ID: 1151916463

View in Genome Browser
Species Human (GRCh38)
Location 17:77121759-77121781
Sequence ACAGCCTTTAACGGTGAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 63}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151916458_1151916463 -8 Left 1151916458 17:77121744-77121766 CCTGCCCAATGCCACACAGCCTT 0: 1
1: 0
2: 7
3: 58
4: 473
Right 1151916463 17:77121759-77121781 ACAGCCTTTAACGGTGAATCAGG 0: 1
1: 0
2: 0
3: 2
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151916463 Original CRISPR ACAGCCTTTAACGGTGAATC AGG Intronic
900664327 1:3804155-3804177 ACAGCCCATAACGGAGAAACAGG + Intergenic
908641774 1:66231839-66231861 AAAGCCTATCACGGTGATTCAGG + Intronic
908934533 1:69358483-69358505 ATAGCCTTTATAGGAGAATCTGG + Intergenic
911459186 1:98167886-98167908 ACAGCCTTTCACTCTGAGTCTGG + Intergenic
1068133397 10:52923751-52923773 AGAGTCATTAACTGTGAATCAGG - Intergenic
1083203432 11:61133379-61133401 AGTGCCTTTAACACTGAATCAGG - Intronic
1094596108 12:31868053-31868075 ACAGCTGTAAAGGGTGAATCTGG + Intergenic
1101520827 12:105480588-105480610 TCAGCCTTTCACGGTGAAAGGGG - Intergenic
1106953943 13:34914870-34914892 ACAGGGTTTACCTGTGAATCTGG + Intergenic
1109961055 13:69631774-69631796 ATACCCTTAAATGGTGAATCAGG + Intergenic
1112908835 13:104456875-104456897 AGTGCCTTTAAAGGTGAATGAGG + Intergenic
1116548225 14:46198385-46198407 ACTGCCTTTCAGTGTGAATCAGG - Intergenic
1124101410 15:26697598-26697620 GCAGCATTTAAGGGTGAATGTGG - Intronic
1125361165 15:38866346-38866368 TCAGCCTTGAACGGTGAGTGGGG - Intergenic
1131797801 15:96037571-96037593 ACAGCATTATACGGTGAAACCGG - Intergenic
1139494240 16:67304411-67304433 CCAGCCTTTACAGGTGAATTGGG - Exonic
1139681206 16:68565242-68565264 ACAGCCTATAAGGGTAAAGCTGG + Exonic
1144639100 17:16927806-16927828 ACATCCTTCCACGGTGACTCTGG - Intergenic
1151916463 17:77121759-77121781 ACAGCCTTTAACGGTGAATCAGG + Intronic
1154132195 18:11747136-11747158 ACAGCCTTGAACTGAGAGTCTGG + Intronic
1155505407 18:26528241-26528263 ACAGCCTTTAATGGGGAGCCAGG + Intronic
1157598522 18:48878476-48878498 ACAGCCTTTGACAGGGAGTCAGG - Intergenic
1162781562 19:13009623-13009645 ACACCCTTAAGCGGGGAATCAGG - Intronic
928207306 2:29295190-29295212 ACAGCCTTTAACAGGGAAGAAGG + Intronic
930299996 2:49603579-49603601 ACAGCCTTTAACTATGCAGCAGG + Intergenic
931066421 2:58592736-58592758 ATAGCATTCAACAGTGAATCTGG + Intergenic
935321348 2:101892432-101892454 TCAACCTCTAATGGTGAATCTGG - Intronic
936671115 2:114657881-114657903 AAAGCTTATAAAGGTGAATCAGG + Intronic
943984104 2:194596624-194596646 ATAGACCTTAACGGTGATTCTGG - Intergenic
948069882 2:235112061-235112083 ACAGCATTTCAGGGTGAAGCTGG + Intergenic
1181772518 22:25136498-25136520 ACAGCCCTAAACCGTGAGTCAGG + Intronic
1183613174 22:38924378-38924400 ACTTCCTTTAACCCTGAATCAGG + Intergenic
950869116 3:16213573-16213595 ACAGCATTTATGGGTCAATCTGG - Intronic
958454829 3:94317682-94317704 AGGGCCTTTAGCGGAGAATCTGG - Intergenic
958576721 3:95959225-95959247 AAAGACTTTAAAGTTGAATCAGG + Intergenic
959499578 3:107090109-107090131 CCAGCCTTAAACAGTGATTCTGG + Intergenic
961941357 3:130640307-130640329 ACAGCCATAAAATGTGAATCTGG - Intronic
963069147 3:141288249-141288271 CCAGCCTTTATGGGTGAATTGGG + Intronic
964247162 3:154666969-154666991 ACAGACTTGAAGGATGAATCTGG + Intergenic
965608183 3:170517494-170517516 ACAGCCTTGAGAGGTGAAACAGG - Intronic
965703518 3:171482396-171482418 AGAGCCTGTAATGTTGAATCTGG + Intergenic
965929246 3:174022462-174022484 ACAGCCAATAATGGTGACTCCGG + Intronic
972593637 4:40511195-40511217 ACAACCTTTCAAGGTGATTCTGG - Intronic
972693741 4:41424364-41424386 ACAGCTTTTAACTGTAATTCAGG - Intronic
973035241 4:45397722-45397744 ACAACCTTTACAGGAGAATCTGG + Intergenic
973584293 4:52375503-52375525 ACAGGCTTTCACCTTGAATCGGG + Intergenic
978228324 4:106366022-106366044 ACAGTCTTCAACTGTGAATAAGG - Intergenic
987384659 5:17317789-17317811 ACACCCTTTATTGCTGAATCCGG - Intergenic
990534617 5:56708033-56708055 ACAGACTTTAACAGTGAAAGGGG + Intergenic
1002972905 6:2042466-2042488 ATAGCCTGTAAAGGTGACTCTGG - Intronic
1013466321 6:110420057-110420079 ACACCTTTTAACAGTGATTCAGG + Intergenic
1013839824 6:114378113-114378135 AAAGCCTTTAAGGATGACTCAGG - Intergenic
1021750069 7:23788567-23788589 ACAGCCATTAGAGGTGAATCAGG - Intronic
1037359925 8:18062359-18062381 AAAACCTTTAACAGTGAATTTGG - Exonic
1041678673 8:60563837-60563859 ACAGCTATTAAAGTTGAATCTGG - Intronic
1044051983 8:87516413-87516435 AGGGCCTTTAACGTTGAACCTGG + Intronic
1046794461 8:118355844-118355866 ACAACCTTTGACTGTGATTCTGG + Intronic
1050489127 9:6168568-6168590 ACGTCCTTTAAAGGTGCATCAGG + Intergenic
1051184694 9:14447598-14447620 ACTGCTTTTAATGGTGAATGTGG - Intergenic
1060141283 9:121212495-121212517 ACAGCCTTCAAGGTTGACTCTGG + Intronic
1186558085 X:10582033-10582055 ACAGCCTTTATCTTTGATTCAGG - Intronic
1187997525 X:24944483-24944505 GCAGCCTTTAACTCTGAATCAGG + Intronic
1190620119 X:52278882-52278904 ACAGGCTTTAAGGGTCAACCAGG - Intergenic
1196761108 X:119201736-119201758 ACAGCCTACAACGATGACTCAGG + Intergenic
1197794520 X:130285100-130285122 AAAACCTTTAACACTGAATCTGG + Intergenic
1201486204 Y:14497024-14497046 GCAGCCTTTAATAGTGAATGGGG - Intergenic