ID: 1151917868

View in Genome Browser
Species Human (GRCh38)
Location 17:77132010-77132032
Sequence CTGTGTTAGCTCAAGGCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 273}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151917859_1151917868 20 Left 1151917859 17:77131967-77131989 CCAGCTTCTTGGCCCGAAGTTTT 0: 1
1: 1
2: 0
3: 6
4: 100
Right 1151917868 17:77132010-77132032 CTGTGTTAGCTCAAGGCCACTGG 0: 1
1: 0
2: 2
3: 37
4: 273
1151917866_1151917868 -4 Left 1151917866 17:77131991-77132013 CCAGGTCGGGAATGATGCACTGT 0: 1
1: 0
2: 0
3: 1
4: 34
Right 1151917868 17:77132010-77132032 CTGTGTTAGCTCAAGGCCACTGG 0: 1
1: 0
2: 2
3: 37
4: 273
1151917864_1151917868 7 Left 1151917864 17:77131980-77132002 CCGAAGTTTTCCCAGGTCGGGAA 0: 1
1: 0
2: 0
3: 6
4: 95
Right 1151917868 17:77132010-77132032 CTGTGTTAGCTCAAGGCCACTGG 0: 1
1: 0
2: 2
3: 37
4: 273
1151917865_1151917868 -3 Left 1151917865 17:77131990-77132012 CCCAGGTCGGGAATGATGCACTG 0: 1
1: 0
2: 0
3: 6
4: 59
Right 1151917868 17:77132010-77132032 CTGTGTTAGCTCAAGGCCACTGG 0: 1
1: 0
2: 2
3: 37
4: 273
1151917863_1151917868 8 Left 1151917863 17:77131979-77132001 CCCGAAGTTTTCCCAGGTCGGGA 0: 1
1: 0
2: 0
3: 7
4: 75
Right 1151917868 17:77132010-77132032 CTGTGTTAGCTCAAGGCCACTGG 0: 1
1: 0
2: 2
3: 37
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151917868 Original CRISPR CTGTGTTAGCTCAAGGCCAC TGG Intronic
901030005 1:6301561-6301583 CTGTGTTGGGTCAGGGACACAGG - Intronic
901245457 1:7726864-7726886 CAGAGGTGGCTCAAGGCCACAGG - Intronic
902143854 1:14379859-14379881 CTGTGTTTGCTCAAGGCCCTGGG - Intergenic
902733807 1:18386859-18386881 CTGTGCAAGCCCAAGGCCTCTGG - Intergenic
904666776 1:32128520-32128542 GTGGTTTAGCTAAAGGCCACTGG - Intronic
905026209 1:34851644-34851666 CTGTGTTAGCACAAGTCGGCTGG - Intronic
906390802 1:45414130-45414152 CTTTGTTTGCTCTAGGCCACTGG + Intronic
906909009 1:49926012-49926034 CTATGTTTGCTCAAGGCCTGGGG - Intronic
909084413 1:71154668-71154690 CTATGTTTACTCAAGGTCACAGG + Intergenic
909667621 1:78153557-78153579 CTATGTTTGCTCAAGGCCAGGGG + Intergenic
910379186 1:86608301-86608323 CTGTGTTTGCTCAAGGCCCTGGG + Intergenic
910733220 1:90421395-90421417 CTGTGTTTGCTCAAAGCCCTAGG - Intergenic
911019953 1:93375937-93375959 CTATGTTTGCTCAAGGCCCTAGG - Intergenic
911487248 1:98516893-98516915 CTGTATTCGCTCAAGGCCCTGGG - Intergenic
911811276 1:102284930-102284952 CTGTGTTTACTCAAGGCCCTAGG - Intergenic
912036511 1:105323986-105324008 CTATGTTTTCTCAAGGCCATGGG + Intergenic
912701109 1:111878795-111878817 CTTGGCTAGGTCAAGGCCACAGG + Intronic
913416777 1:118618089-118618111 CTATGTTTGCTCAAGGCTATGGG + Intergenic
915104775 1:153527012-153527034 CAGTGTTACCTGAAGGCCAGAGG + Intergenic
918476157 1:184927663-184927685 CTATGTTTGCTCAAGGCCTTAGG + Intronic
918487334 1:185044063-185044085 CTTTGGGAGCCCAAGGCCACCGG - Intergenic
919369789 1:196708702-196708724 CTCTGTTAGGGCAAGCCCACTGG + Intronic
920549686 1:206847746-206847768 CTGTGTTTGCTCAAGGCCCTGGG - Intergenic
922358009 1:224795188-224795210 CTATGTTTGCTCAAGGCCCTAGG + Intergenic
922616384 1:226963442-226963464 CTGTGGAAGCCCAAGGCCAGTGG - Intronic
1064696711 10:17974772-17974794 CTATGTTTGCTCAAGGCCTTGGG + Intronic
1064830346 10:19457695-19457717 CTGGGTTGGTCCAAGGCCACAGG + Intronic
1065381431 10:25095527-25095549 TTGTGTTTGCTCAAGGCCCTGGG + Intergenic
1069934329 10:71904949-71904971 CTGTGTTACCTCAGGGGCAAAGG + Intergenic
1070915127 10:80148585-80148607 CTGTGTCTGCTCAAGGCCCTGGG - Intergenic
1071018151 10:81021859-81021881 CTATGTTTGCTCAAGGCCTTGGG - Intergenic
1072058881 10:91788661-91788683 CTATGTTTGCTCAAGGCCCTAGG - Intergenic
1072083693 10:92057585-92057607 CTGTGTTCGCTCAGGGCCCTGGG - Intronic
1072250163 10:93575614-93575636 CTGTGTAAGCTGAAGGACACAGG - Intronic
1073499797 10:103926155-103926177 CTGTGTCAGCAGAAGGCCCCAGG + Intergenic
1073905408 10:108274240-108274262 CTATGTTAGCTCAAGGCCCTGGG + Intergenic
1074226818 10:111493230-111493252 CTATGTTTGCTCAAGGCCCTGGG + Intergenic
1074408562 10:113202282-113202304 CTGTGTTCACTCAAGGCCTTAGG - Intergenic
1076479519 10:130775678-130775700 GTGTGTTCACTCAGGGCCACAGG - Intergenic
1077858954 11:6158110-6158132 CTGTGTTTGCTCAAGGCCTTAGG - Intergenic
1079625914 11:22617793-22617815 CTGTGTTTGCTCAATGCCCTGGG + Intergenic
1084671206 11:70607592-70607614 CTCTGTTTGCTGACGGCCACAGG - Intronic
1085147416 11:74213469-74213491 CTGTGTTCACTCAAGGCCCTAGG - Intronic
1086068851 11:82776492-82776514 CTATGTTTGCTCAAGGCCCTGGG - Intergenic
1086420132 11:86630657-86630679 GTGTGTTGTCTCCAGGCCACAGG - Intronic
1087178549 11:95119674-95119696 CTATGTTTGCTCAAGGACATTGG + Intronic
1087598300 11:100282594-100282616 CTATGTTTGCTCAAGGCCCTGGG + Intronic
1088570023 11:111213715-111213737 CTATGTTTGCTCAAGGCCCTGGG - Intergenic
1089750531 11:120648236-120648258 CTGTGACATCTCTAGGCCACTGG + Intronic
1090306264 11:125693720-125693742 CTGTCTCAGCCCAGGGCCACAGG - Intergenic
1090666949 11:128920682-128920704 ATGAGCTTGCTCAAGGCCACGGG + Exonic
1091194520 11:133719914-133719936 CTGTGATGGCTCTAGGCCCCAGG - Intergenic
1093608022 12:21118187-21118209 CTGTGTTTTCTCAAGGCCCTTGG + Intronic
1093617300 12:21241652-21241674 CAATGTTTGCTCAAGGCCATGGG - Intergenic
1094658105 12:32440680-32440702 CTATGTTCGCTCAAGGCCCTGGG + Intronic
1095154479 12:38835192-38835214 CTTTCTTGACTCAAGGCCACTGG + Intronic
1096879810 12:54658472-54658494 CCGTGTCAGCCCAAGGGCACTGG - Intergenic
1097146925 12:56948127-56948149 CTATGTTTGCTCAAGCCCAAGGG + Intergenic
1097150809 12:56978627-56978649 CTGTGTTTGCTCAAGGCCCTAGG + Intergenic
1097425957 12:59445423-59445445 CTATGTTAGCTCATGGCCCTAGG + Intergenic
1099433867 12:82620196-82620218 CTGTGTTTGTTCAAGGCCTGGGG - Intergenic
1101162534 12:101993860-101993882 CTTTGTTGGCTCAAGGCCCTGGG + Intronic
1102203466 12:111074541-111074563 CTGTCCAAGCTGAAGGCCACAGG - Intronic
1102953026 12:117042549-117042571 CCGTGATAACTCAGGGCCACTGG + Intronic
1103744876 12:123115737-123115759 CTGTATCAGCTCCAGGCAACTGG - Intronic
1104535498 12:129614335-129614357 CTCAGTGAGCTCAAGGCCAGAGG + Intronic
1105424592 13:20283663-20283685 CTGTGTTATCCAAAGGCCCCTGG + Intergenic
1105558943 13:21472787-21472809 CTATGTTTGCTCAAGGCCCTGGG + Intergenic
1106105291 13:26727820-26727842 CTGTGTTAGTTCAAGGTGAAGGG + Intergenic
1106645425 13:31629308-31629330 CTATGTTCACTCAAGGCCCCGGG + Intergenic
1106896080 13:34303352-34303374 CTGTGTTTGCTCAAGGCTCTGGG - Intergenic
1107180296 13:37450587-37450609 CTGTGTTACCTCAAGGTTAGTGG - Intergenic
1107418809 13:40226240-40226262 CTGTGTTGTCTGAAGACCACTGG + Intergenic
1115381529 14:32745678-32745700 CTGTGTTTACTCAAGGCCCTGGG + Intronic
1115620243 14:35133989-35134011 CTGTGTTCACTCAAGGCCCTGGG + Intronic
1116057965 14:39886508-39886530 CTATGTTAACTCAAGGCCCTGGG - Intergenic
1116106528 14:40514536-40514558 CTATGTTTGCTCAAGGCCCAAGG - Intergenic
1116192675 14:41680250-41680272 CTATGTTTGTTCAAGGCCATAGG - Intronic
1116669358 14:47821412-47821434 TTATGTTTGCTCAAGGCCATAGG + Intergenic
1117161347 14:52993698-52993720 CTGTGTTCACTCAAGGCCAAGGG + Intergenic
1117606294 14:57431869-57431891 CTATGTTTGCTCAAGGCCCTAGG - Intergenic
1118002612 14:61537668-61537690 CTGTGTGAGCTCAAAGACAAGGG - Intronic
1118372930 14:65153110-65153132 TTGTGATAGCTTAAGGCGACAGG + Intergenic
1119773312 14:77234838-77234860 CTGTGTTACCTGCAGGCCTCGGG - Intronic
1120808240 14:88775744-88775766 CTATGTTTGCTCAAGGCCCTGGG - Intronic
1121088496 14:91164850-91164872 CTATGTTTGCTCAAGGCCATGGG + Intronic
1122032766 14:98925695-98925717 ACCAGTTAGCTCAAGGCCACAGG - Intergenic
1126250703 15:46565180-46565202 CTGTGTTTGCTCAAGGTCCCAGG + Intergenic
1126294900 15:47129261-47129283 CTATGTTTGCTCAAGGCCTTGGG + Intergenic
1126503798 15:49379899-49379921 CTATGTTTGCTCAAGGCCCCAGG + Intronic
1127035277 15:54908937-54908959 CTGTGTTTTCTCAAGGCCCTGGG - Intergenic
1127045025 15:55016687-55016709 CTGTCTAACCTCAAGCCCACAGG + Intergenic
1127132649 15:55883214-55883236 CAGTGTTCACTCAAGGCCCCAGG - Intronic
1127971418 15:63965465-63965487 CTATGTTTGCTCAAGGCCCTAGG + Intronic
1128562257 15:68676707-68676729 CTGAGTCAGGTCAAGGCCTCTGG - Intronic
1128770257 15:70276696-70276718 ATGTGCTCGCTCAAGGTCACAGG + Intergenic
1129067399 15:72917087-72917109 CTGTGGTTGCTCTAGGCCCCAGG - Intergenic
1130046227 15:80447205-80447227 CTGTGTTAGGTCCAGGACAGTGG + Intronic
1131323428 15:91420299-91420321 CTATGTTTGCTCAAGGCCCTAGG + Intergenic
1131385838 15:92006406-92006428 CTGAGTTAGTTCAAGAGCACAGG + Intronic
1131539801 15:93266556-93266578 CTGTGTTAGCCACAGGCAACAGG - Intergenic
1131539809 15:93266604-93266626 CTGTGTTAGCCACAGGCAACAGG - Intergenic
1133116418 16:3580270-3580292 CAGTGTGAGCCCAAGGCCAGGGG - Intergenic
1135941677 16:26827500-26827522 CTGTGTTAGCTCCAGGCTCCAGG + Intergenic
1136133160 16:28237400-28237422 CTGTGTAAGCTGAAAGCCAGGGG + Intergenic
1138563341 16:57815344-57815366 TTCTGTTAGCTCAAGGCCACAGG + Intronic
1142919293 17:3170307-3170329 CGGTGTTCGCTTAAGGCCCCAGG - Intergenic
1142919661 17:3173024-3173046 TTGTGTTTGCTCAAGGCCCTAGG - Intergenic
1145841697 17:28000512-28000534 CTGTGGGAGCTCAGAGCCACAGG - Intergenic
1149231362 17:54537593-54537615 CTATGCTTGCTCAAGGCCCCAGG - Intergenic
1151850275 17:76685805-76685827 CTGTGTCCACTCCAGGCCACAGG - Intronic
1151917868 17:77132010-77132032 CTGTGTTAGCTCAAGGCCACTGG + Intronic
1153453924 18:5259946-5259968 CTGTGTTCACTCCAGGCCACTGG - Intergenic
1154181923 18:12145640-12145662 CTGTGTTAGCTGGAGACCACTGG - Intergenic
1154386673 18:13898509-13898531 CTGTGTTCACTCAAGGCCCTGGG - Intronic
1155354518 18:24938352-24938374 CTCTTTTACCTCAAGGCCACTGG - Intergenic
1156055679 18:32999472-32999494 CTATGTTTGCTCAAAGCCATAGG - Intronic
1156523712 18:37746377-37746399 CTGTGTGTGCTCTAGCCCACTGG - Intergenic
1156977170 18:43237357-43237379 CTATGTTCACTCAAGGCCATAGG + Intergenic
1159471051 18:68856631-68856653 CTGTATTAGCTGAAGGACTCAGG + Intronic
1159565044 18:70038247-70038269 CTGTGTTCACTCAAGGCCCTAGG - Intronic
1161163873 19:2775173-2775195 AGGTGTTCACTCAAGGCCACTGG + Intronic
1162666683 19:12219713-12219735 CTGTGTTCACTGAAGGCCCCTGG + Intergenic
1163185389 19:15635611-15635633 CTGTGTTGACTCAAGGCCCAAGG + Intronic
1164292841 19:23882691-23882713 CTGTGTTTGCTCAAGGCTTTTGG - Intergenic
1165983558 19:39747299-39747321 CTATGTTTGCTCAAGGCCCTGGG - Intergenic
1166041519 19:40205712-40205734 CTGTGTTAGCTCAAAGAAAGGGG - Intronic
1168166208 19:54549703-54549725 CTGTCTTCGCTCAGGGCCCCAGG + Intergenic
1168376446 19:55883907-55883929 GTGAGTGTGCTCAAGGCCACAGG + Intergenic
926905893 2:17805412-17805434 CTTTGCTAACTCAAGGACACAGG + Intergenic
928472312 2:31586390-31586412 CTATGTTTGCTCAAGGCCTTGGG - Intergenic
930159311 2:48138013-48138035 CTGTGTTTGCTCAAGGCCCTGGG - Intergenic
930492413 2:52092712-52092734 CTGTGTTTGCTCAAGGCCCTGGG + Intergenic
930527599 2:52549162-52549184 CTGTGTTTGCTCAAGGGCCTAGG - Intergenic
934677586 2:96260594-96260616 CTGACTTTGCTCAAGGTCACTGG + Intronic
935078521 2:99769998-99770020 CTGTATTTGCTCAAGGCCCTAGG + Intronic
939244723 2:139609356-139609378 CTGTGTTCGCTCAAGGCCTGTGG + Intergenic
939257148 2:139759224-139759246 CTATGTTTGCTCAAGGCCCTAGG + Intergenic
939800514 2:146701063-146701085 CTGTGTTTGTTCAAGGCTATGGG - Intergenic
940545148 2:155073409-155073431 CTGTGTTGGCCAAAGGCCAAAGG + Intergenic
940795483 2:158072464-158072486 CTGTGTTCACTCAAGGCCCTAGG - Intronic
941357641 2:164512601-164512623 CTATGTTTGCTCAAGGCCCTGGG - Intronic
942472304 2:176273510-176273532 CAGTGTTAGCTCATGTCCACAGG - Intronic
942862883 2:180636679-180636701 CTATGTTAACTCAAGGCCCTAGG - Intergenic
943226703 2:185187543-185187565 CTATGTTTGCTCAAGGCCCTGGG + Intergenic
943309798 2:186311243-186311265 CTGTGTTCTCTCAAGGCCCTGGG - Intergenic
944078731 2:195760408-195760430 CTATGTTTGCTCAAGGCCCTGGG - Intronic
946807340 2:223484374-223484396 CTGTGTTTGTTCCAGGCCATGGG + Intergenic
948475405 2:238215868-238215890 CTGTGTTCACTCAAGGCCCTAGG + Intergenic
1169628714 20:7600894-7600916 CTATGTTCCCTGAAGGCCACAGG - Intergenic
1170437802 20:16348788-16348810 CTGTGTTAAATACAGGCCACAGG + Intronic
1171487468 20:25494884-25494906 CTGGGTCAGCCGAAGGCCACTGG - Intronic
1172434554 20:34919854-34919876 TTCTGTTAACTCAAGGCCAAGGG + Intronic
1173126831 20:40345088-40345110 CTATGTTCACTCAAGGCCATAGG - Intergenic
1173204126 20:40979447-40979469 CTATGTTTGCTCAAGGCCCTAGG + Intergenic
1175667204 20:60870844-60870866 CTGTGGAACCTCCAGGCCACTGG - Intergenic
1176073576 20:63238660-63238682 CTGTGCTTGGCCAAGGCCACTGG + Intronic
1176995039 21:15544868-15544890 CTATGTTCGCTCAAGGCCCTAGG - Intergenic
1177222154 21:18209030-18209052 CTATGTTTGCTCAAGGCCCTAGG + Intronic
1179367030 21:40768257-40768279 CTGTCTTGGCTCAGAGCCACTGG - Intronic
1179652591 21:42821246-42821268 CTATGTTTACTCAAGGCCATAGG - Intergenic
1181717020 22:24738383-24738405 CTATGTTGGCTCAAGGCCCTAGG - Intronic
1183149046 22:36022982-36023004 CTGTGGCAGCCCAAGGACACTGG + Intronic
1183321532 22:37167767-37167789 CTGCGGTGCCTCAAGGCCACAGG + Intronic
949887238 3:8705803-8705825 CTGTCTGAGCTCCAGGCCACAGG - Intronic
950189418 3:10966367-10966389 CTGTGGTAGCTCCATGCCTCAGG - Intergenic
950720699 3:14880650-14880672 GTTTATAAGCTCAAGGCCACAGG - Intronic
952197919 3:31095500-31095522 CTGTGTTAGCTCAAGCGCCTGGG - Intergenic
952222052 3:31332735-31332757 CTATGTTCGCTCAAGGCCCTGGG - Intergenic
953922132 3:46959609-46959631 CTGTGGTAGCTCGAGGGCAAGGG - Intronic
954913386 3:54128239-54128261 CTGTGTCAGCTCAGGCCCAATGG - Intronic
957925531 3:86805651-86805673 CTGTATTTGCTCAAGGCCTTAGG - Intergenic
959279333 3:104317537-104317559 CTATGTTTTCTCAAGGCCATGGG - Intergenic
959547351 3:107612754-107612776 CTATGTTTGCTCAAGGCCCTAGG + Intronic
959717116 3:109444794-109444816 CTATGTTTGCTCAAGGCCCTAGG - Intergenic
959761866 3:109976024-109976046 CTGTGTTCACTCAAGGCCCTGGG + Intergenic
960051203 3:113241088-113241110 CTGTGACTTCTCAAGGCCACTGG + Intronic
961871866 3:129994147-129994169 CTCTGTTAGCTAGAGGCCCCTGG - Intergenic
963365128 3:144324220-144324242 CTTTGTTTGCTCAAGGCCCTGGG - Intergenic
963996025 3:151709554-151709576 CTATGTTCGCTCAAGGCCCTAGG - Intergenic
964059504 3:152504863-152504885 CTATGTTTGCTCAAGGCCCTTGG + Intergenic
965016670 3:163167537-163167559 CTATGTTTGCTCAAGGCCCTGGG + Intergenic
965026261 3:163304632-163304654 CTGTGTTCACTCAAGGTCCCGGG - Intergenic
966401030 3:179546959-179546981 CCCTGTTTGCTCAAGGCCCCAGG - Intergenic
966452150 3:180074555-180074577 CTGTGTTTGCTCAAGGCCCTGGG - Intergenic
968505427 4:969037-969059 CTGTGCTAGCTGGAGGCCCCAGG + Intronic
971838484 4:31800898-31800920 GTATGTTTGCTCAAGGCCCCAGG + Intergenic
972104067 4:35461132-35461154 CTATGTTGGCTCAAGGCCCTGGG + Intergenic
972739752 4:41878561-41878583 CTCTCTGAGCTCAGGGCCACTGG - Intergenic
974301099 4:60067900-60067922 CTATGTTTGCTCAAGGCCGTAGG - Intergenic
974305003 4:60124989-60125011 TTATGCTAGCTCAGGGCCACAGG + Intergenic
976943695 4:90738643-90738665 CTGTGTTCACTCAAGACCAAAGG + Intronic
977985707 4:103380241-103380263 ATGTGTTAACTCAAGGCCCAAGG - Intergenic
978287898 4:107099598-107099620 CTATGTTTGCTCAAGGCCCTGGG - Intronic
979413554 4:120407413-120407435 CTATGTTCACTCAAGGCCATAGG - Intergenic
979851148 4:125572907-125572929 CTATGTTTGCTCAAGGCCCCAGG + Intergenic
982339926 4:154285856-154285878 CTATGTTCACTCAAGGCCCCAGG - Intronic
982932780 4:161429349-161429371 CTATGTTTGCTCAAGGCCCTTGG - Intronic
983118645 4:163851823-163851845 CTTTGTAAGCACATGGCCACAGG - Intronic
983931871 4:173461206-173461228 CTATGTTTGCTCAAGGCCCTGGG - Intergenic
984146240 4:176065238-176065260 GTGTGTTGGATAAAGGCCACAGG + Intergenic
985132054 4:186748562-186748584 CTGTGTTAGTTTAAGGACAATGG + Intergenic
985275151 4:188231095-188231117 CTGGGCTAGCTCCAGGCCCCAGG + Intergenic
986941440 5:12954627-12954649 CTATGTTGGCTCAAGGCCTTGGG - Intergenic
988048924 5:25998456-25998478 CTGAGGTAACTCAAGTCCACTGG + Intergenic
990214141 5:53512729-53512751 CTATGTTAGCTCAAGACCTTAGG + Intergenic
990579668 5:57156010-57156032 CCGTGTTCGCTCAAGACCCCAGG - Intergenic
991297255 5:65094098-65094120 CTATGTTTGCTCAAGGCCCTGGG - Intergenic
991682034 5:69149572-69149594 CTATGTTTGCTCAAGGCCCGAGG + Intergenic
994235527 5:97358113-97358135 CTATGTTTGCTCAAGGCCCTGGG + Intergenic
994530052 5:100957332-100957354 CTGTGTTCCCTCAAGGCCCTGGG - Intergenic
996133311 5:119808948-119808970 CTGTGTTCGCTTAAGGCCCTGGG + Intergenic
996961427 5:129255106-129255128 CTATGTTTGCTCAAGGCCTTGGG + Intergenic
997390482 5:133511085-133511107 CTGAGTTCCATCAAGGCCACAGG + Intronic
997649382 5:135504372-135504394 CTGGGTGAGGTTAAGGCCACAGG + Intergenic
1001975330 5:175994072-175994094 GTGTGACTGCTCAAGGCCACTGG - Intronic
1002242103 5:177849698-177849720 GTGTGACTGCTCAAGGCCACTGG + Intergenic
1002334803 5:178470331-178470353 CTGTGCTTGCCCAAGGACACTGG - Intronic
1003302415 6:4896164-4896186 CTGATTTAGATCAAGGCCGCAGG - Intronic
1004921932 6:20383994-20384016 CTGTGTCATCTGTAGGCCACTGG + Intergenic
1006395088 6:33782051-33782073 CTGTGTTAGGGGAAGGCGACAGG - Intronic
1008727498 6:54440767-54440789 CTATGTTTGCTCAAGGCCATGGG + Intergenic
1009349316 6:62653976-62653998 CAGTGTTACCTGAAGGCCACTGG - Intergenic
1010328154 6:74588561-74588583 CTATGTTAGCTCAAGTCCCTGGG - Intergenic
1010393928 6:75369060-75369082 CTGTGTTAGCTCAAGGTTCTTGG + Intronic
1010795549 6:80113285-80113307 CAGTGTTACCTGAAGGCCAAGGG - Intronic
1011024016 6:82846100-82846122 CTATGATAGCTCAAGGCCCTAGG - Intergenic
1011033291 6:82945098-82945120 CTATGTTTGCTCAAGGCCCTAGG - Intronic
1012290533 6:97450369-97450391 CTGTGTCAGCTCCAGGGCCCAGG - Intergenic
1013294424 6:108746163-108746185 CTGTTTTAGCACAAGGCTTCTGG - Intergenic
1013567608 6:111383067-111383089 TTGTGTTTACTCAAGGCCAAAGG - Intronic
1014542339 6:122692202-122692224 CTATGTTTGCTCAAGGCCCTAGG + Intronic
1016033002 6:139357050-139357072 CTGGGTTGGTTCAAGGCCACTGG + Intergenic
1019304362 7:325845-325867 CTGTGTGAGCACACGGCCAGGGG - Intergenic
1021842764 7:24733916-24733938 CTATGTTTGCTCAAGGCCCTAGG - Intronic
1022080296 7:27013182-27013204 CTGTGTTTGCTCAAGGCCCTGGG - Intergenic
1023716343 7:43047601-43047623 CTATGTTTGCTCAAGGCCCTAGG - Intergenic
1024498410 7:50072488-50072510 CTGTGTTTGCTCAAGGCCCTGGG - Intronic
1027524160 7:79245767-79245789 CTGTGTTTGCTCAAGGGCATAGG - Intronic
1027604971 7:80288608-80288630 CTATGTTTACTCAAGGCCACAGG - Intergenic
1029041165 7:97576340-97576362 CTGTGTTAGATAAACTCCACAGG + Intergenic
1029606579 7:101602768-101602790 CTGTGTGACCTCAAGGCTAGTGG - Intergenic
1031546084 7:123053016-123053038 CTATGTTCACTCAAGGCCCCAGG + Intergenic
1033583226 7:142755130-142755152 CTGTGTGAGAGCCAGGCCACGGG + Intronic
1034230965 7:149528179-149528201 CAGTGTTACCTGAAGGCCCCTGG + Intergenic
1035139182 7:156739430-156739452 CTGTGTTCTCTCAAGGCCCTAGG - Intronic
1038922138 8:32096588-32096610 CTGTATTTGGTGAAGGCCACAGG + Intronic
1039244680 8:35595853-35595875 CTGTGTTTGCACAAGGCCCTTGG + Intronic
1044635400 8:94319260-94319282 CTATGTTTGCTCAAGGCCCTAGG + Intergenic
1045041219 8:98226774-98226796 CTATGTTCGCTCAAGGCCCTAGG + Intronic
1045159563 8:99523350-99523372 CTGTGTTCACTCAAGGCCCTAGG - Intronic
1045294521 8:100861799-100861821 CAGCTTTAGCTCAATGCCACAGG + Intergenic
1045777364 8:105821670-105821692 CTGTGTTTTCTCAAGGCCCTGGG + Intergenic
1046557383 8:115791228-115791250 CTATGTTAGTTCAAGGCCTTAGG - Intronic
1047758924 8:127939689-127939711 CTCTGTTAGCACATGGCCTCAGG - Intergenic
1050722061 9:8601372-8601394 CTATGTTTGCTCAAGGCCATAGG - Intronic
1050926569 9:11270326-11270348 CAGTGTTACCTGAAGGCCCCTGG - Intergenic
1051306813 9:15718461-15718483 CTATGTTTGCTCAAGGCCCTAGG - Intronic
1051465150 9:17368482-17368504 CTATGTTTGCTCAAGGCCCTAGG - Intronic
1051923702 9:22298508-22298530 CTGTGTTCGCTCAAGGCCCCAGG + Intergenic
1052214550 9:25950722-25950744 CTACGTTTGCTCAAGGCCATGGG + Intergenic
1053040151 9:34863261-34863283 CTATGTTTGCTCAAGGCCCTAGG - Intergenic
1054956288 9:70914584-70914606 CTATGTTTGCTCAAGGACACTGG - Intronic
1055827050 9:80339498-80339520 CAGTGTTAACTCAAGGCCCAAGG - Intergenic
1056151469 9:83794216-83794238 CTGTGATATCTTCAGGCCACTGG - Intronic
1057421759 9:94918461-94918483 CTGTGCCAGCTCAAGCCCATGGG - Intronic
1058614224 9:106808573-106808595 ATGTGTAAGCTCAAGACCATGGG + Intergenic
1058703369 9:107619389-107619411 ATGTGTTACCTTAAGGCCCCTGG - Intergenic
1059555371 9:115275718-115275740 GTGTATTAGCTCAAGGCCCTAGG + Intronic
1061928300 9:133818521-133818543 ATGTGTCAGCCCAAGGCCAAAGG - Intronic
1062713138 9:137987578-137987600 CTGTGTTTGCTGCAGGCCAGGGG + Intronic
1186691877 X:11986029-11986051 CTATGTTTGCTCAAGGCCCTAGG - Intergenic
1187526401 X:20059008-20059030 CAATGTTAGCTCAAGGTCACAGG - Intronic
1188040464 X:25365908-25365930 CTATGTTTGCTCAAGGCCCTGGG + Intergenic
1188210715 X:27419933-27419955 CTGTGTTCACTCAAGGCCCTGGG - Intergenic
1189019686 X:37320974-37320996 CTATGTTTGCTCAAGGCCCTGGG - Intergenic
1190907802 X:54745885-54745907 CTATGTTTGCTCAAGGCCCTGGG + Intergenic
1192045918 X:67674350-67674372 CTGTGTTTGCTCAAAGCCTAAGG + Intronic
1192262198 X:69512097-69512119 CAGTGTTAGCTGAAAGCCAGGGG + Intronic
1193098414 X:77579277-77579299 CTATGTTTGCTCAAGGCCCAAGG - Intronic
1193252632 X:79309680-79309702 CTATGTTTGCTCAAGGCCTTGGG - Intergenic
1194065365 X:89253894-89253916 CTATGTTTGCTCAAGGCACCAGG - Intergenic
1194136688 X:90152323-90152345 CTATGTTTGCTCAAGGCCTTGGG - Intergenic
1194288446 X:92039224-92039246 CTATGTTAACTCAAGGCCCTAGG + Intronic
1194379477 X:93176077-93176099 CTGTGTTATCCAAAGGCCCCAGG + Intergenic
1194500801 X:94678875-94678897 CTATGTTTGCTCAAGGCCCTAGG + Intergenic
1194591606 X:95806004-95806026 CTATATTTGCTCAAGGCCATAGG - Intergenic
1194692826 X:97008935-97008957 CTGTGTTTGCTCAAGGCCCTAGG + Intronic
1195172179 X:102280705-102280727 CTTTGTTTGCTCAAGGCCCTGGG + Intergenic
1195186681 X:102406388-102406410 CTTTGTTTGCTCAAGGCCCTGGG - Intronic
1195543246 X:106087106-106087128 CTGTGTTTGCTCAAGTCCTTAGG + Intergenic
1196096654 X:111808138-111808160 CTATGTTTGCTCAAGGCCCTAGG + Intronic
1196304733 X:114087653-114087675 CTATGTTTGCTCAAGGCCCTAGG - Intergenic
1196357201 X:114809006-114809028 CTATGTTTGCTCAAGGCCCAAGG + Intronic
1196479848 X:116135514-116135536 CAATGTTTGCTCAAGGCTACAGG + Intergenic
1196573379 X:117289266-117289288 CTATGTTTGCTCAAGGCCCTGGG - Intergenic
1196589791 X:117472843-117472865 CTTTGGGAGGTCAAGGCCACTGG - Intergenic
1196984450 X:121253310-121253332 TTATGTTAGCTCAAGGCCCTTGG + Intergenic
1197052488 X:122076910-122076932 CTGTGTTCACTCAAGGCCCTGGG + Intergenic
1197307748 X:124863738-124863760 CTATGTTTGCTCAAGGCCTGGGG - Intronic
1197535845 X:127688845-127688867 CTATGTTTGCTCAAGGCCCTAGG + Intergenic
1197562006 X:128035036-128035058 CTATGTTACCTCAAGGCCCTGGG - Intergenic
1197987054 X:132278143-132278165 CTATGTTTGCTCAAGGCCCTGGG + Intergenic
1198925506 X:141787819-141787841 CTGTGTTTCCTCAAGGCCCTGGG + Intergenic
1198927367 X:141814365-141814387 CTATGTTTGCTCAAGGCCCTGGG + Intergenic
1199050666 X:143232915-143232937 CTGTGTTTGCTCAAGGCCCTGGG - Intergenic
1199177746 X:144811403-144811425 CTATGTTTGCTCAAGGCCCTGGG - Intergenic
1199669385 X:150130278-150130300 CTGTTTTAGCCCAATGCCACAGG + Intergenic
1200427197 Y:3034679-3034701 CTGTGTTCACTCAAGGCCCTAGG + Intergenic
1200482434 Y:3722273-3722295 CTATGTTTGCTCAAGGCCTTGGG - Intergenic
1200605967 Y:5263789-5263811 CTATGTTAACTCAAGGCCCTAGG + Intronic
1200719534 Y:6587978-6588000 CTATGTTTGCTCAAGGCACCAGG - Intergenic
1201928745 Y:19318233-19318255 CAGTGTTATCTGAAGGTCACTGG + Intergenic