ID: 1151913946

View in Genome Browser
Species Human (GRCh38)
Location 17:77103817-77103839
Sequence CCCGGCTCCATGGGGTTATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 100}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151913936_1151913946 26 Left 1151913936 17:77103768-77103790 CCTCCTACGCCTGGATTTGTTTT 0: 1
1: 0
2: 0
3: 12
4: 238
Right 1151913946 17:77103817-77103839 CCCGGCTCCATGGGGTTATGAGG 0: 1
1: 0
2: 0
3: 9
4: 100
1151913938_1151913946 17 Left 1151913938 17:77103777-77103799 CCTGGATTTGTTTTTCATTTGAC 0: 2
1: 1
2: 2
3: 67
4: 645
Right 1151913946 17:77103817-77103839 CCCGGCTCCATGGGGTTATGAGG 0: 1
1: 0
2: 0
3: 9
4: 100
1151913937_1151913946 23 Left 1151913937 17:77103771-77103793 CCTACGCCTGGATTTGTTTTTCA 0: 1
1: 0
2: 0
3: 19
4: 289
Right 1151913946 17:77103817-77103839 CCCGGCTCCATGGGGTTATGAGG 0: 1
1: 0
2: 0
3: 9
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151913946 Original CRISPR CCCGGCTCCATGGGGTTATG AGG Intronic
900118863 1:1040198-1040220 CCCGGCTCCATGGGGTGAATCGG + Intronic
900388953 1:2425627-2425649 CCCGGCTACTTGGGGGTCTGAGG - Intergenic
901668129 1:10838066-10838088 CCTGGCTTCATGGGGTTGTTGGG + Intergenic
902606516 1:17572280-17572302 CCCTGCTCCATGGGGCCTTGTGG + Intronic
905469850 1:38183363-38183385 CCCGGCTGCATGGGGCCAGGCGG + Intergenic
911029250 1:93468544-93468566 CCCAGCTACATGGGGTGCTGAGG - Intronic
914201067 1:145486105-145486127 CCCAGCTCCTTGGGGTGCTGAGG + Intergenic
914480180 1:148059237-148059259 CCCAGCTCCTTGGGGTGCTGAGG + Intergenic
915978160 1:160403985-160404007 CCCTACTTCTTGGGGTTATGAGG + Intronic
916361254 1:163971881-163971903 CCCTGCTTCATGGGGCTCTGTGG + Intergenic
918047131 1:180948246-180948268 CCAGGCTCCAAGGGGCTGTGAGG + Exonic
918065321 1:181096818-181096840 CACGACCCCAGGGGGTTATGAGG - Intergenic
920565449 1:206969282-206969304 GCCGGCTCCGTGGGGCAATGAGG + Intronic
924282596 1:242453088-242453110 CCCAGCTCGATGGTGTTAGGAGG + Intronic
1073099810 10:101000491-101000513 CTCGGCTCCGTGGGGTTGGGGGG + Exonic
1075682286 10:124341524-124341546 CCCAGCTCCCTGGGGTGATTGGG - Intergenic
1078524476 11:12090147-12090169 CCCAGCTGAATGGGGTTAAGGGG - Intergenic
1084320833 11:68372629-68372651 CCCCGCTCCATGGGGTTTGGAGG + Intronic
1085127514 11:74011672-74011694 CCCAGCTTCATGGGGTTGTGAGG - Intergenic
1085396564 11:76209732-76209754 TCCGGCTCCAGGGGGTTAGCAGG - Intronic
1085530146 11:77187619-77187641 CCCAGGTCCCTGGGGTTTTGGGG + Intronic
1085967542 11:81546416-81546438 CCCGCCTCCAAGGGGAAATGTGG - Intergenic
1086559930 11:88155446-88155468 CCCTGCTCCATGGGGTCTTTTGG - Intronic
1097054839 12:56243158-56243180 CCCGGCGCCATTGGGTTAGATGG - Exonic
1099615774 12:84933584-84933606 CCCAGCTACATGGGGTGCTGAGG - Intergenic
1102347693 12:112170096-112170118 CCCAGCTGCATGGGGTCAGGTGG - Intronic
1104890532 12:132137637-132137659 CCCGGCTCACTGGAGTTGTGAGG - Exonic
1106054997 13:26229305-26229327 CCAGGCTCCCTGGGGTTGGGCGG + Intergenic
1118586576 14:67359351-67359373 CCCGGCTCAATAAGGGTATGTGG + Intronic
1126498599 15:49319992-49320014 CCTGGCTCCATGATTTTATGAGG + Intronic
1130637887 15:85642546-85642568 CCCCGCCCCATGGCGTTAGGGGG + Intronic
1132470022 16:97358-97380 CCCAGCTACTTGGGGGTATGAGG - Intronic
1133579303 16:7127754-7127776 CCTGCCTCCACGGGGCTATGAGG - Intronic
1134797740 16:17057068-17057090 CCTAGATCCATGGGATTATGAGG + Intergenic
1135687671 16:24511190-24511212 CCTGGCTCCATGGGGCTACTGGG + Intergenic
1136284821 16:29234567-29234589 TGCTGCTCTATGGGGTTATGGGG - Intergenic
1136284829 16:29234597-29234619 CGCTGCTCTATGGGGTTACGGGG - Intergenic
1138553840 16:57760988-57761010 CCCTGCCCCTTGGGGTTGTGGGG + Intronic
1142089841 16:88204043-88204065 CGCTGCTCTATGGGGTTACGGGG - Intergenic
1142089891 16:88204223-88204245 CGCTGCTCTATGGGGTTACGGGG - Intergenic
1148356999 17:46982142-46982164 CCTGGCTCCAAGGGGTGATCAGG - Intronic
1151913946 17:77103817-77103839 CCCGGCTCCATGGGGTTATGAGG + Intronic
1153550022 18:6252906-6252928 CCCGGCCCCAGGGGGTTTTAAGG - Intronic
1155507771 18:26549005-26549027 CCCGGCTCCGGGGGGCAATGAGG - Exonic
1157574762 18:48736197-48736219 CACAGCCCCATGGGGCTATGCGG - Intronic
1160605471 18:80046554-80046576 CCCAGCTCCAGGGGGTTGGGAGG - Intronic
1161554470 19:4932856-4932878 CCCCGCTCCTTGGGGTTGTCGGG - Exonic
926150743 2:10424424-10424446 TCCGGTCCCATGGGGTTGTGAGG + Intronic
927133416 2:20079821-20079843 CCTGGCTCCATGGGGACATGAGG + Intergenic
927645286 2:24873443-24873465 CCCGGCTCAAAGGGCTTCTGGGG + Intronic
929713766 2:44290779-44290801 CTTGCCTCCATGGGGTTGTGGGG + Intronic
941472100 2:165901015-165901037 CCCAGCTCCTTGGGGTGCTGAGG - Intronic
941822587 2:169857361-169857383 CCCGGCCCCATTGTGTTCTGAGG + Intronic
1170627865 20:18043169-18043191 CCAGGCTCCATGATGTCATGAGG - Intronic
1170764603 20:19279410-19279432 CCTGGCTTCATGGGGCCATGGGG - Intronic
1173454703 20:43192597-43192619 CCCAGCTCCCTGGGCTGATGGGG - Intergenic
1173595811 20:44257890-44257912 CCCCTGTCCATGGGGTTCTGGGG - Intronic
1175416888 20:58807374-58807396 CCCGGCCCCATGTTGTTATTTGG + Intergenic
1175926522 20:62474168-62474190 CCCGGCCCCAGGGGGCTGTGAGG - Intronic
1176991054 21:15496688-15496710 CCCGGAGCTATGGGGTAATGGGG - Intergenic
1179059976 21:37970936-37970958 CCGGGTACCATGGGGTGATGGGG - Intronic
1180595444 22:16969997-16970019 CCAGGCTCCAGGGGATTCTGTGG + Exonic
1180940680 22:19658100-19658122 CCTGGCTCCATGTGGATATATGG - Intergenic
1181455600 22:23058657-23058679 CCCAGCTTCAGGGGGCTATGGGG - Intergenic
1183654005 22:39174812-39174834 GTGGGCTCCATGGGGGTATGGGG + Intergenic
1183701563 22:39454061-39454083 CCAAGCTCCATGGTGATATGGGG - Intergenic
1183711146 22:39504227-39504249 CTCGGCTCCACGGGGCCATGGGG - Exonic
1185047697 22:48537253-48537275 CCCGGCTCCCTGGGGACCTGAGG + Intronic
1185052052 22:48559169-48559191 CCCGGGGCCATGGTGTTTTGTGG + Intronic
953407630 3:42667291-42667313 CCCGGCTCCTTGGGGCTCTCTGG + Intergenic
953713783 3:45297972-45297994 CCCGGCTCCTTGGTGAGATGAGG - Intergenic
954372491 3:50176152-50176174 CCTGGCTCCCTGGGGAGATGTGG + Intronic
955080004 3:55649728-55649750 CCTGGCTCCATGGGGAAATGAGG - Intronic
956690732 3:71875765-71875787 CCCTGCTGCAGGGGGTTAAGTGG - Intergenic
961593809 3:128000720-128000742 CCCAGCTCCTTGGGGGTCTGAGG + Intergenic
962974386 3:140433435-140433457 CCCAGGTCCATGGGGAGATGAGG - Intronic
967771235 3:193335598-193335620 CCTTGCTCCATGAGCTTATGAGG - Intronic
974275595 4:59717286-59717308 CCTGGCTTCATGAAGTTATGTGG + Intergenic
984668017 4:182448883-182448905 CCCGGCGCGAAGGGGTTAAGCGG + Intronic
985995136 5:3593510-3593532 CCCAGCTCCCTGGTGTTTTGAGG + Intergenic
987632016 5:20485951-20485973 ATAGGCTCCATGGGGTCATGTGG + Intronic
994620289 5:102154908-102154930 GCCGGCTCCCTGGGCTTGTGGGG + Intergenic
995914725 5:117230680-117230702 CCATGATTCATGGGGTTATGGGG + Intergenic
998848515 5:146333763-146333785 CTCAGCTCCATGGGGGTATGAGG + Intronic
999471527 5:151859057-151859079 ACCTGCTTCATGGGGTTATTAGG + Intronic
1000437431 5:161230410-161230432 CCCAGCTGCACGGGGTCATGTGG - Intergenic
1002351930 5:178589706-178589728 GCCGGCCCCAAGGGGTTTTGCGG - Intronic
1007819793 6:44552880-44552902 CTCGGCTCCAGGTGGTTGTGTGG - Intergenic
1013117578 6:107114803-107114825 GGCGGCTCCATGGCGTTCTGGGG - Intronic
1019638688 7:2090750-2090772 CCGGGCTCCAAGGGATGATGGGG - Intronic
1019901204 7:4021979-4022001 CCCAGCTCCATGGGGCTGTTTGG + Intronic
1027539828 7:79453347-79453369 CTGGGCTCCTTGGGGTTAGGGGG + Exonic
1032893301 7:136222692-136222714 CTGGGCTCCATGGGGGTATGGGG - Intergenic
1035738478 8:1907173-1907195 CCCGTTTCCCTGGTGTTATGAGG + Intronic
1037041664 8:14244064-14244086 CCAGGCTACATGGGTTTAAGTGG + Intronic
1038441763 8:27575554-27575576 CCAGGCTCTGTGGGGTTGTGTGG + Intergenic
1047281250 8:123448120-123448142 CTCGGCTCCATAGAGTTATCAGG - Intronic
1047315791 8:123731756-123731778 CCCAGCTACTTGGGGGTATGGGG + Intronic
1049024905 8:139981690-139981712 CCCATCTCCTGGGGGTTATGTGG - Intronic
1049397210 8:142406532-142406554 CCGGGCTGCATGGGGACATGTGG - Intergenic
1055305399 9:74924061-74924083 CCCAGCTCCATGGGGGTGGGGGG + Intergenic
1055811768 9:80157092-80157114 CCAGTCTCCATGGGCTAATGCGG + Intergenic
1056617441 9:88180520-88180542 CCTGGCTCCAGGGGGCAATGAGG + Intergenic
1062037523 9:134389382-134389404 CCTGGCCCCAGGGGGTTAGGGGG + Intronic
1188280025 X:28255699-28255721 CAGGGCTCCATGGAGTTATTGGG + Intergenic
1189496237 X:41511481-41511503 CCCAGCTACATGGGGTGATGAGG + Intergenic
1189998430 X:46661614-46661636 CCCGGCCACATGGTGTTATGTGG - Intronic
1192426982 X:71085890-71085912 CCTGCCTCCATGAGGATATGAGG + Intergenic
1193562249 X:83032809-83032831 GCCTGCTTCCTGGGGTTATGAGG + Intergenic
1200110469 X:153738207-153738229 CCCGGCTCCCTGAGCATATGTGG - Intronic