ID: 1151919188

View in Genome Browser
Species Human (GRCh38)
Location 17:77140982-77141004
Sequence GACCGCCGGTTCCGGGGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 106}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151919188_1151919201 28 Left 1151919188 17:77140982-77141004 CCCCCTCCCCGGAACCGGCGGTC 0: 1
1: 0
2: 1
3: 8
4: 106
Right 1151919201 17:77141033-77141055 AGACTGCCCCGCGGAGCCGCCGG 0: 1
1: 0
2: 0
3: 6
4: 92
1151919188_1151919199 19 Left 1151919188 17:77140982-77141004 CCCCCTCCCCGGAACCGGCGGTC 0: 1
1: 0
2: 1
3: 8
4: 106
Right 1151919199 17:77141024-77141046 GTGGAACCGAGACTGCCCCGCGG 0: 1
1: 0
2: 0
3: 4
4: 70
1151919188_1151919198 0 Left 1151919188 17:77140982-77141004 CCCCCTCCCCGGAACCGGCGGTC 0: 1
1: 0
2: 1
3: 8
4: 106
Right 1151919198 17:77141005-77141027 GAGCTACGGTCGCGGAGCAGTGG 0: 1
1: 0
2: 0
3: 2
4: 39
1151919188_1151919197 -8 Left 1151919188 17:77140982-77141004 CCCCCTCCCCGGAACCGGCGGTC 0: 1
1: 0
2: 1
3: 8
4: 106
Right 1151919197 17:77140997-77141019 CGGCGGTCGAGCTACGGTCGCGG 0: 1
1: 0
2: 0
3: 0
4: 8

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151919188 Original CRISPR GACCGCCGGTTCCGGGGAGG GGG (reversed) Intronic