ID: 1151914446

View in Genome Browser
Species Human (GRCh38)
Location 17:77107143-77107165
Sequence CAACCACCGTGGACCCACAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 90}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151914446 Original CRISPR CAACCACCGTGGACCCACAG GGG Intronic
900389652 1:2428409-2428431 GAGCCACCGTGGTCCCAGAGTGG - Intronic
900553335 1:3267781-3267803 CACCCACTGTGGACCCGCAGCGG - Intronic
901322880 1:8350109-8350131 CATCCATCGTGGATCCCCAGGGG - Intergenic
902075589 1:13782328-13782350 CAACCACCGCAGACGGACAGCGG + Exonic
902923509 1:19680881-19680903 CAAGCACCATGGCCCCTCAGAGG - Intergenic
903580435 1:24366629-24366651 GAGCCAGCCTGGACCCACAGAGG - Intronic
904206236 1:28856996-28857018 CTACCACCGAGGACACCCAGGGG + Intronic
908268333 1:62399705-62399727 CACCCAAAGTGGACCCAAAGTGG + Intergenic
919819079 1:201461671-201461693 GAACCATGGTGGACCCACTGAGG + Intergenic
919990714 1:202707435-202707457 CCACCACCCTGGACCTTCAGTGG + Intronic
922154609 1:223031316-223031338 TGACCACCGTCAACCCACAGAGG - Intergenic
1077937216 11:6800878-6800900 CCACCACCGAGAACCCACATGGG - Intergenic
1086049779 11:82576936-82576958 CAAGCAGCTTGGACCCACCGAGG + Intergenic
1090494502 11:127196975-127196997 CAAAAACTGTGGACCCAGAGAGG - Intergenic
1099036054 12:77589050-77589072 AAAGCAACGTGGACTCACAGAGG + Intergenic
1100472335 12:94904697-94904719 CACCCACCTTGGACTCCCAGAGG + Intronic
1105206377 13:18229137-18229159 CAGCCACTGTGGATCCTCAGAGG + Intergenic
1114193890 14:20460888-20460910 CTACCACCGTGGAGCATCAGTGG - Intronic
1119520081 14:75278735-75278757 CAACCACGGTGGCGCCAGAGGGG - Intergenic
1119939194 14:78622664-78622686 CAATCACCCTGCACTCACAGAGG - Intronic
1122276139 14:100591761-100591783 CTACAACTGTGGCCCCACAGGGG + Intergenic
1122663182 14:103311434-103311456 CAACCTCCGTGGACCATCCGGGG - Intergenic
1124347389 15:28931667-28931689 CAACCACTTTGGACTCTCAGAGG - Intronic
1131957136 15:97748612-97748634 CAGCCACTGTGGGCCCCCAGTGG + Intergenic
1133631930 16:7629926-7629948 GACCCACCCTGGACCCACACTGG - Intronic
1133660754 16:7915073-7915095 CAACCACCTGGGACACCCAGAGG + Intergenic
1134228183 16:12408332-12408354 GCACCACAGTGGACCCAGAGAGG - Intronic
1134880256 16:17740010-17740032 GATCCACCGTGGACACACCGAGG - Intergenic
1136355909 16:29744735-29744757 CAGCCACCGTGCACCCACCCTGG - Exonic
1136630859 16:31488568-31488590 CAGCCGCCCTGGACCCCCAGTGG + Intronic
1138687224 16:58735967-58735989 CAGGCAACGTGGAGCCACAGAGG - Intergenic
1139496154 16:67320034-67320056 CAGCCACCATGGACCCAGAATGG - Intronic
1143476798 17:7207877-7207899 GAAACACCTTGGTCCCACAGAGG - Intronic
1147391773 17:40113665-40113687 AAGCCAGCGTGGAGCCACAGAGG - Intergenic
1147902632 17:43799222-43799244 CAACCACTGTGTTCCCACACTGG + Intergenic
1151313838 17:73310421-73310443 CCAGCACCCTGGACCCTCAGGGG + Intronic
1151914446 17:77107143-77107165 CAACCACCGTGGACCCACAGGGG + Intronic
1165228037 19:34367848-34367870 CAAACACCATGGACACACATTGG + Intronic
1166297475 19:41896142-41896164 CATCCACCCAGGACACACAGGGG + Intronic
928742353 2:34369978-34370000 CAAACACCGTAAACCCACAAAGG - Intergenic
929484697 2:42342922-42342944 CGGGCACCGTGGAGCCACAGAGG + Intronic
938680420 2:133684176-133684198 CAATCACAGTGGACCATCAGTGG + Intergenic
943365118 2:186961421-186961443 GAACCACAGGGGACTCACAGTGG - Intergenic
948930796 2:241130692-241130714 CACTCAACGCGGACCCACAGTGG + Intronic
1171892016 20:30725278-30725300 CAACCACCATGGCCCCTGAGAGG - Intergenic
1178403028 21:32303522-32303544 CCACCAGTGTGGACCCAGAGGGG + Intronic
1179886312 21:44315713-44315735 GCACCAGTGTGGACCCACAGTGG + Intronic
1180144470 21:45911466-45911488 AAACCACCGTGGAGGAACAGAGG + Intronic
1180759575 22:18189570-18189592 CAGCCACTGTGGATCCTCAGAGG - Intergenic
1180769887 22:18373869-18373891 CAGCCACTGTGGATCCTCAGAGG - Intergenic
1180776442 22:18488797-18488819 CAGCCACTGTGGATCCTCAGAGG + Intronic
1180809169 22:18746166-18746188 CAGCCACTGTGGATCCTCAGAGG + Intergenic
1180827827 22:18876826-18876848 CAGCCACTGTGGATCCTCAGAGG - Intergenic
1181072088 22:20351145-20351167 CAGCCACTGTGGATCCTCAGAGG + Intronic
1181195163 22:21180087-21180109 CAGCCACTGTGGATCCTCAGAGG + Intergenic
1181214283 22:21312687-21312709 CAGCCACTGTGGATCCTCAGAGG - Intergenic
1181485592 22:23229800-23229822 CAGCAACAGTGGACCCTCAGGGG - Intronic
1181524738 22:23474325-23474347 CAGCCACTGTGGATCCACAGAGG - Intergenic
1182301810 22:29341151-29341173 CAACCACCTGGGAACAACAGAGG + Intronic
1183363390 22:37394537-37394559 CAGCCCCCGTGGACCGTCAGGGG + Intronic
1203231717 22_KI270731v1_random:115053-115075 CAGCCACTGTGGATCCTCAGAGG - Intergenic
1203277925 22_KI270734v1_random:102822-102844 CAGCCACTGTGGATCCTCAGAGG - Intergenic
951279499 3:20731325-20731347 CCACCACCATAGACCCACAGTGG + Intergenic
958803174 3:98779779-98779801 CAACCACCCTGGAAACACGGAGG - Intronic
964752484 3:160065204-160065226 GAACCACAGGGGACCCACAGTGG - Intergenic
971904723 4:32711611-32711633 CAACCTCCTTGGACCCTCACTGG - Intergenic
974763741 4:66312341-66312363 CAACCCCCATGAAACCACAGTGG - Intergenic
976082785 4:81375160-81375182 CCACCACCACAGACCCACAGCGG + Intergenic
979093148 4:116513361-116513383 CAACCTCAGTGGACCCTAAGTGG - Intergenic
989975265 5:50578321-50578343 CAACCTCCTTGGACCCTCACTGG + Intergenic
999960139 5:156745604-156745626 CAGCCAATGTAGACCCACAGAGG + Intronic
1000225378 5:159256165-159256187 CAACCACTGTGGACCCTCACTGG + Intergenic
1004671229 6:17799343-17799365 CAGCCACCGTAGACTCACACTGG + Exonic
1007320007 6:41021287-41021309 CAACCTCCGTGTACTCACTGAGG + Intergenic
1007363366 6:41373706-41373728 TGGCCACCGTGGGCCCACAGAGG + Intergenic
1010149073 6:72709086-72709108 CACCCACCTTGGCCCCACAAAGG + Intronic
1011102886 6:83743886-83743908 CCACCATCATCGACCCACAGGGG + Intergenic
1013801268 6:113947712-113947734 CAACCACTGTTGACCTACAAAGG + Intronic
1016743503 6:147553511-147553533 CAACCACTCTGGACCCACGCTGG + Intronic
1019758005 7:2787659-2787681 CAGTCAGCGTGGACCCACAACGG - Intronic
1020794170 7:12661541-12661563 CTACCACCCTAGACCCATAGGGG + Intergenic
1024484387 7:49900682-49900704 GAAGCACCGTGGACCCAGATAGG + Intronic
1028970936 7:96858326-96858348 AAAGCACTGTGGTCCCACAGCGG + Intergenic
1031035397 7:116782993-116783015 CAACCAAAGTAAACCCACAGGGG + Intronic
1032751050 7:134842003-134842025 CAACCTCCAGGGACCCTCAGTGG + Intronic
1040522107 8:48186874-48186896 TAAGCAACATGGACCCACAGTGG - Intergenic
1041147595 8:54893966-54893988 CAACCACGGTGACCCCACAGTGG - Intergenic
1041731390 8:61066651-61066673 CAACCTCCGTTGACCCACAGGGG - Intronic
1041872294 8:62648781-62648803 CAACCAGCCTGGACCCATGGAGG - Intronic
1043312352 8:78876344-78876366 CCACCACCACTGACCCACAGGGG + Intergenic
1047285076 8:123480817-123480839 AAGCCACAGTGGACTCACAGTGG - Intergenic
1048264987 8:132977904-132977926 CAAACACCTTGGAAGCACAGAGG + Intronic
1048630203 8:136234114-136234136 CAACAACCCTGCACCCACATAGG + Intergenic
1052375842 9:27716668-27716690 CACCCACCATGTACCGACAGTGG + Intergenic
1189319252 X:40077751-40077773 CAGCCACCGTGGGCCCAAAAGGG - Intronic
1192433748 X:71129601-71129623 GACCCACCCTGGGCCCACAGAGG - Intronic
1193871345 X:86802717-86802739 CAGCCATCGTGGTCCCTCAGTGG - Intronic
1195563889 X:106319412-106319434 CAACCACCATGGAGGCACAAAGG + Intergenic