ID: 1151917648

View in Genome Browser
Species Human (GRCh38)
Location 17:77130255-77130277
Sequence ATGCTTCAGCTCAGTCCATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 168}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151917643_1151917648 19 Left 1151917643 17:77130213-77130235 CCAGTGTGGGGTGGAGGGGTGGT 0: 1
1: 0
2: 7
3: 40
4: 432
Right 1151917648 17:77130255-77130277 ATGCTTCAGCTCAGTCCATGTGG 0: 1
1: 0
2: 0
3: 14
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151917648 Original CRISPR ATGCTTCAGCTCAGTCCATG TGG Intronic
900814452 1:4832764-4832786 AAGCTGCATCTCAGGCCATGTGG + Intergenic
900888527 1:5432391-5432413 AGGATTTAGCTCAGTCCCTGGGG - Intergenic
901794668 1:11673399-11673421 AGGCCTCACCTCTGTCCATGTGG - Exonic
904071824 1:27805089-27805111 ATGCTTCAGTTTTGTCCATCTGG + Intronic
904892710 1:33791457-33791479 ATGCTTCTGCTCAGGACATGTGG - Intronic
905049389 1:35036752-35036774 ATGTTTCAGCTCAGACAGTGAGG - Intergenic
905345351 1:37307467-37307489 AAGCTTCAGCTCAGAGCAAGAGG - Intergenic
912339613 1:108899541-108899563 ATGCTTCAGGTAAGTGAATGGGG - Intronic
913305433 1:117425333-117425355 ATTTTTCAGCTCATTCTATGAGG + Intronic
913535103 1:119764430-119764452 GGGCTTCTGCTCAGTCCAAGAGG - Exonic
914049097 1:144116750-144116772 GTCCTTCAGCTGTGTCCATGTGG + Intergenic
914130087 1:144848695-144848717 GTCCTTCAGCTGTGTCCATGTGG - Intergenic
916797301 1:168179032-168179054 CTGCTTCAGCTTATTCCTTGTGG + Exonic
918776821 1:188642761-188642783 ATGCCACACCTCAGCCCATGTGG + Intergenic
919447750 1:197730372-197730394 ATTATTCAGCTCCATCCATGTGG + Intronic
919527422 1:198671275-198671297 ATGCTTTAGCTTGGTCCATTGGG - Intronic
920899923 1:210098477-210098499 GTGGGTCAGCTCAGACCATGTGG - Intronic
921744623 1:218725455-218725477 ATGCCTCAGCTGATTCTATGGGG - Intergenic
922877512 1:228951560-228951582 ATTCTTCAGTTCAGGCCATCTGG - Intergenic
1064881900 10:20064922-20064944 CTACTTTTGCTCAGTCCATGGGG + Intronic
1066580495 10:36875228-36875250 CTGCTTCAGCTCAGTCATTTGGG - Intergenic
1067473395 10:46551445-46551467 ATGCATCAGCTTTTTCCATGAGG + Intronic
1068857028 10:61808302-61808324 AAACTTCAGCTGACTCCATGGGG + Intergenic
1070288130 10:75098437-75098459 AGGCATTAGCTCATTCCATGCGG - Intronic
1072034890 10:91554629-91554651 ATTCTTCAACTCAGTACATATGG + Intergenic
1072394357 10:95023477-95023499 CTGCTTCAGCTCACTCTCTGTGG + Intergenic
1079089765 11:17472691-17472713 CTGCTTCAGCTCAGTGCAAAGGG - Intronic
1079179567 11:18177943-18177965 CTGCTTCAGCTGAGTGCTTGGGG - Intronic
1080846248 11:36029563-36029585 ATGCTTCAGTGCATTTCATGAGG - Intronic
1084469750 11:69352195-69352217 ATGTCTCAGCTCAGGCCATCAGG + Intronic
1084941794 11:72617032-72617054 ATGCTTCAGCCCAGCCCTTTGGG + Intronic
1086575566 11:88336096-88336118 ATGATTCAGCTGTGTCCATCTGG + Intronic
1086815901 11:91370376-91370398 ATGCTTCATGTCTGGCCATGTGG + Intergenic
1092639569 12:10489605-10489627 AAGCTTCAACTCATTCTATGAGG - Intergenic
1093275116 12:17116456-17116478 CTGCTTCAGCTCAGGCTCTGTGG - Intergenic
1093621152 12:21291059-21291081 ATGCTTAAGCTCAGTGTATCAGG + Intronic
1099739047 12:86607766-86607788 ATGCTCCTTCTCAATCCATGAGG + Intronic
1105012512 12:132765247-132765269 CAGCTTCCGCTCAGTCCCTGGGG - Intergenic
1105304235 13:19157951-19157973 GTACCTCAGCTCACTCCATGTGG + Intergenic
1105380155 13:19879766-19879788 ATCCTTCAGCCCAGTCAAAGTGG - Intergenic
1113721044 13:112556624-112556646 ATTCCTCTGCTCAGTACATGGGG - Intronic
1113797535 13:113067037-113067059 AGGCTGCAGCACAGCCCATGAGG + Intronic
1115426662 14:33268587-33268609 TTGCTTCATGTCACTCCATGAGG + Intronic
1118568828 14:67172501-67172523 CTGCTTCAGCTCAGGCCCTGGGG - Intronic
1123419037 15:20116321-20116343 GTCCTTCAGCTGTGTCCATGTGG + Intergenic
1123528258 15:21122864-21122886 GTCCTTCAGCTGTGTCCATGTGG + Intergenic
1126116563 15:45213151-45213173 AAGCCTCAGCTCTCTCCATGGGG - Intergenic
1129034510 15:72641317-72641339 AGGCTTCAGATCAGGGCATGTGG + Intergenic
1129215372 15:74095899-74095921 AGGCTTCAGATCAGGGCATGTGG - Intergenic
1129392255 15:75226308-75226330 AGGCTTCAGATCAGGGCATGTGG + Intergenic
1129732514 15:77940228-77940250 AGGCTTCAGATCAGGGCATGTGG - Intergenic
1130095218 15:80850709-80850731 AGGCTGTAGCTGAGTCCATGGGG - Intronic
1131935826 15:97503666-97503688 ATCCTTGAGATCAGACCATGTGG - Intergenic
1132806321 16:1776692-1776714 ACGTTTCAGCTCACGCCATGTGG + Exonic
1134426763 16:14156301-14156323 ATGCTTCCTCTCAGTACATATGG + Intronic
1135633604 16:24055492-24055514 CTGCTTCAGCTCAGAGAATGTGG + Intronic
1141827600 16:86492096-86492118 AAGCTCCAGCTCAGACCAAGAGG - Intergenic
1151343282 17:73485482-73485504 ATTCTTCAGCCCAGCCCATAAGG - Intronic
1151917648 17:77130255-77130277 ATGCTTCAGCTCAGTCCATGTGG + Intronic
1152143890 17:78555871-78555893 ATGGCCCAGCTCAGGCCATGAGG - Intronic
1203171828 17_GL000205v2_random:155454-155476 ATGCCTCATCTCAGCCTATGTGG + Intergenic
1203173905 17_GL000205v2_random:177303-177325 ATGCCTCATCTCAGCCTATGTGG - Intergenic
1155671566 18:28378024-28378046 AGGCTTCAGCCTATTCCATGGGG - Intergenic
1157019620 18:43764162-43764184 ATGTTTTAACTCATTCCATGAGG + Intergenic
1158758248 18:60352067-60352089 AATCTTCACCTCAGTCCATGTGG + Intergenic
1160492158 18:79347624-79347646 AAGCTTCAGCTCCGTCGATGGGG - Intronic
1165453985 19:35900346-35900368 ACGCTTCAGCTCCGTCCCTCAGG + Intronic
1167242116 19:48350465-48350487 ATGGTTAAGTTCAGACCATGAGG - Intronic
1202688548 1_KI270712v1_random:69644-69666 GTCCTTCAGCTGTGTCCATGTGG + Intergenic
925040036 2:725582-725604 AGGCTTGAGCTCAGATCATGTGG + Intergenic
925040055 2:725666-725688 AGGCTTGAGCTCAGATCATGTGG + Intergenic
925117684 2:1394373-1394395 GTGCTTCTGCTCAGTGCAGGCGG - Intronic
925756989 2:7142865-7142887 ATGCATGAGCTCAGTTTATGTGG + Intergenic
928886128 2:36150526-36150548 GTCCTCCAGCTCAATCCATGTGG - Intergenic
929545518 2:42853073-42853095 ATGCTCCAGCCCAGTCTACGAGG - Intergenic
930787868 2:55288662-55288684 GTGCTTCAGATCTGTCCATGTGG - Exonic
931952967 2:67385705-67385727 ATGCTACAGCACAGTCAAGGTGG - Intergenic
933599157 2:84312337-84312359 CCTCTGCAGCTCAGTCCATGGGG + Intergenic
933957881 2:87386443-87386465 GTCCTTCAGCTGTGTCCATGTGG - Intergenic
934241991 2:90278202-90278224 GTCCTTCAGCTGTGTCCATGTGG - Intergenic
934271181 2:91538486-91538508 GTCCTTCAGCTGTGTCCATGTGG + Intergenic
936995429 2:118409424-118409446 ATGCTTCAGCTCACCCTCTGTGG - Intergenic
937223825 2:120356960-120356982 ATGCCTCACCTCTGTCCCTGGGG - Intergenic
938581845 2:132653335-132653357 TTGCTCCAGCTCTGTCCATTGGG - Intronic
939655789 2:144822774-144822796 AATTTTCAGCTCATTCCATGAGG + Intergenic
944596950 2:201269522-201269544 TTGCTTCAGCCCAGCTCATGCGG - Intronic
946190991 2:218007884-218007906 ATGCATCAGCCCAGAGCATGGGG + Intergenic
946745147 2:222838103-222838125 ATGTTTGAGCTAAGTCCCTGAGG - Intergenic
948107789 2:235428971-235428993 CTGCTGGAGCTCCGTCCATGAGG - Intergenic
948456464 2:238106754-238106776 ATGCCTCAGCACAGTCCTAGGGG - Intronic
1168963950 20:1887553-1887575 AGGATGCAGCTCTGTCCATGAGG - Intergenic
1172200729 20:33124341-33124363 ATGCCTGAGCTCAGACCTTGGGG - Intergenic
1174321678 20:49746975-49746997 ATGCTTCGGCTCAGGCAATAAGG - Intergenic
1176327810 21:5517291-5517313 ATGCTTCATCTCAGCCTATGTGG + Intergenic
1176329897 21:5538949-5538971 ATGCCTCATCTCAGCCTATGTGG - Intergenic
1176397860 21:6282002-6282024 ATGCCTCATCTCAGCCTATGTGG + Intergenic
1176399947 21:6303660-6303682 ATGCTTCATCTCAGCCTATGTGG - Intergenic
1176437210 21:6685444-6685466 ATGCTTCATCTCAGCCTATGTGG + Intergenic
1176439297 21:6707102-6707124 ATGCCTCATCTCAGCCTATGTGG - Intergenic
1176461472 21:7012514-7012536 ATGCTTCATCTCAGCCTATGTGG + Intergenic
1176463559 21:7034171-7034193 ATGCCTCATCTCAGCCTATGTGG - Intergenic
1176485033 21:7394292-7394314 ATGCTTCATCTCAGCCTATGTGG + Intergenic
1176487120 21:7415950-7415972 ATGCCTCATCTCAGCCTATGTGG - Intergenic
1181403738 22:22667404-22667426 CTGCCTCAGCTCTGACCATGGGG + Intergenic
1182571695 22:31244000-31244022 CTGCTTCAACTCAGGACATGGGG + Intronic
1185141412 22:49103788-49103810 GTTCTGCTGCTCAGTCCATGAGG + Intergenic
949243598 3:1899751-1899773 ATGCTTCTTCTTAGTCCATGTGG + Intergenic
950444608 3:13029268-13029290 ATGCTTAGGCTCATCCCATGAGG + Intronic
951539150 3:23765812-23765834 ATAATTCAGCTCACTCCATGAGG - Intergenic
957522691 3:81340322-81340344 ATGCTTCAGATCAGTGTAAGTGG - Intergenic
959093160 3:101925339-101925361 CTGCTTCAGCTCACTCTCTGTGG + Intergenic
959933934 3:112010900-112010922 CTGCTGCAGCTCAGTCTCTGGGG - Intronic
960944721 3:122958210-122958232 CACCTCCAGCTCAGTCCATGAGG + Intronic
962496477 3:135945275-135945297 TTGCTTCAGCTCAGGCCTTGGGG + Intergenic
967273330 3:187748935-187748957 ATTCTTATGCCCAGTCCATGAGG - Intergenic
973028940 4:45310846-45310868 CTGCTTCAACTCAGTCCCTAAGG - Intergenic
975449271 4:74505466-74505488 CTGCTTCAGCTCACTCTTTGTGG - Intergenic
976092630 4:81473520-81473542 GTGCTTCAGCTCACTCCCCGTGG - Intronic
978409625 4:108412474-108412496 CTGCTTCAGCTCAGGCCTGGGGG - Intergenic
980792789 4:137640916-137640938 AAGATTCAGCTCAGACCATAGGG + Intergenic
981220098 4:142221892-142221914 ATGATTCAACTAAGTCAATGAGG + Intronic
982403702 4:154997575-154997597 ATAGTTCAGTCCAGTCCATGAGG + Intergenic
983760542 4:171400885-171400907 ATGCTTCAGATCAGTCTACAAGG + Intergenic
983840101 4:172447316-172447338 TTGATTCAGCTCAGTCTTTGAGG - Intronic
984701873 4:182823577-182823599 ATGCTGCAGCTCAGTGGGTGGGG - Intergenic
987152462 5:15056603-15056625 CTGCTTCAGCTCAGACCCAGAGG + Intergenic
987665978 5:20940393-20940415 ATGCTTGAGATCAATCCATAAGG + Intergenic
988756709 5:34261785-34261807 ATGCTTGAGATCAATCCATAAGG - Intergenic
990673879 5:58162166-58162188 ATGCTTCAGCTTGGTGCAGGGGG - Intergenic
996239274 5:121174566-121174588 ATCCTCCAGTTCTGTCCATGTGG + Intergenic
997771286 5:136556688-136556710 CGGCTTCAGCTCAGGCCCTGAGG + Intergenic
1000414563 5:160969985-160970007 AGGCTTCAGCAGATTCCATGAGG - Intergenic
1001145468 5:169180271-169180293 ATGCTTCAGTGCAGTGGATGTGG + Intronic
1002573079 5:180155086-180155108 CTCCTTCAGCTCAGTCCATCAGG - Intronic
1002656621 5:180753662-180753684 TGGCTTCAGCTCAGGCCCTGAGG - Intergenic
1003226002 6:4206234-4206256 ATTCTTCAGATCAGAGCATGGGG + Intergenic
1006924423 6:37646733-37646755 GTGCTTCTGCTCAGCCCAAGAGG - Intronic
1006964207 6:37965722-37965744 TTGCTTCACTTCAGTCCATAAGG - Intronic
1009273022 6:61639115-61639137 ATGCATCAGCTCATTTCATAAGG - Intergenic
1012006200 6:93716194-93716216 CTGCTTCAGCTTAGCCCCTGAGG + Intergenic
1013625760 6:111935259-111935281 CTGCTTCAGCTCAGCCTCTGTGG + Intergenic
1014257578 6:119178341-119178363 ATGTTTCAGCCTAATCCATGGGG + Exonic
1015692006 6:135935873-135935895 ATGTCTCAGCGCTGTCCATGTGG + Intronic
1021655195 7:22867715-22867737 TTGCTTCAACTCAGTGCCTGGGG + Intergenic
1024561890 7:50651788-50651810 ATTCTTCAACTCAAACCATGTGG + Intronic
1027883456 7:83872839-83872861 GTGCTTCAGCTGAGCCCAGGGGG - Intergenic
1029924385 7:104300198-104300220 AGACTTCAGCTCATCCCATGGGG + Intergenic
1030949773 7:115775530-115775552 AACCTTCAGGTCAGGCCATGAGG - Intergenic
1033225941 7:139562532-139562554 AGGCTGCAGCTCAGTACACGTGG + Exonic
1034360813 7:150496378-150496400 CTGCTTCAGCTCATTCTCTGTGG - Intergenic
1035564192 8:630345-630367 GTGAGTCAGCTCTGTCCATGTGG - Intronic
1035564293 8:630964-630986 GTGAGTCAGCTCTGTCCATGTGG - Intronic
1035564307 8:631049-631071 ATGAGTCAGCTCTGTCAATGTGG - Intronic
1037965177 8:23128387-23128409 CTGCATCAGCTCTGGCCATGAGG - Intergenic
1038272611 8:26087770-26087792 ATGACACAGCTCAGTCCATAAGG + Intergenic
1040985870 8:53293984-53294006 ATGCTTCTCCTCAGACCATTGGG + Intergenic
1042211128 8:66381560-66381582 AAGCTTCAGGTCACTCCGTGGGG - Intergenic
1042637490 8:70894547-70894569 TTGCTTCTGCTCAGGCCTTGTGG + Intergenic
1044440884 8:92222034-92222056 CTGCTTCAGCTCATGCCTTGTGG + Intergenic
1045015352 8:97996677-97996699 ATGCTTGCACTCAGTCCATTAGG + Intronic
1046056353 8:109083466-109083488 ATGATTCAGCTTTGGCCATGAGG - Intergenic
1046607869 8:116390868-116390890 TTGCTTCAGCTCACTCTCTGTGG - Intergenic
1049317354 8:141976400-141976422 ATGCCTCAGCTCCATCCGTGAGG - Intergenic
1049662152 8:143824296-143824318 ATGCTTAAGGTCAGTACCTGTGG + Exonic
1050137598 9:2483462-2483484 ATTCTTTAGCTCAGTCCAGTAGG + Intergenic
1053060716 9:35029093-35029115 ATGGCTTTGCTCAGTCCATGTGG - Intergenic
1054986070 9:71262817-71262839 CTGCTTCAGCTCACTCTCTGTGG + Intronic
1060885596 9:127149895-127149917 ATGGCTCAGGTCAGCCCATGTGG + Intronic
1062174291 9:135152438-135152460 ATGTGTCAGCTCAGAGCATGTGG - Intergenic
1203432198 Un_GL000195v1:101377-101399 ATGCCTCATCTCAGCCTATGTGG + Intergenic
1203434297 Un_GL000195v1:123167-123189 ATGCCTCATCTCAGCCTATGTGG - Intergenic
1185855856 X:3534391-3534413 ATGCTCATGCTCAGTCCCTGGGG + Intergenic
1190553838 X:51614027-51614049 ATCCTTGATCTCAGTCCTTGTGG - Intergenic
1191654691 X:63584124-63584146 AGGCTGCAGCTCAATACATGTGG + Intergenic
1191730490 X:64329521-64329543 ATACTTTAGTTCAGACCATGGGG + Intronic
1193693707 X:84680612-84680634 CTGCTTCAGTTCAGGCCCTGGGG + Intergenic
1198232985 X:134710663-134710685 GTTCTTGAGATCAGTCCATGTGG - Intronic
1198338744 X:135693250-135693272 ATGCATCATCTCAGTGCCTGAGG + Intergenic
1199989536 X:152978336-152978358 ACGCTGCTGCTCAGTCAATGAGG - Intergenic
1202174649 Y:22086138-22086160 CTGCTTCAGCTCATTCACTGTGG - Intronic
1202216713 Y:22500244-22500266 CTGCTTCAGCTCATTCACTGTGG + Intronic
1202326474 Y:23695824-23695846 CTGCTTCAGCTCATTCACTGTGG - Intergenic
1202544296 Y:25974229-25974251 CTGCTTCAGCTCATTCACTGTGG + Intergenic