ID: 1151913315

View in Genome Browser
Species Human (GRCh38)
Location 17:77099043-77099065
Sequence CCATTGCAATAAAAAGAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 433
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 410}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151913315_1151913318 7 Left 1151913315 17:77099043-77099065 CCAAGTTCTTTTTATTGCAATGG 0: 1
1: 0
2: 0
3: 22
4: 410
Right 1151913318 17:77099073-77099095 AGGAGCCCCGTGTAAGTCACTGG 0: 1
1: 0
2: 1
3: 4
4: 82
1151913315_1151913319 11 Left 1151913315 17:77099043-77099065 CCAAGTTCTTTTTATTGCAATGG 0: 1
1: 0
2: 0
3: 22
4: 410
Right 1151913319 17:77099077-77099099 GCCCCGTGTAAGTCACTGGAAGG 0: 1
1: 0
2: 0
3: 9
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151913315 Original CRISPR CCATTGCAATAAAAAGAACT TGG (reversed) Intronic
901075209 1:6550378-6550400 CCTTGGTAATGAAAAGAACTGGG - Exonic
903872429 1:26446016-26446038 CCATCTCAAGAAAAAGAATTTGG + Intronic
905329068 1:37179488-37179510 CCCCTGCAATAGAAAGAGCTGGG + Intergenic
906090365 1:43173640-43173662 ACATAGCAATAAAATGAACTTGG - Intronic
907774879 1:57504236-57504258 CCATTTCAATAAAGGGAACCAGG + Intronic
909220981 1:72961441-72961463 ACATCACAATTAAAAGAACTAGG - Intergenic
910106602 1:83638002-83638024 GCATTATCATAAAAAGAACTTGG + Intergenic
910163902 1:84302732-84302754 GCATTGCAATGAAAAAATCTAGG + Intronic
910290945 1:85599868-85599890 CCATTTAAATAAATAGAACATGG + Intergenic
910613839 1:89175319-89175341 CCATTGCTATAAGAGGAAATGGG - Intronic
910822803 1:91369663-91369685 ACATCACAATTAAAAGAACTAGG + Intronic
911106565 1:94137174-94137196 ACATCACAATTAAAAGAACTAGG + Intergenic
913110181 1:115650405-115650427 GCTTTGCAATAAAAATAAATTGG - Intronic
913129023 1:115821362-115821384 ACTGTGCACTAAAAAGAACTAGG + Intergenic
913258593 1:116977794-116977816 ACATCACAATTAAAAGAACTAGG + Intronic
913402720 1:118454374-118454396 CCATTGCAAAAGAAAGAAATTGG + Intergenic
913975850 1:143454463-143454485 GCATAGCAATAAAAAAAAATGGG + Intergenic
914070245 1:144280082-144280104 GCATAGCAATAAAAAAAAATGGG + Intergenic
914108910 1:144686272-144686294 GCATAGCAATAAAAAAAAATGGG - Intergenic
915889693 1:159761274-159761296 ACATCACAATTAAAAGAACTAGG - Intergenic
915910381 1:159911340-159911362 CCAATTCAATACAATGAACTTGG + Intergenic
916372921 1:164119697-164119719 ACATCACAATGAAAAGAACTAGG + Intergenic
917331003 1:173880114-173880136 CAAATGCAATAAAATGCACTTGG - Intronic
917400885 1:174648273-174648295 ACATCACAATTAAAAGAACTAGG - Intronic
918263800 1:182821256-182821278 CCATTTGAATTTAAAGAACTTGG + Intronic
919274266 1:195392201-195392223 GCATTGCAATTCAAAGACCTTGG - Intergenic
919500168 1:198328608-198328630 CCTTTTCAATAGACAGAACTAGG + Intergenic
920882151 1:209889936-209889958 CCCATGCAATAGAGAGAACTAGG + Intergenic
921458265 1:215397612-215397634 CCATTGCTATAGAAAAAGCTGGG - Intergenic
923438380 1:233991991-233992013 CCATTGCATTGATAAGAAATGGG + Intronic
923690605 1:236189386-236189408 ACATCACAATTAAAAGAACTTGG - Intronic
924199367 1:241642782-241642804 CCATTTCAATAAAAGGACTTTGG + Intronic
1063027803 10:2199843-2199865 CCTTTTCAATAAGCAGAACTTGG + Intergenic
1063302240 10:4860746-4860768 CCATTGCTTTGAAAAGAATTTGG - Intergenic
1064784748 10:18881445-18881467 ACATTAAAATAAAAAGAAATGGG - Intergenic
1065349770 10:24785050-24785072 CCATTACAATAAAATGGAATGGG + Intergenic
1066391690 10:34981977-34981999 TCATAGCAATGAAAAGAAGTGGG - Intergenic
1066930496 10:41752268-41752290 ACATCACAATTAAAAGAACTAGG + Intergenic
1066933773 10:41800950-41800972 ACATCACAATTAAAAGAACTAGG - Intergenic
1066983182 10:42438319-42438341 ACATCACAATTAAAAGAACTAGG + Intergenic
1066983976 10:42447525-42447547 ACATCACAATTAAAAGAACTAGG + Intergenic
1066992487 10:42529277-42529299 ACATCACAATTAAAAGAACTAGG - Intergenic
1067579266 10:47430893-47430915 ACATCACAATTAAAAGAACTAGG - Intergenic
1067855187 10:49786424-49786446 CCTTTTCAATAAACAGAGCTGGG + Intergenic
1068462608 10:57347168-57347190 CCATTGCCACAAAAATACCTAGG - Intergenic
1069194613 10:65534828-65534850 CCATTGCCATGAAAAGATTTTGG + Intergenic
1071215914 10:83401147-83401169 CCATTGAAAAAAAAAAAAATGGG + Intergenic
1071443200 10:85722380-85722402 AAATTACAAAAAAAAGAACTTGG - Intronic
1071773979 10:88763995-88764017 ACTTTGACATAAAAAGAACTGGG + Intronic
1074094048 10:110292487-110292509 CCTTTGAATTAAAAAGCACTGGG - Exonic
1075273388 10:121072444-121072466 TTATAGCAATAAAAAGAGCTGGG + Intergenic
1075939563 10:126378345-126378367 CCATTGCAATATCAAAAAGTTGG + Intronic
1078137840 11:8666763-8666785 TCATTGCAATTAGAATAACTTGG + Intronic
1078756850 11:14219214-14219236 ACATTGCAATGAGAAGAAATAGG - Intronic
1078977981 11:16499381-16499403 ACATCACAATTAAAAGAACTAGG + Intronic
1079516453 11:21274972-21274994 ACATCACAATTAAAAGAACTAGG + Intronic
1079732679 11:23955091-23955113 CAATTCAAATAATAAGAACTCGG + Intergenic
1079814191 11:25034653-25034675 CCAATTCAATAAATGGAACTGGG - Intronic
1080938518 11:36887357-36887379 CCATAGCTATAATGAGAACTAGG + Intergenic
1081073055 11:38633806-38633828 CCACTGCAATAAAAATAGCATGG + Intergenic
1081172873 11:39890312-39890334 ACATCACAATTAAAAGAACTAGG + Intergenic
1083113185 11:60432124-60432146 CAATAGCTATAAAAAGAACATGG + Intronic
1083498026 11:63076024-63076046 ACATCACAATTAAAAGAACTAGG - Intergenic
1085543776 11:77298116-77298138 AGATTGAAATAAAAAGATCTTGG + Intronic
1087484493 11:98744617-98744639 CCAGTGCAATAAAGAGGAGTTGG - Intergenic
1087658070 11:100950784-100950806 CCATTGCATTACATAAAACTTGG - Intronic
1088646696 11:111923090-111923112 CCATTTAAATAAAAATAAGTAGG + Intronic
1092202770 12:6596793-6596815 CCATTTCAAAAAAAAAAATTAGG + Intronic
1094084606 12:26575871-26575893 ACATTGAGAGAAAAAGAACTTGG - Intronic
1094397535 12:30024484-30024506 CCATTCCAATAGAAAGAAATTGG + Intergenic
1094776049 12:33729173-33729195 ACATAACAATTAAAAGAACTAGG - Intergenic
1097779163 12:63684106-63684128 TATTTGCAATAAAGAGAACTGGG + Intergenic
1098270518 12:68765250-68765272 CCATTTCAAAAAAAAAAAATTGG + Exonic
1098423243 12:70327477-70327499 CCACGGCAACACAAAGAACTAGG - Intronic
1099366357 12:81769450-81769472 CCTTTGTAATAAACAGAATTGGG - Intergenic
1099495761 12:83343832-83343854 CCATTTCAAAAGAAAGAAGTTGG - Intergenic
1099559931 12:84160036-84160058 CCAATTCAATAAAAATAAATTGG + Intergenic
1101600964 12:106209840-106209862 ACATCACAATTAAAAGAACTAGG - Intergenic
1101642449 12:106597369-106597391 CCAATACAATTAAAAGAACTTGG - Intronic
1102541738 12:113624958-113624980 CTATTCCAATAAAAGGAACCAGG - Intergenic
1104069863 12:125335313-125335335 TCATTTCAACAAAAAGAACAAGG - Intronic
1108120682 13:47182634-47182656 ACATTGTAATAAGAAAAACTGGG - Intergenic
1108306310 13:49137747-49137769 ACATTACAATCAAAAGTACTGGG - Intronic
1110086549 13:71387632-71387654 ACATCACAATTAAAAGAACTAGG - Intergenic
1110725114 13:78813875-78813897 CCATTATAATAAAGAAAACTAGG - Intergenic
1111015033 13:82369575-82369597 CCATTTCAATAAAAATTACAGGG + Intergenic
1111108047 13:83671711-83671733 CCAGTGGAATAAAAAGAAAATGG + Intergenic
1111227915 13:85299585-85299607 CCATTGTAATAACAAGCAATTGG - Intergenic
1111434466 13:88188669-88188691 ACTCTCCAATAAAAAGAACTAGG + Intergenic
1111797139 13:92936516-92936538 CCATTGCAATTATCAGAACCTGG + Intergenic
1112352413 13:98647178-98647200 CCATTACAAAAAAAATAACAAGG + Intergenic
1112573803 13:100617594-100617616 CCATTGCTTTAAAAAAAAATTGG + Intronic
1113124598 13:106962672-106962694 CAATCGCACTGAAAAGAACTGGG + Intergenic
1113395954 13:109947799-109947821 CCATTGGAAAAAAGAGAGCTAGG + Intergenic
1114766056 14:25372031-25372053 CCATTCCAATAAAATGTTCTGGG - Intergenic
1115122868 14:29958441-29958463 ACATCACAATTAAAAGAACTAGG - Intronic
1115627644 14:35210144-35210166 CAAATGGAAAAAAAAGAACTTGG + Intronic
1115916471 14:38320941-38320963 CCATTCCAAAAGAAAGAAATTGG + Intergenic
1116022578 14:39479382-39479404 ACATCACAATTAAAAGAACTAGG - Intergenic
1116316594 14:43404116-43404138 CTATTGTAATCAAAAGAACATGG + Intergenic
1117084912 14:52190012-52190034 CCATTGCTAAAATAAGAAGTAGG - Intergenic
1117582481 14:57166366-57166388 CCATTTCAAAAAAAAGAAAAAGG + Intergenic
1118078283 14:62327189-62327211 ACATCACAATTAAAAGAACTAGG - Intergenic
1118093588 14:62510850-62510872 CTATTGCAATCAAAAGAGCATGG + Intergenic
1118450335 14:65895107-65895129 ACATCACAATTAAAAGAACTAGG + Intergenic
1118879976 14:69817721-69817743 CCGTCTCAAAAAAAAGAACTTGG - Intergenic
1119756443 14:77123488-77123510 CCATTCCAAGAACAAGGACTGGG + Intronic
1120380545 14:83773502-83773524 CCATTAAAACAAAAAGAACTGGG - Intergenic
1120842864 14:89101849-89101871 ACATCACAATTAAAAGAACTAGG - Intergenic
1123789775 15:23709199-23709221 CCATAGCAATAGGAAGAACAGGG + Intergenic
1123823221 15:24053977-24053999 ACTTTCCAATAAAAAGAACGAGG + Intergenic
1123912769 15:24985290-24985312 CCAGTGCAATACAAGGAAGTTGG + Intergenic
1123949659 15:25258679-25258701 ACATCACAATTAAAAGAACTAGG + Intergenic
1124583189 15:30980619-30980641 ATTTTCCAATAAAAAGAACTAGG + Intronic
1125129918 15:36272099-36272121 CCATGGAAATAAAAAGATCAGGG - Intergenic
1126297416 15:47155974-47155996 ACATTGTAATGAAAAGAAATGGG - Intergenic
1126699697 15:51356884-51356906 GCCTTGTAATAAAAAGAATTTGG + Intronic
1126745511 15:51822273-51822295 CCATCTCAAAAAAAAAAACTGGG + Intergenic
1127367788 15:58307971-58307993 CCATTCCAGTAAGAAAAACTGGG + Intronic
1127559818 15:60124970-60124992 ACATTGCAACATAAAGAACTTGG + Intergenic
1130265266 15:82395604-82395626 CAATTACAAAAAAAAGAAATGGG - Intergenic
1130400573 15:83549285-83549307 CCATTCAAATAAAAATAATTTGG - Intronic
1130475544 15:84262933-84262955 CAATTACAAAAAAAAGAAATGGG - Intergenic
1130482962 15:84376987-84377009 CAATTACAAAAAAAAGAAATGGG - Intergenic
1130506745 15:84551284-84551306 CAATTACAAAAAAAAGAAATGGG + Intergenic
1131352946 15:91718239-91718261 CCAGTCCAATGATAAGAACTTGG - Intergenic
1132096719 15:98991036-98991058 ACATCACAATTAAAAGAACTAGG + Intronic
1134268983 16:12717165-12717187 TCAGAGTAATAAAAAGAACTTGG + Intronic
1135426187 16:22338731-22338753 CCAGGAAAATAAAAAGAACTAGG + Intergenic
1135764507 16:25165965-25165987 CCAGTTCAAAACAAAGAACTGGG - Intronic
1136653116 16:31690249-31690271 ACATCACAATTAAAAGAACTAGG + Intergenic
1137230752 16:46564503-46564525 CTATTTCAATAGAAAGACCTTGG + Intergenic
1137371727 16:47912920-47912942 ACATCACAATTAAAAGAACTAGG + Intergenic
1138734307 16:59232705-59232727 ACATCACAATTAAAAGAACTAGG + Intergenic
1138901017 16:61270438-61270460 TCATTGTAATAAAAAGAAAGAGG - Intergenic
1138997712 16:62474785-62474807 CCATTGCAAAAGGAAGAAATTGG - Intergenic
1140675574 16:77325953-77325975 CCCTTGCAATGAAAATAGCTTGG - Exonic
1141369800 16:83476342-83476364 CCACTGCTGTAAAAAGGACTAGG + Intronic
1141738324 16:85871065-85871087 CAATGGCAACAAAAACAACTAGG + Intergenic
1143886256 17:10067247-10067269 CCATCTCAAAAAAAAGAAGTGGG - Intronic
1144210887 17:13014438-13014460 CCATTGAAAGGAATAGAACTGGG - Exonic
1144929114 17:18843232-18843254 GCATTGTAATATAAAGAAGTTGG + Intronic
1148969932 17:51470845-51470867 CCATTAGAATAAGAAGAGCTGGG + Intergenic
1149044183 17:52225346-52225368 CCATTGCCATAAAACAATCTAGG - Intergenic
1149142046 17:53442958-53442980 CAATTGCAACAAAAACAAGTGGG + Intergenic
1151156398 17:72126402-72126424 ACATTGCATTAAAAAGAAAGTGG + Exonic
1151165492 17:72199561-72199583 CATTTGCATTAAAAAGAAGTAGG - Intergenic
1151913315 17:77099043-77099065 CCATTGCAATAAAAAGAACTTGG - Intronic
1153351683 18:4087806-4087828 CCATTTTAAAATAAAGAACTAGG - Intronic
1153366089 18:4257923-4257945 CGATTGCTAGAAAATGAACTGGG - Intronic
1153454461 18:5264748-5264770 ACATTACAACTAAAAGAACTAGG + Intergenic
1153974477 18:10255731-10255753 ACATCACAATTAAAAGAACTAGG - Intergenic
1154937950 18:21079713-21079735 CCATGGCTACTAAAAGAACTGGG + Intronic
1156083730 18:33374067-33374089 CAACTGCAATAAAGAGATCTGGG + Intronic
1156230455 18:35149254-35149276 ACATCACAATTAAAAGAACTAGG - Intergenic
1156323678 18:36052978-36053000 CCATCTCAAAAAACAGAACTAGG + Intronic
1157999546 18:52600240-52600262 TCATTTCAATAAATAGAGCTGGG - Intronic
1158640549 18:59199973-59199995 ACATTGTAATACAAAGAAGTGGG + Intergenic
1159697263 18:71575521-71575543 CCATTCCAAATAAAAGAAATTGG + Intergenic
1163693075 19:18747626-18747648 CCATCGCAAGAAAAAGAAAGTGG + Intronic
1164277389 19:23732621-23732643 CCAGTGCAATAAATGGCACTGGG - Intergenic
1164433971 19:28212169-28212191 CCCTGGAAATAAAAAGAAGTGGG + Intergenic
927752194 2:25679263-25679285 CCACTGCAAAAAAAAAAAATTGG + Intergenic
929170021 2:38922472-38922494 CCATTGCTATAAACCAAACTAGG + Intronic
929307882 2:40386014-40386036 CCAGTTCAATAAAGAAAACTCGG - Intronic
929705130 2:44203136-44203158 CCATTCTATTAAAAAGAAATCGG - Intronic
930267116 2:49212838-49212860 ACATCACAATTAAAAGAACTAGG + Intergenic
931146534 2:59525800-59525822 TCATTAGAAAAAAAAGAACTAGG - Intergenic
932622248 2:73271633-73271655 CCATCTCAAAAAAAAGAAGTTGG - Intronic
933899378 2:86838134-86838156 CCATTGTTATAATAAGAAATTGG - Intronic
935479534 2:103568518-103568540 CAATTGAAAAAAAAAAAACTGGG + Intergenic
935781184 2:106511094-106511116 CCATTGTTATAATAAGAAGTTGG + Intergenic
936582754 2:113718360-113718382 ATTTTGCTATAAAAAGAACTTGG - Intronic
937695253 2:124801775-124801797 GAATTGCATTATAAAGAACTGGG + Intronic
939066294 2:137487066-137487088 ACATCACAATTAAAAGAACTAGG + Intronic
939986893 2:148838109-148838131 CCATAGGAACAAAGAGAACTGGG - Intergenic
940036988 2:149321410-149321432 CCATTGTGGTAAAAAGAAATGGG + Intergenic
941226134 2:162850355-162850377 CTATTGCAAGAAAAAGGAATTGG - Intergenic
941411098 2:165158027-165158049 ATTTTCCAATAAAAAGAACTAGG - Intronic
941544456 2:166831137-166831159 CAATTTCAATAAAAATTACTAGG - Intergenic
941735329 2:168968617-168968639 TTATTGCAATAAATAAAACTCGG + Intronic
941961038 2:171253761-171253783 ACATGGCAATAAAATGAAGTAGG - Intergenic
943351724 2:186804875-186804897 GCATTGCAATAAACAGTACAGGG - Intergenic
943469382 2:188274978-188275000 CCAGTGCAAAAAGAAGAAGTTGG + Intergenic
943705697 2:191031868-191031890 CAATTTTAATGAAAAGAACTGGG - Intronic
944788686 2:203101233-203101255 CCTTTTCAATAAATAGTACTGGG - Intronic
947375867 2:229494406-229494428 CCATTCCAAAAGGAAGAACTAGG + Intronic
947757311 2:232576196-232576218 CCATCTCAAAAAAAAAAACTGGG + Intronic
1170708061 20:18763753-18763775 CCCTGGCAATAAAAAGAACATGG - Exonic
1172884227 20:38220732-38220754 CCATTGCAATAGAAATAGCACGG - Intronic
1173624405 20:44461682-44461704 CCATGTCAATAAATAGAGCTGGG + Intronic
1175004014 20:55663102-55663124 CCATTTCTAGAAAAAGGACTGGG + Intergenic
1175472632 20:59242216-59242238 CCATTTCAATAATAATAGCTGGG - Intronic
1176335347 21:5592729-5592751 CCATAGCAATAAAAACTACATGG + Intergenic
1176392410 21:6228219-6228241 CCATAGCAATAAAAACTACATGG - Intergenic
1176469009 21:7087955-7087977 CCATAGCAATAAAAACTACATGG + Intergenic
1176492570 21:7469733-7469755 CCATAGCAATAAAAACTACATGG + Intergenic
1176508072 21:7668650-7668672 CCATAGCAATAAAAACTACATGG - Intergenic
1177574083 21:22927980-22928002 ACATTGTAGGAAAAAGAACTAGG - Intergenic
1177828157 21:26106847-26106869 CCATTGCAGGAAAAACAACGTGG - Intronic
1178463910 21:32828926-32828948 GCATATCAATAAATAGAACTGGG - Intergenic
1181370751 22:22414863-22414885 CAATTGTAATACAAACAACTGGG + Intergenic
1181450703 22:23018147-23018169 CCATTTCAAAAAAAAGAAAAAGG + Intergenic
1182523685 22:30901969-30901991 CTATTCCAATAACAAAAACTTGG + Intronic
1182640750 22:31765294-31765316 CCATTTCAAAAAAAAGAAAAAGG - Intronic
1182656198 22:31892153-31892175 TCACTGAAATAAAAAGATCTGGG + Intronic
949221597 3:1640723-1640745 CCATTTCTGTAAAATGAACTTGG - Intergenic
949578759 3:5365169-5365191 TAATTGCTATAAAAATAACTAGG + Intergenic
951133444 3:19075467-19075489 CCATTCCAAAAGAAAGAAATTGG - Intergenic
951417720 3:22445587-22445609 ACATCACAATTAAAAGAACTAGG - Intergenic
951585038 3:24206574-24206596 ACATCACAATTAAAAGAACTAGG + Intronic
951640446 3:24829658-24829680 CAATAGCAATAAAGGGAACTTGG - Intergenic
951676153 3:25244380-25244402 ACATCACAATTAAAAGAACTAGG - Intronic
952538598 3:34341307-34341329 GAATTGCAATCACAAGAACTAGG - Intergenic
953486613 3:43304188-43304210 ACAGTGCAATATAAAGAATTTGG + Intronic
955925335 3:63998838-63998860 CCATTAAAACAAAAATAACTGGG + Intronic
956781919 3:72610519-72610541 CCATTTCAAAAAAAAGAATTAGG + Intergenic
956926422 3:73993770-73993792 ACATCACAATGAAAAGAACTAGG + Intergenic
958763553 3:98337949-98337971 ACATTCCAATAAATAGTACTGGG + Intergenic
959011266 3:101079163-101079185 CCATTGCAATAGAAAGAATGTGG - Intergenic
959183114 3:103007463-103007485 CCATTCCAAAAGAAAGAAATTGG + Intergenic
959371869 3:105537080-105537102 CCATTTCAAGAAAAAAAAATTGG + Intronic
959939877 3:112069896-112069918 ACATCACAATTAAAAGAACTAGG - Intronic
962684634 3:137835474-137835496 CCAGTGCAATAAAAAAAAGGGGG + Intergenic
962877804 3:139549265-139549287 CCAGTGCAATGAACAGAGCTGGG + Intergenic
963209324 3:142671738-142671760 TCATATAAATAAAAAGAACTTGG - Intronic
963340277 3:144024407-144024429 ACATCACAATCAAAAGAACTAGG + Intronic
964152574 3:153545231-153545253 CAATAGCTATAAAAAGAAATAGG - Intergenic
964240815 3:154592093-154592115 CCATTGAAATATAAACATCTTGG + Intergenic
966647664 3:182264775-182264797 CCATTGAAATAAAAATGATTTGG - Intergenic
967048681 3:185761765-185761787 CCATTGCAACAAAAACACTTTGG + Intronic
967312914 3:188122902-188122924 ACTTTACAATAACAAGAACTGGG - Intergenic
967622474 3:191650443-191650465 CCATTCCAAAAGAAAGAAATTGG + Intergenic
968731972 4:2273453-2273475 CCCTTGCAAGAATAAAAACTCGG + Intronic
970070842 4:12158207-12158229 CCATCACAATTAAAAGAACTAGG - Intergenic
970669147 4:18376371-18376393 CCATTGGAAAAAAACGCACTGGG + Intergenic
970893515 4:21074706-21074728 ACATCACAATTAAAAGAACTAGG - Intronic
971247328 4:24941469-24941491 ACATCACAATTAAAAGAACTAGG + Intronic
971698976 4:29943614-29943636 TCCTTGAATTAAAAAGAACTAGG + Intergenic
971886691 4:32458873-32458895 CAATTGCCTAAAAAAGAACTGGG - Intergenic
971969543 4:33604154-33604176 CCATTCCAAAAGAAAGAAATTGG + Intergenic
974754325 4:66183947-66183969 CAATTCCAAAAGAAAGAACTAGG + Intergenic
974883747 4:67790799-67790821 CCATTGAAATCAATAGAATTAGG + Intergenic
975181255 4:71348254-71348276 CCACAGAAATAAAAGGAACTGGG - Intronic
976167893 4:82274820-82274842 ACATCACAATTAAAAGAACTAGG + Intergenic
976268555 4:83207680-83207702 CTATAGTTATAAAAAGAACTAGG - Intergenic
976382027 4:84410359-84410381 CCATTGTACTAAAATTAACTTGG + Intergenic
976417637 4:84797142-84797164 CCATTAAAATGAAAAGAAATAGG + Intronic
976453049 4:85214439-85214461 CCACAGAAATAAAAAGAACCAGG - Intergenic
977330645 4:95633142-95633164 CCATTGCAATGGAAAAATCTAGG + Intergenic
977523018 4:98109801-98109823 CATTAGCAATAAAATGAACTAGG - Intronic
978139373 4:105300125-105300147 ACATCACAATTAAAAGAACTAGG + Intergenic
978197596 4:105989414-105989436 ACATTTTAATAAAAATAACTTGG - Intronic
978571262 4:110140391-110140413 CAATTTAATTAAAAAGAACTAGG - Intronic
980168135 4:129252845-129252867 CCATTCCAAATAAAAGAAATTGG - Intergenic
980971934 4:139575063-139575085 CAATTGCTATAAAAAAAACTTGG - Intronic
981345858 4:143675463-143675485 ACATCACAATTAAAAGAACTAGG + Intronic
981439283 4:144764596-144764618 CCAATGGAAAAAAAACAACTTGG - Intergenic
981608121 4:146562443-146562465 CAAATGCAATAGGAAGAACTAGG - Intergenic
983648420 4:170015418-170015440 CCATTGCAGTAAATACAACTGGG + Intronic
983877719 4:172896577-172896599 CAATTGCAACAAGGAGAACTTGG + Intronic
984351672 4:178602100-178602122 ACCCTGCAATAAAAACAACTTGG + Intergenic
984384086 4:179032988-179033010 ACATCACAATTAAAAGAACTAGG + Intergenic
985393899 4:189520967-189520989 TCATTTCCATAAAGAGAACTAGG - Intergenic
986113528 5:4746339-4746361 CCAATGCAATAATAAAAACATGG - Intergenic
986947183 5:13037007-13037029 ATTTTCCAATAAAAAGAACTAGG + Intergenic
988268968 5:28989852-28989874 CTATTGCAATATACAAAACTAGG - Intergenic
989089692 5:37717311-37717333 CCACTGCAGTGCAAAGAACTAGG - Intronic
989115380 5:37947678-37947700 CTGTAGCAATCAAAAGAACTAGG - Intergenic
989655578 5:43744285-43744307 ACATCACAATTAAAAGAACTAGG - Intergenic
991327154 5:65446980-65447002 CTGTTACCATAAAAAGAACTTGG + Intronic
991539104 5:67706732-67706754 ACATCACAATTAAAAGAACTAGG + Intergenic
991541957 5:67739972-67739994 ACATCACAATTAAAAGAACTAGG - Intergenic
992873422 5:81028658-81028680 CTATTAAAATAAAAATAACTTGG + Intronic
992975328 5:82111113-82111135 CCATTGTAACAAACAGAAATAGG - Intronic
993028934 5:82680997-82681019 GCATTGGAATAAAAAGCTCTGGG + Intergenic
993229907 5:85221293-85221315 CCCTTGGAATAAAAAGAAAATGG - Intergenic
993740270 5:91530096-91530118 CTATTTGAAGAAAAAGAACTAGG - Intergenic
995980329 5:118094715-118094737 CCATTGCAAAAAAAGTAGCTTGG + Intergenic
996550083 5:124721518-124721540 CCAGAGCAATAAATAGAAATGGG + Intronic
996603603 5:125294878-125294900 CCACTGCCATATAAAGCACTTGG + Intergenic
997493359 5:134298405-134298427 TCATGGCAAAAAAAAGAAGTAGG + Exonic
997644256 5:135469940-135469962 CCATTTCATTATACAGAACTAGG - Intergenic
997986971 5:138509589-138509611 CCATTTCTATAAAAAAAATTAGG + Intronic
999467303 5:151819904-151819926 CTATAGCAATGAAAAGAACCTGG - Intergenic
1000384388 5:160660191-160660213 CCATTTAAATGAACAGAACTAGG - Intronic
1000836286 5:166158326-166158348 CCATTGCAATAAAAATATAAAGG - Intergenic
1000897700 5:166875841-166875863 CTATTGCACAAAAAAGAATTGGG + Intergenic
1000921613 5:167144974-167144996 CCACTGCAATAATAAGGACAAGG - Intergenic
1001979353 5:176028307-176028329 CCATTGCAAAAAAATTCACTGGG + Intronic
1002238063 5:177815454-177815476 CCATTGCAAAAAAATTCACTGGG - Intergenic
1003037437 6:2656204-2656226 CTATTGCAATAAACAGAAATTGG + Intergenic
1003471666 6:6441904-6441926 TCATTTCAACAAAAAGAGCTGGG + Intergenic
1003649513 6:7946246-7946268 ACATCACAATTAAAAGAACTAGG - Intronic
1004028287 6:11840281-11840303 ACATCACAATTAAAAGAACTAGG + Intergenic
1004577013 6:16906544-16906566 CCATTGGAAAAAAAAAAAGTAGG + Intergenic
1004630159 6:17413303-17413325 TCTTTGCAATAAAAAGAAAATGG + Intronic
1004651011 6:17608308-17608330 CCATTGTGGTAAAAAGAAATGGG + Exonic
1004989798 6:21124633-21124655 CCATTGCCACAAAGAGAACGAGG - Intronic
1005692533 6:28321259-28321281 CCTTTTCAATAGAAAGACCTAGG - Intergenic
1006236909 6:32641638-32641660 CAATTGCCATAAGAAGATCTGGG - Intronic
1007305810 6:40903434-40903456 CAATTTAAATAAAAAGAAATAGG - Intergenic
1007362519 6:41369251-41369273 CCATAGCACGAAAAAGAACCAGG + Intergenic
1009283605 6:61782889-61782911 CCATTGCCATAAGAAGAATATGG - Intronic
1009677344 6:66842771-66842793 ACATCACAATTAAAAGAACTAGG + Intergenic
1009695591 6:67098468-67098490 ACATCACAATTAAAAGAACTAGG + Intergenic
1009723020 6:67499818-67499840 TCATTGCAGTAAAATGCACTTGG - Intergenic
1011012538 6:82718267-82718289 ACATCACAATTAAAAGAACTAGG + Intergenic
1011185254 6:84668075-84668097 ACAGAGCAATGAAAAGAACTGGG + Intergenic
1011459036 6:87584196-87584218 GCATGGGAAGAAAAAGAACTTGG + Intronic
1011735607 6:90307954-90307976 CAAGTGCTATACAAAGAACTTGG - Intergenic
1012740893 6:103015587-103015609 ACATAACAATGAAAAGAACTAGG - Intergenic
1012858503 6:104530551-104530573 CCATTGCCCTAAAGAGAAATAGG - Intergenic
1013059427 6:106618273-106618295 CCTTAGTAATAAAAAAAACTAGG + Intronic
1013120888 6:107139519-107139541 CCAATGGAATAAACAGATCTGGG - Intergenic
1013206642 6:107952705-107952727 CCAGTGCAATAGCAAGATCTTGG - Intronic
1013492968 6:110668110-110668132 CCATTGAAATAAATACAACTGGG + Intronic
1013850597 6:114509500-114509522 ACACAGCAATAAAAAGAAATGGG - Intergenic
1014058211 6:117041152-117041174 ACATCACAATTAAAAGAACTAGG - Intergenic
1014490485 6:122055785-122055807 CCTTTTCAATAACAAGAACAGGG + Intergenic
1014598499 6:123376820-123376842 CCATTTAAATAAAATGAAATGGG + Intronic
1014882392 6:126739415-126739437 CCCAGGCAATAAACAGAACTAGG + Intergenic
1015432228 6:133145142-133145164 ACATCACAATTAAAAGAACTAGG - Intergenic
1015569080 6:134603573-134603595 CCATTGTGGTAAAAAGAAATGGG - Intergenic
1016011065 6:139137386-139137408 CCTTTAAAATAACAAGAACTGGG - Intronic
1016520215 6:144938515-144938537 CCATGACAATAAAAAGAGCTGGG - Intergenic
1016939279 6:149471133-149471155 CCATTTCTGTAAAAAGCACTGGG + Intronic
1017994239 6:159518303-159518325 ACATTGCAACTAAGAGAACTAGG - Intergenic
1018328507 6:162701468-162701490 GCATTGCAAAAAAAAAAAATTGG + Intronic
1018484098 6:164222802-164222824 CCCTTGCAATACAGAGATCTAGG - Intergenic
1018571134 6:165211221-165211243 CCATTGCAACAAAAAATAATGGG - Intergenic
1018619571 6:165716783-165716805 CCATTGCAAATAAAAGATTTTGG - Intronic
1018656494 6:166041890-166041912 CCTTAGTAATAAGAAGAACTTGG - Intergenic
1019007359 6:168810586-168810608 CCTATGAAATAAAAAGCACTTGG + Intergenic
1020686968 7:11308386-11308408 TGATTGTAATAAAAATAACTTGG + Intergenic
1020696212 7:11417033-11417055 CCATTTAAATAAAAGGTACTGGG + Intronic
1020765736 7:12318165-12318187 CTAATGCAAACAAAAGAACTTGG + Intergenic
1021519757 7:21527322-21527344 CCATTCCAAAAAAGAGAAATTGG - Intergenic
1021770128 7:23991422-23991444 CTATTGAAATAAAAAAAAATCGG + Intergenic
1021876224 7:25052092-25052114 CTATTGAAATAAAAATAAATAGG + Intergenic
1022332505 7:29393594-29393616 CTATTCAAATAAACAGAACTAGG - Intronic
1022938086 7:35201751-35201773 TATTTGCAATAAAGAGAACTAGG + Intergenic
1022949612 7:35323715-35323737 CCATTGCAATCAAAATCTCTGGG - Intergenic
1023108093 7:36782979-36783001 CCATTGCACTAAAAATATCTAGG + Intergenic
1024535845 7:50431812-50431834 CCAAAGCAATAAAAAGGCCTAGG + Intergenic
1025640694 7:63365306-63365328 TCATTGCAATAAAAAGTAAAGGG + Intergenic
1025642005 7:63382780-63382802 TCATTGCAATAAAAAGTAAAGGG - Intergenic
1025717695 7:63977687-63977709 CTATTGCAATAAAAACAAGATGG + Intergenic
1027736653 7:81940732-81940754 ACTATGCAATAAAAAGATCTTGG - Intergenic
1028000358 7:85489340-85489362 ACATTACAATAAAAAACACTTGG - Intergenic
1031034828 7:116777367-116777389 CCTGTGCAAAAGAAAGAACTTGG - Exonic
1033298853 7:140167524-140167546 ACATTTCAATAAATAGTACTGGG + Intronic
1033616720 7:143023498-143023520 CCATTCCAAAAGAAAGAAATAGG - Intergenic
1034098276 7:148429429-148429451 ACATCACAATTAAAAGAACTAGG + Intergenic
1035080949 7:156215500-156215522 CAATTCCAAGAAAAGGAACTGGG - Intergenic
1035816679 8:2548707-2548729 ACATTACAATATAAAGAAGTAGG - Intergenic
1037655566 8:20881142-20881164 CAATAGCAATAAATAGAATTTGG + Intergenic
1039116205 8:34094054-34094076 ACTTTCCAATAAAAAGAACTAGG - Intergenic
1040373535 8:46800383-46800405 ACATCACAATTAAAAGAACTAGG + Intergenic
1040770290 8:50966498-50966520 CAAATGCAATAAAAAGAAAATGG - Intergenic
1041483628 8:58349898-58349920 TCATTAAAATAAAAATAACTTGG - Intergenic
1041685731 8:60642829-60642851 CCATTTTAATATAAACAACTTGG - Intergenic
1041918392 8:63158486-63158508 CCATTGCTATATAAATAAATGGG + Intergenic
1042195309 8:66227116-66227138 CCATTGCAAGAGGGAGAACTAGG + Intergenic
1043010524 8:74876922-74876944 CCATAGCAATAACAATATCTTGG - Intergenic
1043217573 8:77613142-77613164 TCACTGCAACAAAATGAACTTGG - Intergenic
1046269957 8:111881853-111881875 CAAGTGCAATAAAATGACCTAGG - Intergenic
1046479429 8:114796395-114796417 CCACTGTAATAAAAAAACCTAGG + Intergenic
1046824322 8:118670559-118670581 CCTTTGCATTAAAAAACACTGGG - Intergenic
1047846355 8:128809877-128809899 CCATTCCAAAAGAAAGAAATAGG - Intergenic
1050032056 9:1396454-1396476 ACATCACAATTAAAAGAACTAGG + Intergenic
1050064425 9:1743899-1743921 CCAAAGCAATGAAAAGGACTTGG + Intergenic
1050797436 9:9561841-9561863 CCATTCCAACAATAAGAGCTTGG - Intronic
1051025051 9:12598940-12598962 TCATTGCACTTAAAATAACTTGG - Intergenic
1051615498 9:19001818-19001840 ACATCACAATTAAAAGAACTAGG + Intronic
1052515041 9:29469815-29469837 ACATCTCAATGAAAAGAACTAGG - Intergenic
1053211689 9:36234541-36234563 CCTTTACACTAACAAGAACTCGG + Intronic
1053813639 9:41881438-41881460 GTAGTTCAATAAAAAGAACTGGG - Intergenic
1054616957 9:67306001-67306023 GTAGTTCAATAAAAAGAACTGGG + Intergenic
1054994038 9:71364171-71364193 CTACAACAATAAAAAGAACTGGG + Intronic
1055023915 9:71699084-71699106 CCAATCTAATAAAAAGAATTAGG + Intronic
1055252530 9:74325210-74325232 AGATTACAATAAAAAGAATTTGG - Intergenic
1055548840 9:77411361-77411383 ACATCACAATTAAAAGAACTAGG + Intronic
1055982783 9:82021751-82021773 CTAGTGCAATAAAAAGAAATCGG - Intergenic
1056401167 9:86228777-86228799 CCCTTGCAATAAAATTGACTAGG - Intronic
1057889422 9:98857510-98857532 CCATGGCACAAAAATGAACTAGG - Intergenic
1058837958 9:108876383-108876405 CCGTTGAAATAAAAGCAACTAGG - Intronic
1058958930 9:109974609-109974631 GCATTGTAATAAAAAGAAGAAGG + Intronic
1059082513 9:111265537-111265559 CCATTGCAAAAGAAAGAAATTGG + Intergenic
1059748550 9:117226631-117226653 CCATAGCAAGCAAATGAACTAGG + Intronic
1059877202 9:118647741-118647763 CCATTCCAAAAAAGAGAAATAGG - Intergenic
1059909507 9:119026638-119026660 GCAATGAAATAAGAAGAACTGGG + Intergenic
1059986595 9:119826068-119826090 ACTTTGCAATCAAAAGAATTTGG - Intergenic
1060057583 9:120428179-120428201 ACATCACAATTAAAAGAACTAGG + Intronic
1060357969 9:122928471-122928493 ACAGTTCAAAAAAAAGAACTAGG - Intronic
1062222235 9:135422975-135422997 CCTTTGAAAGAAAAAGAACTGGG - Intergenic
1203426292 Un_GL000195v1:42188-42210 CCATAGCAATAAAAACTACATGG - Intergenic
1187180441 X:16938955-16938977 CCATTCAAAAAAAAAGAAATTGG + Intergenic
1187835269 X:23426361-23426383 ACATCACAATTAAAAGAACTAGG - Intergenic
1187945504 X:24422908-24422930 CCATCCAAATAAAAAGCACTTGG - Intergenic
1188035793 X:25316000-25316022 ACATCACAATTAAAAGAACTAGG - Intergenic
1188210023 X:27411622-27411644 CCATTGCAAGAAACAGGCCTTGG - Intergenic
1190941872 X:55049876-55049898 ACATCACAATTAAAAGAACTAGG - Intergenic
1190965492 X:55296621-55296643 ACATTGTAATTAAAAGAACTCGG - Intergenic
1190980255 X:55451329-55451351 CAATTGGAATAAGAAGCACTGGG - Intergenic
1190988720 X:55523550-55523572 CAATTAGAATAAAAAGCACTGGG + Intergenic
1191602141 X:63020076-63020098 ACATCACAATTAAAAGAACTAGG + Intergenic
1191763361 X:64668014-64668036 ACATCACAATTAAAAGAACTAGG - Intergenic
1192271516 X:69584365-69584387 TCATTGTAATAAAAACAATTCGG - Intergenic
1192551507 X:72058326-72058348 CAATTTAAAAAAAAAGAACTGGG - Intergenic
1192876497 X:75234859-75234881 ACATCACAATTAAAAGAACTAGG + Intergenic
1192994266 X:76495704-76495726 ACATCACAATTAAAAGAACTAGG + Intergenic
1193002390 X:76577520-76577542 ACATCACAATTAAAAGAACTAGG - Intergenic
1193387229 X:80886003-80886025 CCATTTCAATTGGAAGAACTTGG + Intergenic
1194292409 X:92091017-92091039 ACATTCCACTAAAAAGAACCAGG + Intronic
1194328149 X:92546166-92546188 CCATTACACAATAAAGAACTTGG - Intronic
1196204683 X:112925960-112925982 ACATCACAATTAAAAGAACTAGG - Intergenic
1196634217 X:117982256-117982278 ACTTTACAATAAAAACAACTGGG + Intronic
1196697002 X:118624017-118624039 CAATTACAATAATATGAACTTGG - Intronic
1197983854 X:132247102-132247124 ACATCACAATTAAAAGAACTAGG - Intergenic
1198382678 X:136099216-136099238 CCATTAAAAAAAAAACAACTAGG - Intergenic
1198561519 X:137855814-137855836 CCATTACAATAAAAAAATCTGGG + Intergenic
1199970463 X:152856528-152856550 CATTTCCCATAAAAAGAACTAGG + Intronic
1200636858 Y:5665367-5665389 CCATTACACAATAAAGAACTTGG - Intronic
1200959864 Y:8986754-8986776 CCATTCCCACAAAAAAAACTAGG + Intergenic
1201248719 Y:12033677-12033699 ACATCACAATTAAAAGAACTAGG - Intergenic
1201278814 Y:12322804-12322826 CCATTGTGGTAAAAAGAAATGGG + Intergenic
1201439254 Y:13990561-13990583 ACATTTCAATAAATAGCACTAGG - Intergenic
1201445319 Y:14052147-14052169 ACATTTCAATAAATAGCACTAGG + Intergenic
1201536151 Y:15050750-15050772 ACATCACAATTAAAAGAACTAGG - Intergenic
1202013634 Y:20375892-20375914 ACATGGAAATAAAAAGAAATGGG + Intergenic
1202375201 Y:24229172-24229194 CAATTACAAAAAAAAGAAATGGG + Intergenic
1202495579 Y:25440948-25440970 CAATTACAAAAAAAAGAAATGGG - Intergenic