ID: 1151913945

View in Genome Browser
Species Human (GRCh38)
Location 17:77103817-77103839
Sequence CCTCATAACCCCATGGAGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 156}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151913945_1151913953 14 Left 1151913945 17:77103817-77103839 CCCGGCTCCATGGGGTTATGAGG 0: 1
1: 0
2: 2
3: 15
4: 156
Right 1151913953 17:77103854-77103876 GGGAAGACCGTGGATCCAGGCGG 0: 1
1: 0
2: 3
3: 13
4: 184
1151913945_1151913958 25 Left 1151913945 17:77103817-77103839 CCCGGCTCCATGGGGTTATGAGG 0: 1
1: 0
2: 2
3: 15
4: 156
Right 1151913958 17:77103865-77103887 GGATCCAGGCGGCACCGGGCGGG 0: 1
1: 0
2: 0
3: 14
4: 163
1151913945_1151913949 -7 Left 1151913945 17:77103817-77103839 CCCGGCTCCATGGGGTTATGAGG 0: 1
1: 0
2: 2
3: 15
4: 156
Right 1151913949 17:77103833-77103855 TATGAGGATACAATGCACAGCGG 0: 1
1: 0
2: 1
3: 22
4: 178
1151913945_1151913956 21 Left 1151913945 17:77103817-77103839 CCCGGCTCCATGGGGTTATGAGG 0: 1
1: 0
2: 2
3: 15
4: 156
Right 1151913956 17:77103861-77103883 CCGTGGATCCAGGCGGCACCGGG 0: 1
1: 0
2: 1
3: 9
4: 95
1151913945_1151913954 20 Left 1151913945 17:77103817-77103839 CCCGGCTCCATGGGGTTATGAGG 0: 1
1: 0
2: 2
3: 15
4: 156
Right 1151913954 17:77103860-77103882 ACCGTGGATCCAGGCGGCACCGG 0: 1
1: 0
2: 0
3: 1
4: 78
1151913945_1151913951 4 Left 1151913945 17:77103817-77103839 CCCGGCTCCATGGGGTTATGAGG 0: 1
1: 0
2: 2
3: 15
4: 156
Right 1151913951 17:77103844-77103866 AATGCACAGCGGGAAGACCGTGG 0: 1
1: 0
2: 0
3: 6
4: 95
1151913945_1151913950 -6 Left 1151913945 17:77103817-77103839 CCCGGCTCCATGGGGTTATGAGG 0: 1
1: 0
2: 2
3: 15
4: 156
Right 1151913950 17:77103834-77103856 ATGAGGATACAATGCACAGCGGG 0: 1
1: 0
2: 0
3: 17
4: 137
1151913945_1151913959 26 Left 1151913945 17:77103817-77103839 CCCGGCTCCATGGGGTTATGAGG 0: 1
1: 0
2: 2
3: 15
4: 156
Right 1151913959 17:77103866-77103888 GATCCAGGCGGCACCGGGCGGGG 0: 1
1: 0
2: 3
3: 8
4: 129
1151913945_1151913957 24 Left 1151913945 17:77103817-77103839 CCCGGCTCCATGGGGTTATGAGG 0: 1
1: 0
2: 2
3: 15
4: 156
Right 1151913957 17:77103864-77103886 TGGATCCAGGCGGCACCGGGCGG 0: 1
1: 0
2: 0
3: 5
4: 109
1151913945_1151913952 11 Left 1151913945 17:77103817-77103839 CCCGGCTCCATGGGGTTATGAGG 0: 1
1: 0
2: 2
3: 15
4: 156
Right 1151913952 17:77103851-77103873 AGCGGGAAGACCGTGGATCCAGG 0: 1
1: 0
2: 0
3: 6
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151913945 Original CRISPR CCTCATAACCCCATGGAGCC GGG (reversed) Intronic
900118862 1:1040198-1040220 CCGATTCACCCCATGGAGCCGGG - Intronic
900388954 1:2425627-2425649 CCTCAGACCCCCAAGTAGCCGGG + Intergenic
901668128 1:10838066-10838088 CCCAACAACCCCATGAAGCCAGG - Intergenic
902043690 1:13510227-13510249 CCTTGTACCCTCATGGAGCCTGG + Intronic
904003434 1:27351065-27351087 CCTCTTAACCTCATGGCCCCAGG + Intronic
905700186 1:40007009-40007031 CCTCAGCCCCCCATGTAGCCAGG + Intergenic
909763146 1:79319556-79319578 CCTCACAAGACTATGGAGCCTGG - Intergenic
909867220 1:80687888-80687910 CCTCAGAAACCCATAGACCCTGG - Intergenic
910492364 1:87786648-87786670 ACTCATAAGCCCATGGTGCCTGG - Intergenic
911029251 1:93468544-93468566 CCTCAGCACCCCATGTAGCTGGG + Intronic
914201066 1:145486105-145486127 CCTCAGCACCCCAAGGAGCTGGG - Intergenic
914480179 1:148059237-148059259 CCTCAGCACCCCAAGGAGCTGGG - Intergenic
914913625 1:151805073-151805095 CCTCAAAGTCCCATGGGGCCAGG + Intronic
914915243 1:151815437-151815459 CCTCATAAACCCCTGGTCCCTGG - Intronic
915876490 1:159616485-159616507 TTTCATATCCCCATGGTGCCTGG + Intergenic
915978159 1:160403985-160404007 CCTCATAACCCCAAGAAGTAGGG - Intronic
918047130 1:180948246-180948268 CCTCACAGCCCCTTGGAGCCTGG - Exonic
919231380 1:194779296-194779318 CCTCATGAGCCCATGCCGCCAGG + Intergenic
920698714 1:208201576-208201598 CATCACTACCCCAGGGAGCCAGG + Intronic
924282595 1:242453088-242453110 CCTCCTAACACCATCGAGCTGGG - Intronic
1067066287 10:43105897-43105919 CCTCACAACCCCCTCCAGCCTGG + Intronic
1067582908 10:47456786-47456808 CCTCTGAATCTCATGGAGCCAGG - Intergenic
1070669357 10:78367214-78367236 GCTCCTATCCACATGGAGCCTGG + Intergenic
1071291327 10:84191311-84191333 CCTCAGTACCAGATGGAGCCTGG + Intergenic
1072607770 10:96998832-96998854 CCTCCCAGCCCCATGGCGCCAGG + Exonic
1072629593 10:97135974-97135996 CATCATCACCCCAAGGACCCCGG - Intronic
1075823536 10:125334353-125334375 CTGCATAACCCCAGGAAGCCTGG + Intergenic
1076238979 10:128888020-128888042 CCTCTGCAGCCCATGGAGCCTGG - Intergenic
1079414842 11:20224226-20224248 CCTCAGGAACCCCTGGAGCCAGG + Intergenic
1083363003 11:62124273-62124295 CCTCATATGCCCAGGTAGCCAGG - Intronic
1084009340 11:66338929-66338951 CCTCTTAACCCCCTGGTTCCAGG + Intronic
1084320832 11:68372629-68372651 CCTCCAAACCCCATGGAGCGGGG - Intronic
1084408217 11:68991229-68991251 CCTTCTAATGCCATGGAGCCTGG + Intergenic
1085127515 11:74011672-74011694 CCTCACAACCCCATGAAGCTGGG + Intergenic
1085200442 11:74698742-74698764 CCTCATTCCCCCTTGGGGCCTGG - Intronic
1092070878 12:5630326-5630348 CTTTATGTCCCCATGGAGCCTGG + Intronic
1097406639 12:59197744-59197766 CCTCATAAACCCATGCTACCAGG + Intergenic
1099615775 12:84933584-84933606 CCTCAGCACCCCATGTAGCTGGG + Intergenic
1102790709 12:115643060-115643082 CAGCATGACTCCATGGAGCCAGG - Intergenic
1104394187 12:128417635-128417657 CCTCACAACCCCATCGAAGCAGG - Intronic
1104774867 12:131385068-131385090 GCTCAGAGGCCCATGGAGCCAGG - Intergenic
1104890533 12:132137637-132137659 CCTCACAACTCCAGTGAGCCGGG + Exonic
1106054996 13:26229305-26229327 CCGCCCAACCCCAGGGAGCCTGG - Intergenic
1110304001 13:73963952-73963974 CCTCATAATCCCATAGTGCTAGG - Intronic
1111373852 13:87352942-87352964 CTTTATAACCCCATTCAGCCAGG + Intergenic
1113743144 13:112724856-112724878 CCTCATTCCACCACGGAGCCAGG + Intronic
1117411138 14:55452217-55452239 CCTTCTGACCCCATGGTGCCTGG + Intronic
1117772582 14:59149903-59149925 CCTCAAACCCCCAAGTAGCCAGG + Intergenic
1118475193 14:66109832-66109854 CCTGATGACCACAAGGAGCCAGG + Intergenic
1118908837 14:70044560-70044582 TGTCATAATCCCTTGGAGCCTGG - Exonic
1120524949 14:85567209-85567231 CCTCAGAATCCCATGGACACTGG + Intronic
1121728480 14:96170063-96170085 CCTCACGACCCCATGGACCAAGG - Intergenic
1124601488 15:31136224-31136246 CTTGGTGACCCCATGGAGCCTGG - Intronic
1126498598 15:49319992-49320014 CCTCATAAAATCATGGAGCCAGG - Intronic
1129079363 15:73025513-73025535 GCTCAAAACCTTATGGAGCCAGG + Intergenic
1129691919 15:77718724-77718746 CATCATAACCCCCTGGGGTCAGG + Intronic
1132470023 16:97358-97380 CCTCATACCCCCAAGTAGCTGGG + Intronic
1133579304 16:7127754-7127776 CCTCATAGCCCCGTGGAGGCAGG + Intronic
1134797739 16:17057068-17057090 CCTCATAATCCCATGGATCTAGG - Intergenic
1135687670 16:24511190-24511212 CCCAGTAGCCCCATGGAGCCAGG - Intergenic
1137603800 16:49774119-49774141 CCTGAGGACCCCAAGGAGCCTGG - Intronic
1138630822 16:58293142-58293164 CCTTCTAACCCCAGGGAGGCAGG + Intronic
1140523570 16:75603241-75603263 CCTAAAAACCACATGAAGCCTGG - Intronic
1141847760 16:86622438-86622460 CATCATGACCACCTGGAGCCTGG + Intergenic
1141981347 16:87552193-87552215 TCTCAGAACCACAGGGAGCCGGG - Intergenic
1144670961 17:17132298-17132320 CCTCATTCCCCCATGGCCCCAGG - Intronic
1144779607 17:17801206-17801228 CCTCCTATCCAGATGGAGCCTGG + Intronic
1146284575 17:31565805-31565827 CCTCATTGTCCCATGGACCCTGG - Intergenic
1146465480 17:33083041-33083063 CTTCATAACCTCAGGGAGACGGG + Intronic
1146765917 17:35521562-35521584 CATCAAAACCCAATTGAGCCTGG + Intronic
1147705216 17:42421486-42421508 GCTCCTAACCCCAGGGAGGCGGG - Intronic
1148357000 17:46982142-46982164 CCTGATCACCCCTTGGAGCCAGG + Intronic
1148785899 17:50146077-50146099 CCTCGGAGCCCCATGGCGCCTGG - Intronic
1149355921 17:55839470-55839492 GGTCCCAACCCCATGGAGCCTGG + Intronic
1150929931 17:69573479-69573501 CTTCATGACCCCATGGAGAAGGG + Intergenic
1151913945 17:77103817-77103839 CCTCATAACCCCATGGAGCCGGG - Intronic
1153413558 18:4820941-4820963 CCTCAGAACCCAAGAGAGCCAGG + Intergenic
1153550023 18:6252906-6252928 CCTTAAAACCCCCTGGGGCCGGG + Intronic
1155507772 18:26549005-26549027 CCTCATTGCCCCCCGGAGCCGGG + Exonic
1157473020 18:48004075-48004097 CCTTATAGCCTCATGGTGCCTGG + Intergenic
1158387727 18:57013962-57013984 TCTCATAACCCTATGCAGCCTGG - Intronic
1159549807 18:69882961-69882983 CATAATAATCCCTTGGAGCCAGG - Intronic
1160415851 18:78710167-78710189 GCTCATCACCCCATGGTGCAGGG - Intergenic
1160585470 18:79911291-79911313 ACACAGAACCCCAGGGAGCCAGG + Intronic
1160605472 18:80046554-80046576 CCTCCCAACCCCCTGGAGCTGGG + Intronic
1163588553 19:18177322-18177344 ACTCATAGTCCCATGGAGTCAGG + Intronic
1167696805 19:51019732-51019754 CCTTTTAACCCCAAGGAGTCCGG + Intronic
1168354638 19:55693498-55693520 GCTGAAAACCCCAAGGAGCCAGG - Intronic
925844289 2:8021204-8021226 CATCATAACTCCATGGAGAGGGG + Intergenic
927133415 2:20079821-20079843 CCTCATGTCCCCATGGAGCCAGG - Intergenic
928053421 2:28025698-28025720 CATCATAACAACATGGAGGCTGG - Intronic
928981441 2:37139468-37139490 CCTCATGGCCCCATGGTGCATGG + Intronic
930036466 2:47088535-47088557 CCTCATAGCCCCCTAGAGGCAGG - Intronic
935349617 2:102142414-102142436 TCTACTACCCCCATGGAGCCTGG - Intronic
938173954 2:129107240-129107262 TCTGAAAACCCCATGGAGGCAGG - Intergenic
941472101 2:165901015-165901037 CCTCAGCACCCCAAGGAGCTGGG + Intronic
941822586 2:169857361-169857383 CCTCAGAACACAATGGGGCCGGG - Intronic
941989663 2:171542763-171542785 CCTCATCATCCCAAGTAGCCAGG - Intronic
947220872 2:227791358-227791380 ACTCACAACACCGTGGAGCCTGG - Intergenic
1169972021 20:11278555-11278577 CCTCAGGGCCCCATGTAGCCTGG + Intergenic
1170627866 20:18043169-18043191 CCTCATGACATCATGGAGCCTGG + Intronic
1170764604 20:19279410-19279432 CCCCATGGCCCCATGAAGCCAGG + Intronic
1171450939 20:25235932-25235954 CATTAAAACTCCATGGAGCCAGG - Intergenic
1172854951 20:37994480-37994502 CCTCATTACCGCATGGAGAGAGG - Intronic
1175748368 20:61477322-61477344 ACGCCTAACCCCATGGGGCCCGG - Intronic
1175926523 20:62474168-62474190 CCTCACAGCCCCCTGGGGCCGGG + Intronic
1177735188 21:25080356-25080378 CCTGAAAACCACAGGGAGCCTGG - Intergenic
1179059977 21:37970936-37970958 CCCCATCACCCCATGGTACCCGG + Intronic
1179341649 21:40516494-40516516 CCTCACAGCCCCATGGAGAGAGG - Intronic
1180595443 22:16969997-16970019 CCACAGAATCCCCTGGAGCCTGG - Exonic
1180940681 22:19658100-19658122 CCATATATCCACATGGAGCCAGG + Intergenic
1181271410 22:21660974-21660996 CCTCATCACCCCCTGGCACCTGG + Intronic
1181936542 22:26442913-26442935 GCTCAGAAGCCCATGAAGCCAGG + Intronic
1182081232 22:27530246-27530268 CCTCACATCACCATTGAGCCAGG + Intergenic
1183135417 22:35882392-35882414 CCTCTTAAACCCACGCAGCCAGG - Intronic
1183701564 22:39454061-39454083 CCCCATATCACCATGGAGCTTGG + Intergenic
1185047696 22:48537253-48537275 CCTCAGGTCCCCAGGGAGCCGGG - Intronic
949698964 3:6733692-6733714 CATCATAACCCATTGCAGCCTGG - Intergenic
950441752 3:13014702-13014724 CCTGATGACCCCAGTGAGCCAGG + Intronic
952275020 3:31868401-31868423 CTTCAAAACCCGATGGAGCTCGG - Intronic
952446478 3:33385618-33385640 CCTCATCACCCCTTGGGCCCAGG - Exonic
953713784 3:45297972-45297994 CCTCATCTCACCAAGGAGCCGGG + Intergenic
954249935 3:49359402-49359424 TCTCAGTACCCCATGGAGCTGGG - Exonic
954372490 3:50176152-50176174 CCACATCTCCCCAGGGAGCCAGG - Intronic
954524916 3:51261523-51261545 TCTCATACCCCAGTGGAGCCTGG + Intronic
954659170 3:52217554-52217576 TCTCATAACCCCAAGAAGCAGGG - Intergenic
955080005 3:55649728-55649750 CCTCATTTCCCCATGGAGCCAGG + Intronic
956132313 3:66065973-66065995 ACTCATAATCCCACCGAGCCTGG + Intergenic
956157999 3:66318295-66318317 CCTCATGAGCCCATGCATCCAGG - Intronic
961593808 3:128000720-128000742 CCTCAGACCCCCAAGGAGCTGGG - Intergenic
961622999 3:128239456-128239478 CCTCTTGACCTCCTGGAGCCTGG - Intronic
962973912 3:140429602-140429624 ACTCTTAACCACATGGAGGCAGG - Intronic
962974387 3:140433435-140433457 CCTCATCTCCCCATGGACCTGGG + Intronic
967771236 3:193335598-193335620 CCTCATAAGCTCATGGAGCAAGG + Intronic
974275594 4:59717286-59717308 CCACATAACTTCATGAAGCCAGG - Intergenic
975127853 4:70802226-70802248 CATCATAATCCCAGGAAGCCTGG - Intronic
977518663 4:98054244-98054266 ACGCATAACCCCATGCAGCAGGG + Intronic
977631513 4:99248235-99248257 TTTCATAACCCAATGGTGCCTGG - Intergenic
982060792 4:151602377-151602399 CTTCATTTCCCCATGGAGTCTGG - Intronic
985511319 5:315753-315775 CCTCCCATCCCCAGGGAGCCTGG - Intronic
985820076 5:2153617-2153639 CCTCATGCCCCCATGGTTCCTGG - Intergenic
985995135 5:3593510-3593532 CCTCAAAACACCAGGGAGCTGGG - Intergenic
992388016 5:76304445-76304467 CTTCATCTCCCCATGGAGGCAGG + Intronic
993020500 5:82585158-82585180 CCTCATAAGCTCATGCAACCAGG - Intergenic
995914724 5:117230680-117230702 CCCCATAACCCCATGAATCATGG - Intergenic
1001598696 5:172915012-172915034 GCTTAAAACCCCAGGGAGCCTGG - Intronic
1001866400 5:175109524-175109546 CATCTTCTCCCCATGGAGCCAGG + Intergenic
1002474873 5:179459100-179459122 TCTCATATCCCCATGCAGCTGGG - Intergenic
1003279247 6:4677555-4677577 TGTCATTACCCCATGAAGCCAGG - Intergenic
1004129464 6:12905111-12905133 GGTCCCAACCCCATGGAGCCTGG + Intronic
1007074820 6:39059769-39059791 CCTCTAGACCCCAGGGAGCCAGG + Intronic
1016241838 6:141940207-141940229 CTTCATACCCCAATGGCGCCTGG + Intergenic
1016505067 6:144769988-144770010 GCTCAAAAGACCATGGAGCCGGG - Intronic
1016737149 6:147491820-147491842 GCTCATAACCCCAAGGTGCCAGG + Intergenic
1018092931 6:160361133-160361155 CCTCATAACTCCATGGGGAGAGG + Intronic
1019638689 7:2090750-2090772 CCCCATCATCCCTTGGAGCCCGG + Intronic
1020874306 7:13674050-13674072 TTTCATACCCCCATGGCGCCTGG - Intergenic
1023912305 7:44564707-44564729 CCTCAGCACTCCATGAAGCCAGG + Intergenic
1033499041 7:141929181-141929203 CCTACTGACCCCAAGGAGCCTGG - Exonic
1035738477 8:1907173-1907195 CCTCATAACACCAGGGAAACGGG - Intronic
1037041663 8:14244064-14244086 CCACTTAAACCCATGTAGCCTGG - Intronic
1038441762 8:27575554-27575576 CCACACAACCCCACAGAGCCTGG - Intergenic
1047744452 8:127833779-127833801 CTTCATATCCCTCTGGAGCCAGG - Intergenic
1049397211 8:142406532-142406554 CCACATGTCCCCATGCAGCCCGG + Intergenic
1052492024 9:29181932-29181954 CCTCAAAACTGCATGGAGTCTGG - Intergenic
1055811767 9:80157092-80157114 CCGCATTAGCCCATGGAGACTGG - Intergenic
1056617440 9:88180520-88180542 CCTCATTGCCCCCTGGAGCCAGG - Intergenic
1061386821 9:130295417-130295439 CCTCAGAACACCATGGGGTCAGG - Intronic
1062037522 9:134389382-134389404 CCCCCTAACCCCCTGGGGCCAGG - Intronic
1189496236 X:41511481-41511503 CCTCATCACCCCATGTAGCTGGG - Intergenic
1189998431 X:46661614-46661636 CCACATAACACCATGTGGCCGGG + Intronic
1192426981 X:71085890-71085912 CCTCATATCCTCATGGAGGCAGG - Intergenic
1196146368 X:112321691-112321713 TCTCATAACCCTATGAAGCGAGG + Intergenic
1200454811 Y:3376756-3376778 CCTCAGAATCCCATGTAGCTAGG - Intergenic