1151907260

View in Genome Browser
Species Human (GRCh38)
Location 17:77056611-77056633
Sequence TTTTCACCGAGCTGAGCCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151907257_1151907260 12 Left 1151907257 17:77056576-77056598 CCGGGTGTTGAGGGAAGAAACCT No data
Right 1151907260 17:77056611-77056633 TTTTCACCGAGCTGAGCCCTTGG No data
1151907255_1151907260 20 Left 1151907255 17:77056568-77056590 CCGGAGTCCCGGGTGTTGAGGGA No data
Right 1151907260 17:77056611-77056633 TTTTCACCGAGCTGAGCCCTTGG No data
1151907256_1151907260 13 Left 1151907256 17:77056575-77056597 CCCGGGTGTTGAGGGAAGAAACC No data
Right 1151907260 17:77056611-77056633 TTTTCACCGAGCTGAGCCCTTGG No data
1151907253_1151907260 21 Left 1151907253 17:77056567-77056589 CCCGGAGTCCCGGGTGTTGAGGG No data
Right 1151907260 17:77056611-77056633 TTTTCACCGAGCTGAGCCCTTGG No data
1151907251_1151907260 22 Left 1151907251 17:77056566-77056588 CCCCGGAGTCCCGGGTGTTGAGG No data
Right 1151907260 17:77056611-77056633 TTTTCACCGAGCTGAGCCCTTGG No data
1151907249_1151907260 24 Left 1151907249 17:77056564-77056586 CCCCCCGGAGTCCCGGGTGTTGA No data
Right 1151907260 17:77056611-77056633 TTTTCACCGAGCTGAGCCCTTGG No data
1151907250_1151907260 23 Left 1151907250 17:77056565-77056587 CCCCCGGAGTCCCGGGTGTTGAG No data
Right 1151907260 17:77056611-77056633 TTTTCACCGAGCTGAGCCCTTGG No data
1151907248_1151907260 27 Left 1151907248 17:77056561-77056583 CCTCCCCCCGGAGTCCCGGGTGT No data
Right 1151907260 17:77056611-77056633 TTTTCACCGAGCTGAGCCCTTGG No data
1151907259_1151907260 -8 Left 1151907259 17:77056596-77056618 CCTGCACTTGGATGCTTTTCACC No data
Right 1151907260 17:77056611-77056633 TTTTCACCGAGCTGAGCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151907260 Original CRISPR TTTTCACCGAGCTGAGCCCT TGG Intergenic
No off target data available for this crispr