ID: 1151920226

View in Genome Browser
Species Human (GRCh38)
Location 17:77149044-77149066
Sequence CTGGAGAGACAGATGGGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 852
Summary {0: 1, 1: 0, 2: 3, 3: 85, 4: 763}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151920226 Original CRISPR CTGGAGAGACAGATGGGGAA TGG (reversed) Intronic
900485769 1:2921986-2922008 CTGGATAGACAGATGGACAGAGG - Intergenic
900581792 1:3413148-3413170 CTGGAGAGAGGGGTGGGGAAGGG - Intronic
900615410 1:3563437-3563459 CTGGAGTCACAGCTGGGGCAGGG + Intronic
901091566 1:6645127-6645149 CTGGGGAGACAGAGGGTGCAAGG + Intronic
901208468 1:7510909-7510931 GTGGACAGGCAGATGGGGCAGGG - Intronic
901238549 1:7680225-7680247 CGGGAGGGACAGGCGGGGAACGG - Intronic
901727135 1:11250684-11250706 CTGGGGAGAGAGCTGGGCAAGGG - Intronic
901737526 1:11321936-11321958 CTGGAGGGAGACATGTGGAAGGG + Intergenic
901849634 1:12007309-12007331 GTGGGAAGAGAGATGGGGAAGGG - Intronic
902163434 1:14550894-14550916 CTGGGGAGAGAGCTGGGGATGGG - Intergenic
902883820 1:19390676-19390698 CTGGAAAGACGGGTGGGGAGTGG + Intronic
902939204 1:19787601-19787623 ATGGAGCATCAGATGGGGAAGGG + Intronic
903260083 1:22126923-22126945 CTGGTGAGGCAGATGGAGGAAGG - Intronic
903273666 1:22207760-22207782 CAGGAGAGAGAGGTGGGAAAGGG - Intergenic
903281109 1:22250485-22250507 CTGGTGACTCAGATGGGGAGGGG + Intergenic
903447623 1:23432337-23432359 CTGGACAGGTAGATGGGGAATGG - Intronic
903682587 1:25107040-25107062 CGGGAGAGCGAGGTGGGGAACGG + Intergenic
903733480 1:25515146-25515168 TTGGAGAGGCAGGTGGAGAATGG - Intergenic
904292796 1:29498473-29498495 AGAGAGAGAGAGATGGGGAAGGG + Intergenic
904333965 1:29785098-29785120 GGAGAGAGAGAGATGGGGAAGGG + Intergenic
904371030 1:30047507-30047529 CTGGGGAGACCCCTGGGGAAAGG + Intergenic
904421822 1:30399006-30399028 CTGCAGAGAGAGATGGGGGTGGG + Intergenic
904585723 1:31579573-31579595 CTGCAGAGTCAGAGGGAGAAGGG + Intronic
904738798 1:32655710-32655732 CAGGAGAGAAAGTTGGGGTAAGG - Intronic
905301062 1:36986399-36986421 ATGGACAGAGAGATGGGGACAGG - Intronic
905313661 1:37067655-37067677 CTGTAGAGCCAGAGGTGGAAAGG - Intergenic
905362347 1:37429725-37429747 GGGGAGAGACAGAGAGGGAAGGG - Intergenic
905402904 1:37716296-37716318 CTGCAGAAACAGCTGGGGTAGGG + Exonic
905631696 1:39522380-39522402 CTGCAGGGACAGAAGGGGCAAGG - Intronic
905666057 1:39763792-39763814 CTGCAGGGACAGAAGGGGCAAGG + Exonic
905705658 1:40055087-40055109 CTAGAGGGGCAGATGGGAAAGGG + Intronic
906298705 1:44665259-44665281 GTGGAGAGACAGATAGGGAGGGG + Intronic
906312237 1:44762163-44762185 CTGGAGAGTCAGCTGGGTGAGGG + Intronic
907635374 1:56129328-56129350 ATGGAGAGAGAGATGTGGACAGG - Intergenic
908406656 1:63820829-63820851 ATGGAGAAACAGATGAGGAATGG + Intronic
908903554 1:68983042-68983064 CTACACAGAGAGATGGGGAAAGG + Intergenic
908959377 1:69676936-69676958 CTGGAGACTCAGAAGGGAAAGGG - Intronic
910540529 1:88350858-88350880 CTGGTGAGCCAGATGGGGTGGGG + Intergenic
910696370 1:90021961-90021983 CTGGGGAGGCAGATGTGGAGTGG + Intronic
911052031 1:93680002-93680024 CTGGAGAGTCAGATGGAGAGAGG + Intronic
911277939 1:95886249-95886271 GAGGAGAGACAGATGGGATAAGG - Intergenic
911370307 1:96988086-96988108 CTGGGAACACAGATGGGGAAGGG - Intergenic
911601274 1:99850316-99850338 GGGGAGAAACAGAAGGGGAAGGG - Intronic
911879871 1:103223755-103223777 CTTGAGAGGCAGACGGGGATGGG + Intergenic
912515447 1:110213871-110213893 ATAGAGATAGAGATGGGGAAAGG + Intronic
913053695 1:115138728-115138750 CTGGACAGACAAGTGGGGGATGG - Intergenic
913230511 1:116737045-116737067 CTGCAGATACAGATGGGGTCTGG + Intergenic
913530174 1:119728377-119728399 CTGGAAGGACAGATGGACAATGG - Intronic
914343957 1:146782181-146782203 CGGGTGAGACAGCTGGGGACGGG - Intergenic
914686394 1:149983555-149983577 TTGGAGAGACAAATTGGGAAAGG + Intronic
914902258 1:151717002-151717024 CTGGGGAGTAAGATGGGGGAAGG - Intronic
914988742 1:152480520-152480542 ATGGAGAGAGAGACTGGGAAAGG - Intergenic
915017098 1:152744385-152744407 CTGGAGGGACACATGGGGCTGGG - Intronic
915076171 1:153309613-153309635 CTGGAGAGACTGCTGAGGACAGG + Intronic
916091044 1:161308243-161308265 CTGGAGAGTCAGGAAGGGAAGGG + Intronic
916170105 1:161995574-161995596 CTGGGGAGGCAGTTGGGGAGAGG + Intronic
916239061 1:162621304-162621326 CTGGAGAGACTGATGGGTTCTGG + Intergenic
916556738 1:165899962-165899984 CTGGAAAAGCAAATGGGGAATGG - Intronic
916824383 1:168430042-168430064 CAGGTGAGACAGATGGAAAAGGG + Intergenic
916841950 1:168609862-168609884 CTGAGGAGACAGAGGGGGGAGGG + Intergenic
916875023 1:168959883-168959905 GTGGGGAGAGAGATGGGGTAGGG - Intergenic
917024959 1:170631588-170631610 CCTGAGAGCCATATGGGGAAGGG - Intergenic
917028055 1:170663420-170663442 GGGGAGAGAGAGAAGGGGAAAGG + Intronic
917144252 1:171871122-171871144 CTGGAGAGGGAGATCAGGAAGGG + Intronic
917410822 1:174758452-174758474 TTGGAGACTCAGAAGGGGAAAGG - Intronic
917803814 1:178595622-178595644 TTGGAGAGTCACATGAGGAAAGG - Intergenic
918076693 1:181176081-181176103 GTGGAGTGAGAGGTGGGGAAGGG + Intergenic
918081513 1:181211241-181211263 CTCCAGAGTGAGATGGGGAAAGG - Intergenic
918532604 1:185539695-185539717 CAGGAGAGACAGAGAGTGAAGGG - Intergenic
918579148 1:186104783-186104805 ATGGAGAGAAAAAAGGGGAATGG - Intronic
919097150 1:193051250-193051272 CTGGTCAGAAAGATGGGGGAAGG + Intronic
919717153 1:200790592-200790614 ATGGAGAGACAGACAGGCAAAGG - Intronic
919805128 1:201376917-201376939 CTTGGGGGGCAGATGGGGAAAGG - Intronic
920181132 1:204132144-204132166 CTGGCCAGACAGATGGGTAGGGG + Exonic
920215095 1:204357369-204357391 CTGAACAGACAGATGGTCAAGGG + Intronic
920267017 1:204731589-204731611 CTGGTGAGAGAGATGGAGAGAGG - Intergenic
920284928 1:204872480-204872502 CTGGTGAGACAGCTGGGGCTGGG + Intronic
920713221 1:208315399-208315421 CTGTAGAAGCAGATGGGGAAAGG + Intergenic
920975965 1:210785675-210785697 ATGGAGAGACATATCAGGAATGG - Intronic
922081350 1:222300278-222300300 CAGGAGAGACAGAGAGTGAAGGG + Intergenic
922162713 1:223090157-223090179 CTGGAGAGCCAGATGAGGGGAGG - Intergenic
922183470 1:223254410-223254432 CAGGAGAGACAGAGGGTTAATGG + Intronic
922724399 1:227915705-227915727 CTGGAGAGGAGGAGGGGGAAGGG - Intergenic
922916479 1:229262107-229262129 ATGGAGACACAGATGAGAAAGGG - Intergenic
923142708 1:231174647-231174669 CGGGACAGACTGTTGGGGAAAGG - Intronic
923555856 1:234999882-234999904 CTGGACAGAGAGAGCGGGAAAGG + Intergenic
924088099 1:240475012-240475034 CTGGAGGGACTGAAGGGGACAGG - Exonic
924601911 1:245498398-245498420 CTGGAGAGGCAGCTGGGTTAAGG + Intronic
924606324 1:245538614-245538636 ATGGAGAGACAGACAGGGGAAGG - Intronic
924740159 1:246790206-246790228 CAGGACAGGCAGATGGGGATTGG - Intergenic
1063217823 10:3939716-3939738 CTGGTTGGACAGATGGGAAAAGG - Intergenic
1063523644 10:6763249-6763271 CGGGAGAAACATTTGGGGAATGG + Intergenic
1063975844 10:11415005-11415027 GTTTTGAGACAGATGGGGAAGGG - Intergenic
1064272591 10:13878909-13878931 CAGGACAGACAGATGAGGCAGGG + Intronic
1065127127 10:22584481-22584503 CTGGAGAAACAGAAGGGGAGAGG + Intronic
1065550066 10:26861003-26861025 CTGGAGAGAGTGAGGAGGAAGGG - Intronic
1066444566 10:35470052-35470074 ATGGAGAGACAGATGAGATAGGG + Intronic
1066489702 10:35882857-35882879 CTGGAGGGACAGATGCAGACAGG + Intergenic
1067222297 10:44352942-44352964 CTGGTGACACAGATGGAGAAAGG + Intergenic
1067344530 10:45427995-45428017 CTGCAGAAGCAGAGGGGGAAGGG - Intronic
1068075291 10:52246356-52246378 TTAGAAAGAGAGATGGGGAAGGG + Intronic
1068595197 10:58895674-58895696 CTGGAGAGACAGAGGTGGCCAGG + Intergenic
1069326980 10:67243173-67243195 CTGGAGAGAAACATGGGGAGTGG - Intronic
1069342909 10:67433236-67433258 AGAGAGACACAGATGGGGAAAGG + Intronic
1069548975 10:69349311-69349333 CTGGTGAGGCAGGTGGGGCAGGG - Intronic
1070052094 10:72899217-72899239 CTGAAGAAATAGAAGGGGAAAGG + Intronic
1070603182 10:77879799-77879821 CAGGAAAAACAGATGGGGGAGGG + Intronic
1070721199 10:78758370-78758392 CTGGAGAGACAGGAGTGCAAGGG - Intergenic
1071149350 10:82615795-82615817 TTGGAGAGGGAGATGGGAAAGGG + Intronic
1071197504 10:83178085-83178107 CAGGAGAGAGAGAGAGGGAAGGG + Intergenic
1071299595 10:84246386-84246408 CTGGAGACTCAGAAGGGGAAGGG - Intronic
1071324546 10:84499850-84499872 GTGCAGAGAGAGATGGGGTAGGG - Intronic
1071626210 10:87173805-87173827 CTATAGAGATAAATGGGGAAAGG + Intronic
1072070406 10:91909590-91909612 CTGGAGAGACAGAGAGAGAGAGG - Intergenic
1072839074 10:98750458-98750480 CTGAAGAGACTGAAGGGGATGGG + Intronic
1073106940 10:101037485-101037507 CTGGAGAGAGAGTTGGGGCCTGG - Intronic
1073136439 10:101223038-101223060 CTGGGGGAACAGATGGGCAAAGG + Intergenic
1073204866 10:101763449-101763471 CAAGAGATCCAGATGGGGAAGGG + Intergenic
1073293291 10:102423901-102423923 CAGGGGAAACAGATGGGGATAGG + Intronic
1073417281 10:103395103-103395125 ATGGAGGGCCAAATGGGGAACGG + Intronic
1073741918 10:106417076-106417098 CAGGAGAGACAGAGTGTGAAGGG + Intergenic
1073774139 10:106767265-106767287 CTTCAGTGACAGCTGGGGAATGG - Intronic
1074125825 10:110528159-110528181 CTGGATGGACAGATCGGGATTGG + Intergenic
1074233589 10:111562135-111562157 CTGGAAAGGCAAATGGAGAATGG + Intergenic
1074385730 10:113015234-113015256 CTGCAGAGACAGCAGAGGAATGG - Intronic
1074800379 10:116994498-116994520 CTGTAGAGACAGAGAGAGAAGGG + Intronic
1075370093 10:121928198-121928220 GCGGAGAGACAGAGCGGGAAGGG + Intronic
1075400153 10:122155213-122155235 CTGGAGAGGCAGGTTGAGAAGGG - Intronic
1075409254 10:122215257-122215279 CTGGAGTGACAGAGGTGGGAGGG + Intronic
1075422356 10:122310975-122310997 CTGCTGAGACAGATGAGGAAAGG - Intronic
1075667671 10:124242674-124242696 CAGGGGAAACAGAGGGGGAAGGG + Intergenic
1076088076 10:127653438-127653460 GTGGAGAGGCCCATGGGGAAAGG + Intergenic
1076265605 10:129107624-129107646 ATGAAGATGCAGATGGGGAAGGG + Intergenic
1076479096 10:130772652-130772674 CAGGAGATTCAGATGGGCAAAGG - Intergenic
1076814840 10:132909610-132909632 CTGGAAAGCCAGATGGAGGAGGG - Intronic
1077069115 11:659797-659819 CTGGAGAGACAGAGCGGGAGAGG + Intronic
1077097329 11:804632-804654 CTGGAAAGAGGGTTGGGGAATGG + Intronic
1077280616 11:1743486-1743508 ATGGATGGACAGATGGAGAATGG + Intronic
1077759882 11:5083042-5083064 ATGCAGAGAGATATGGGGAAAGG - Intergenic
1078064970 11:8072281-8072303 TTGGAGATGCAGAGGGGGAAGGG + Intronic
1078084415 11:8225100-8225122 GTGGGGAGACAGATGGAGAAAGG + Intronic
1078714740 11:13829104-13829126 GTGGGGAGACAGAGGGAGAAGGG - Intergenic
1078827168 11:14940335-14940357 CAGGAGAGAGAGAGGGGGAAGGG + Intronic
1079119515 11:17671995-17672017 CTGCAGAGACACATGGGGATGGG + Intergenic
1079239848 11:18714625-18714647 CTGGGGAGAAAGGTGGGCAAGGG + Intronic
1080118575 11:28648120-28648142 TTGAAGAGCCAGATGGGGCAAGG + Intergenic
1080807532 11:35668099-35668121 CTGGAGAGAGTGAAGGGGGAAGG + Intronic
1080829421 11:35877412-35877434 GTTGAGAGACACATGGAGAAGGG + Intergenic
1081455034 11:43212795-43212817 CTTGAGAGCCACACGGGGAAGGG - Intergenic
1081579060 11:44339531-44339553 CTGGAGAGACAGATCTGGCCTGG + Intergenic
1081589699 11:44412906-44412928 GAAGAGAGACAGATGGGGCAGGG + Intergenic
1081593666 11:44444521-44444543 GTGGAGAGGCAGAGGTGGAATGG + Intergenic
1081641274 11:44755975-44755997 ATGGAGAGAGAGATGGAGGAGGG + Intronic
1082009684 11:47441734-47441756 CTGCAGAGCCAGGTGGGGGATGG + Intronic
1083261743 11:61526881-61526903 CTGGGAAGGCAGGTGGGGAAAGG + Intronic
1083343299 11:61972725-61972747 CTGGAGACATAGATGAGGATTGG + Intergenic
1083398122 11:62405233-62405255 CTGGAGAGACAGGTGGGAACAGG + Intronic
1083749186 11:64752072-64752094 CTGGAGGCAGAGACGGGGAAGGG + Intronic
1083821167 11:65172223-65172245 CTGCAGAGACAGATCGGGGTGGG - Intronic
1083894801 11:65614405-65614427 CAGGAGAGGCAGAGAGGGAAAGG + Intronic
1083939248 11:65886508-65886530 CTGGATAGGTGGATGGGGAAGGG - Intronic
1084006883 11:66327873-66327895 CTGGACACACACATGGGGACAGG - Intergenic
1084711374 11:70845979-70846001 CTGGAGAAACAGGTGGCCAAGGG + Intronic
1085820093 11:79783240-79783262 GTGGGGAGACAGCTGTGGAAGGG + Intergenic
1085837936 11:79976225-79976247 CTGCAGACACAGATGGAGATGGG + Intergenic
1086941621 11:92803984-92804006 CTGAAGAGACTGAGTGGGAAGGG - Intronic
1087092555 11:94288729-94288751 CTGGAGAAAGAGGTGGAGAATGG + Intergenic
1088194189 11:107257508-107257530 CTGGAAAGAAAGAAAGGGAAGGG + Intergenic
1089153193 11:116380496-116380518 TTGCAGAGACACATGGAGAAAGG - Intergenic
1089998797 11:122935138-122935160 CGGGAGAGGAAGAAGGGGAAGGG + Intronic
1090082267 11:123622008-123622030 AGAGAGAGACAGAGGGGGAAAGG - Intronic
1090260384 11:125314896-125314918 CAGGAAAGAGAGTTGGGGAAAGG + Intronic
1090386954 11:126362972-126362994 CTGGAGAGGCAGAGAGAGAAGGG - Intronic
1090408560 11:126492256-126492278 TTGGAGACACAGCTGGGGAAGGG + Intronic
1090534072 11:127621196-127621218 GTGCAGAGACAGGTGAGGAAAGG - Intergenic
1090658627 11:128864778-128864800 CTGCAGAGAGTGATGGGGACAGG - Intronic
1090901147 11:131032780-131032802 CTGAAGAGACATGTGTGGAAAGG + Intergenic
1092202210 12:6592818-6592840 CTGGTGAAGCAGATGGAGAAAGG + Intronic
1092364484 12:7865623-7865645 AAGGAGAGAGAAATGGGGAATGG - Intronic
1092884553 12:12913763-12913785 CGGGAGAGACACATGAAGAAGGG - Exonic
1092917130 12:13199183-13199205 CTGGGCAGACCGCTGGGGAAAGG + Intronic
1093495808 12:19756018-19756040 CAGGTGAGGGAGATGGGGAAAGG - Intergenic
1094635548 12:32223865-32223887 AAGGAGAAAGAGATGGGGAATGG + Intronic
1096077093 12:48812716-48812738 CTGCAGAGCAAGATGGAGAAGGG + Intergenic
1096252628 12:50042850-50042872 CTGGATAGGCAGAGGAGGAAGGG - Intergenic
1096863198 12:54545108-54545130 CAGGAGCTAGAGATGGGGAAGGG - Exonic
1097067465 12:56331348-56331370 CAGGTGAGAAAGATGGGAAAAGG - Intronic
1097173713 12:57130851-57130873 CTGGAGATACAGAGGGGGCGTGG - Intronic
1097466976 12:59938402-59938424 GTGGAGGGACAGAGAGGGAAGGG + Intergenic
1097697326 12:62787203-62787225 CTGGAGACAGGGAAGGGGAAAGG + Intronic
1098521008 12:71435628-71435650 CAGGAGAGAGAGAGGGTGAATGG + Intronic
1098848387 12:75565851-75565873 ATGGAGTAACAGATGGGGGAAGG + Intergenic
1098862343 12:75724197-75724219 ATGGAAACACATATGGGGAAAGG - Intergenic
1098990373 12:77059299-77059321 CAGGACAGACAGATGGAGCAAGG - Intronic
1099947520 12:89261474-89261496 CTGGGGTGATAGAAGGGGAAAGG + Intergenic
1099975040 12:89537713-89537735 CTGGTGAGACAGTTGGGCACAGG + Intergenic
1100245610 12:92753711-92753733 CTGGAGAGGCAGAAGGGAAAAGG - Intronic
1100434490 12:94559437-94559459 CTGGTTAGAAAGAGGGGGAATGG + Intergenic
1100785532 12:98074022-98074044 CTGCAGGGAGAGATGGTGAAGGG - Intergenic
1101540213 12:105658328-105658350 CTGGGGAGATAAATGGGGAATGG + Intergenic
1101843924 12:108346555-108346577 GTGGGGAGAGACATGGGGAATGG + Intergenic
1102437437 12:112936331-112936353 CTGGAGGCAGAGATGAGGAAAGG + Intergenic
1102558051 12:113741925-113741947 ATGGAGAGAGAGAAGGGGAAGGG + Intergenic
1102851176 12:116246758-116246780 CTGGGGAGGGAGGTGGGGAAGGG + Intronic
1102872726 12:116426624-116426646 CTGGAGAGAAAGATTGGAGAAGG + Intergenic
1102927229 12:116835614-116835636 CTGGAGTGCTAGATGGAGAAGGG + Intronic
1102928731 12:116846448-116846470 TTGTAGAGACATATGGGGCATGG + Intronic
1103081402 12:118026866-118026888 CTGTGTAGACAGAGGGGGAAAGG - Intronic
1103097818 12:118146152-118146174 CTGCAGTGAAAGATGGGGAAGGG - Intergenic
1104427993 12:128693806-128693828 CTGCAAAGACAGAGGGAGAAAGG - Intronic
1104649823 12:130523539-130523561 CTGGAGCTCCTGATGGGGAAGGG - Intronic
1104972513 12:132538370-132538392 GTGAAGAGACAGCTGGGGATGGG - Intronic
1105211680 13:18260879-18260901 CTTGAGAGAGGCATGGGGAAGGG - Intergenic
1105398805 13:20069271-20069293 CAGGAGAGAAAAATGGGGGAAGG - Intronic
1105670712 13:22611704-22611726 CTGGAGAGCCAGACCTGGAAAGG - Intergenic
1106029618 13:25988297-25988319 CTGCACAGGCAGATGGTGAAAGG + Intronic
1106152153 13:27115319-27115341 CTGGAGAGAGAGAAAGGTAAGGG + Intronic
1106343340 13:28852275-28852297 CTGGAGAGACAGATGAACAAAGG - Intronic
1106421556 13:29589864-29589886 CTGGTGTGACTGATGGGGAGAGG - Intronic
1107435699 13:40378911-40378933 CTGGAGAGACACATCGGGAGTGG - Intergenic
1107459103 13:40584074-40584096 AGGGGGAGACAGATGGGGAATGG + Intronic
1107502944 13:40999336-40999358 TTGGAGAGACTAAAGGGGAAAGG + Intronic
1107613392 13:42139633-42139655 GTGGACAGATAGATGGGGAGTGG - Intronic
1108076139 13:46681530-46681552 CAGGAGAGAAAAATGGAGAAAGG - Intronic
1108087131 13:46805128-46805150 CAGGAGAGACAGAGAGAGAAGGG - Intergenic
1108827331 13:54429656-54429678 CTGGAGACAGAGATAGTGAAAGG - Intergenic
1110317969 13:74133210-74133232 CTGGAGAGAGTGGAGGGGAAGGG - Intronic
1110583469 13:77159650-77159672 CAGGAGAGAGAGAAGGGGAAAGG - Intronic
1111080660 13:83302428-83302450 CAGAAGAGACAGAAGGGTAAAGG - Intergenic
1111321490 13:86635975-86635997 AGGGTGAGAAAGATGGGGAAAGG - Intergenic
1111337874 13:86846411-86846433 CTGGAGAGTCTCAAGGGGAAGGG + Intergenic
1111877939 13:93919987-93920009 CTGTAGAGAGAGATGAGGGAGGG - Intronic
1112563003 13:100530120-100530142 CTGGAGACACAGTTGGAGAAGGG + Exonic
1112924546 13:104657552-104657574 AGGGAGAGACAGAGGGAGAAAGG - Intergenic
1113038110 13:106073625-106073647 TTGGAGTGACATCTGGGGAAAGG + Intergenic
1113050290 13:106203835-106203857 TTGGAGACTCAGAGGGGGAAGGG - Intergenic
1113589947 13:111491443-111491465 ATGGGGAGAGAGATGGGGAGAGG - Intergenic
1113967829 13:114164392-114164414 AAGGAGAGGCAGATGGGGGAAGG + Intergenic
1114046527 14:18880881-18880903 ATGGAGAGAGAGATGGTGAGAGG + Intergenic
1114117685 14:19638569-19638591 ATGGAGAGAGAGATGGTGAGAGG - Intergenic
1114517396 14:23308774-23308796 CAGGAGAGAAAGAAGGAGAAAGG - Intronic
1115176595 14:30569179-30569201 CTGGGGAGAGAGAAGGGGTAGGG - Intronic
1116024642 14:39500289-39500311 GAGGAGAGAAAGATGGGGAGAGG - Intergenic
1116387639 14:44351078-44351100 CTTAAGAGACAGGTGGGGAATGG - Intergenic
1116998117 14:51345594-51345616 CAGGAGAGACAGAGAGTGAAGGG - Intergenic
1118492071 14:66270701-66270723 CTGGTGGGACACATTGGGAAAGG + Intergenic
1118969033 14:70616357-70616379 CTGGGGAGAGAAATGAGGAAGGG + Intergenic
1119444606 14:74652764-74652786 CTGGAGAGGGAGGTGGAGAATGG + Intergenic
1119662095 14:76459410-76459432 CTGGAGAAACAGAGGGTGGAGGG + Intronic
1119685299 14:76626356-76626378 CTGGAGAGGAAGGTGGGGAGTGG - Intergenic
1119738701 14:77000126-77000148 CTGGGGAGACCAATGGGGCAGGG - Intergenic
1120537465 14:85714542-85714564 CTGGAGAGACAGATAGATATTGG + Intergenic
1120920105 14:89746921-89746943 CTAGCCAGACAGAAGGGGAAAGG + Intergenic
1122127294 14:99586237-99586259 CTTGGGAGACAGATGGGGCCTGG - Intronic
1122292411 14:100686868-100686890 CTGGAGAGGCAGGAGGGGGAGGG + Intergenic
1122639028 14:103146437-103146459 CTGGAGGCATGGATGGGGAAGGG + Intergenic
1122717624 14:103705196-103705218 CTGGGGACACTGGTGGGGAAGGG - Intronic
1122854356 14:104552997-104553019 CTGGAAGGACAGAGAGGGAAAGG + Intronic
1123124405 14:105935898-105935920 CTGGAGATCCAGATAGGGCATGG + Intergenic
1202928465 14_KI270725v1_random:16170-16192 GGGGAGAGAGAGGTGGGGAAGGG - Intergenic
1123427724 15:20185615-20185637 ATGGAGGGACAGATGGGGAGGGG - Intergenic
1123536961 15:21192165-21192187 ATGGAGGGACAGATGGGGAGGGG - Intergenic
1125702131 15:41696052-41696074 CTGGAGAGAGAGAGGAGAAAGGG - Intronic
1126519422 15:49574472-49574494 CAGGAAAGACAGAAAGGGAAGGG - Intronic
1126704850 15:51397447-51397469 CTGGAGAGAGAGAGAGAGAAAGG - Intronic
1127267570 15:57374255-57374277 AAGGAGAGAGAGAAGGGGAAGGG - Intergenic
1127500439 15:59549537-59549559 CTGGTGAGACAGGAGGTGAAAGG + Intergenic
1128128021 15:65207142-65207164 CTGGAGAGACAAATGTGATAGGG - Intronic
1128356773 15:66933659-66933681 CTGGAAGGAGGGATGGGGAATGG - Intergenic
1128405716 15:67335736-67335758 CAGGTGAGTCAGAAGGGGAAAGG - Intronic
1128429031 15:67573381-67573403 CAGGAGAGACAGTTGGGTAGAGG + Intronic
1128591129 15:68898427-68898449 ATGGAGAGAGAGAAGGGGCAAGG - Intronic
1128651625 15:69419388-69419410 GTGGAGAGACAGATGGGAGACGG - Intronic
1128894191 15:71357582-71357604 CGGGAGAGCCAGGAGGGGAAAGG - Intronic
1129025239 15:72565798-72565820 CTGAAAAGAAAGATGGGGAATGG - Intronic
1129107368 15:73319199-73319221 CTGGAGACAGGGGTGGGGAAGGG + Intergenic
1129249639 15:74301862-74301884 GTGGAGAGAGAGAGGGGGGAGGG - Intronic
1129352241 15:74962858-74962880 CTGGCCCCACAGATGGGGAATGG + Intronic
1129462415 15:75706225-75706247 CTGGGGAGACAGAGGGGGCTGGG - Intronic
1130064263 15:80591758-80591780 CGGCAGAGACCGAGGGGGAAAGG - Intronic
1130988790 15:88862457-88862479 GTAGAGTGAGAGATGGGGAAAGG - Intronic
1131342688 15:91617394-91617416 CAGGAGAGAGAGAGAGGGAAGGG + Intergenic
1131667982 15:94590576-94590598 CTGGAGTGACGGAAGGAGAAAGG - Intergenic
1132437834 15:101824806-101824828 CTGGAGAGACAAATGGAAACTGG - Intergenic
1132471203 16:104364-104386 CTGGAGAGAGTTATAGGGAAAGG + Intronic
1132693935 16:1193839-1193861 CTGGAGTGACAGGTGGGGGCAGG + Intronic
1132915827 16:2342748-2342770 CTGTGAAGACTGATGGGGAAAGG - Intergenic
1133026230 16:2990064-2990086 CTGGAGAGACAGATGAGGTGAGG - Intergenic
1133027587 16:2995435-2995457 CAGGTGAGACAGATGGGGTCTGG + Intergenic
1133141427 16:3747550-3747572 CTAGAGAGACAGCTGGGTAATGG - Intronic
1133232559 16:4373409-4373431 CCGGAGGGTCAGATGGGGATGGG + Intronic
1133387941 16:5385887-5385909 CTGGAGAGACAAGTGGGGGCAGG + Intergenic
1134282208 16:12827138-12827160 CTGAAGACTCAGCTGGGGAAAGG + Intergenic
1134346119 16:13393366-13393388 TTGGTGAGACATTTGGGGAAAGG - Intergenic
1134810911 16:17166346-17166368 CTGGAGGAACAGATGGGAATTGG - Intronic
1135898462 16:26432274-26432296 CTGGAGAGAGAGATTGAGATCGG - Intergenic
1136376864 16:29871086-29871108 CTGGAGAGAGGGCTGGGGAAAGG - Intergenic
1136856574 16:33664194-33664216 ATGGAGTGACAGATGGGGAGGGG + Intergenic
1137675375 16:50301307-50301329 GTGGAGGGAGAGGTGGGGAAGGG + Intronic
1137692664 16:50440434-50440456 CTGGAGAGGCAGGTGGGTAGGGG + Intergenic
1137846606 16:51695962-51695984 CTGGAGAGGCTGAAGTGGAAGGG + Intergenic
1139808402 16:69589988-69590010 TTGTAGAGACAGTTGGGGAGGGG - Intronic
1139990038 16:70933154-70933176 CGGGTGAGACAGCTGGGGATGGG + Intronic
1140665687 16:77225132-77225154 CAGGAGAGACAGAAGGAAAATGG - Intergenic
1141263070 16:82471327-82471349 AAGGAGAAACAGAAGGGGAAGGG - Intergenic
1141306849 16:82872751-82872773 CTGGAGATAGAAATAGGGAATGG + Intronic
1141388990 16:83648763-83648785 CAGGAGACAGAGATGGGGAGAGG - Intronic
1141461382 16:84180407-84180429 CTGGAGAGCCACATGGGGCCTGG - Intronic
1141798978 16:86294590-86294612 AGGGAGAGACAGAAGGGGAGAGG - Intergenic
1142218971 16:88843668-88843690 CTGGAGAGCCTGAGGGGGAGGGG + Intronic
1203118152 16_KI270728v1_random:1512669-1512691 ATGGAGTGACAGATGGGGAGGGG + Intergenic
1142919581 17:3172527-3172549 ATAGAGAGAGAGGTGGGGAAGGG - Intergenic
1143589093 17:7869803-7869825 CTGGAGTGCTAGATGGTGAAAGG + Intronic
1143592548 17:7894346-7894368 ATGGAGAGAGAGAGGGAGAAGGG - Intronic
1143718407 17:8792834-8792856 CTGGAAAGACAGATGGGACCAGG - Intergenic
1144438269 17:15260591-15260613 CTGGGAACCCAGATGGGGAAGGG + Intronic
1145300045 17:21627773-21627795 GTGGAGGGAGGGATGGGGAAGGG + Intergenic
1145350243 17:22075503-22075525 GTGGAGGGAGGGATGGGGAAGGG - Intergenic
1146665428 17:34699500-34699522 CTGGAGAGGCAGAGGGAGAAAGG - Intergenic
1147601861 17:41751662-41751684 CTGCAAAGACAGCTGGGAAATGG - Intergenic
1148001450 17:44389887-44389909 CTGTACAGCCAGATGGGGGAAGG - Intergenic
1148148845 17:45384255-45384277 TGGGAAAGACAGATGGGGGAAGG + Intergenic
1148617938 17:49014249-49014271 AGGGGGAGACAGATGGGGACGGG - Intronic
1148793206 17:50185080-50185102 CTGGGGAGACAGATTTGGGAAGG + Exonic
1149356287 17:55843392-55843414 CTGGAGAGGTAGATGGGGAGGGG - Intergenic
1149544972 17:57496664-57496686 CTGGAGCCAGGGATGGGGAAGGG - Intronic
1149559617 17:57599245-57599267 CCCGAGACACAGATGGGGAAAGG + Intronic
1149576692 17:57718726-57718748 CAGGAGAGAAAGAAGGAGAAAGG + Intergenic
1149587814 17:57804628-57804650 AGGGAGAGATATATGGGGAATGG - Intergenic
1150639903 17:66942518-66942540 CTGGAGGGACAGAGGGAGGAGGG + Intergenic
1151393547 17:73804015-73804037 CTGGCCAGGCAGCTGGGGAATGG - Intergenic
1151555737 17:74845886-74845908 CTGGAGAGAGACTTGAGGAAGGG - Intronic
1151828056 17:76534729-76534751 CTGGAGAGACAGCTGTGCCAGGG + Intronic
1151920226 17:77149044-77149066 CTGGAGAGACAGATGGGGAATGG - Intronic
1151962123 17:77411169-77411191 CTTGGGAGAGAGTTGGGGAATGG - Intronic
1152520358 17:80852648-80852670 CTGGAGGGGCAGATGGGGTATGG - Intronic
1152986233 18:323950-323972 CTGGAAAAACAAATGGAGAAAGG - Intronic
1153039478 18:798492-798514 TTGGAGTGACTGATGGGGTAGGG + Intronic
1153042412 18:826332-826354 CAGGAGAGACAGCTCCGGAAAGG + Intergenic
1153107721 18:1547234-1547256 CTGGGGAGACAGGTTGGGAAAGG - Intergenic
1153171447 18:2320565-2320587 CTGGAGATACAGCTGTGAAAAGG + Intergenic
1153374075 18:4356052-4356074 CTGGAGTGACAGATGTGCAATGG - Intronic
1153382043 18:4451163-4451185 CTAGAGAGAAGGATGGGAAATGG + Intronic
1153959648 18:10130199-10130221 CCAGGGAGGCAGATGGGGAAAGG - Intergenic
1154090816 18:11361194-11361216 CTAGACAGAAAGGTGGGGAAAGG + Intergenic
1154348834 18:13566196-13566218 CTGGGGAGATAGTAGGGGAAAGG + Intronic
1155728962 18:29127916-29127938 CAGGAGAGAGAGAAGGCGAAGGG + Intergenic
1155771342 18:29704342-29704364 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1156490916 18:37495523-37495545 CTGGAGCCTCAGATGGGGCATGG - Intronic
1157198641 18:45640360-45640382 CTGGAGAGACACAGGGGTAGGGG + Intronic
1157656209 18:49391646-49391668 CTGGAGAGACAGAAGAATAAAGG + Intronic
1158025525 18:52892385-52892407 CTGAGAAGAAAGATGGGGAAAGG - Intronic
1158369557 18:56784434-56784456 ATGGAGACTCAGAAGGGGAAGGG - Intronic
1158579198 18:58666928-58666950 CTGGGGATACTGATGGGAAAGGG - Intergenic
1159942621 18:74420117-74420139 CTGGAGAGGCGGAGGAGGAAGGG - Intergenic
1160029345 18:75244957-75244979 CAAGAGAGAGAGATGGGGGAAGG - Intronic
1160427877 18:78790708-78790730 GTGGACACACAGATGGGGAGCGG + Intergenic
1161176429 19:2845108-2845130 ATGGAGGGACAGAGGGGGAAAGG - Intronic
1161256186 19:3311086-3311108 ATGGAGAGAGAGATGGAGAGAGG - Intergenic
1161256200 19:3311208-3311230 ATGGAGAGAGAGATGGAGAGAGG - Intergenic
1161449717 19:4338405-4338427 CGGGAGAGACAGACGGGGCCAGG + Intronic
1161465731 19:4429255-4429277 CTGAAGGGACAGATGGAGGAGGG - Intronic
1161991629 19:7687475-7687497 CTGGACAGGCTGATGGGGAGTGG - Exonic
1162087117 19:8255602-8255624 CAGGAGAGACAGCTGGGGCTGGG - Exonic
1162153293 19:8660342-8660364 CTGTAGACACAGAGGGGGAATGG + Intergenic
1162182411 19:8879354-8879376 CCTGAGAGACACACGGGGAAGGG + Intronic
1162559171 19:11406143-11406165 CTGGAGGGGCAGCTGGGGAGGGG - Intronic
1162833914 19:13303735-13303757 ATGGAGAGAGAGAAGGGGACAGG - Intronic
1163233061 19:16016704-16016726 CTGGGGATGCAGATGGGGCAGGG - Intergenic
1163374774 19:16923274-16923296 CTGGACAGAAAGCTGGGGACGGG + Intronic
1163662904 19:18589183-18589205 CTGCAGAGTCAGATGGGGCGGGG + Intronic
1163709305 19:18836522-18836544 CTGGACAGAAAGGTGGGAAAGGG + Intronic
1164443850 19:28300544-28300566 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1164781063 19:30893253-30893275 CTGAAAACACAGATGGAGAATGG + Intergenic
1165278383 19:34774281-34774303 CTGGAGGGGCAGATGGGGAGGGG - Intergenic
1165412877 19:35673209-35673231 CTGGGGAGACAGAGGGAGGACGG - Intronic
1165413367 19:35676033-35676055 ATGGATAGACAGATGGAGCAGGG - Intronic
1165750335 19:38255810-38255832 CTGGAGAAAGAGTGGGGGAAGGG - Intronic
1165790275 19:38487254-38487276 ATGGAGAGAAGGATAGGGAACGG - Intronic
1165996798 19:39849353-39849375 CTGGAGAGACAGGAGGTGACGGG - Intergenic
1166330696 19:42076458-42076480 CTGGAGCGGCGGGTGGGGAAGGG + Intronic
1166423146 19:42653704-42653726 GGGAAGAGACAGATGGGGATGGG + Intronic
1166864970 19:45830310-45830332 CTGGAGAGGCAGCAGGGGGATGG - Intronic
1167110549 19:47458160-47458182 GAGGAGAGAGAGATGGGGAGAGG - Intronic
1167110602 19:47458405-47458427 CGGGGGAGAGAGATGGGGAAAGG - Intronic
1167192976 19:48004589-48004611 CTGGAGGAACAGATGGAGGAGGG - Intronic
1167233885 19:48302349-48302371 TTGGAGAGACAGACGTTGAATGG + Intronic
1167389963 19:49188618-49188640 CTGGAGAGACAAAGAGGGCACGG - Intronic
1167676452 19:50889386-50889408 GAGGAGAGACAAATGGCGAAAGG + Intergenic
1167691752 19:50989258-50989280 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1167810724 19:51827926-51827948 TAGGAGAGACAGAAGGGAAAAGG - Intergenic
1168299087 19:55393147-55393169 CTGGAGGGACAGCAGGGGAGCGG - Intronic
925092509 2:1166946-1166968 ATGGAGAGCCAGAAGGGGCATGG - Intronic
925237910 2:2295225-2295247 GGGAAGAGACAGATGAGGAAGGG + Intronic
925682923 2:6442042-6442064 GTGAACAGACAGAAGGGGAATGG - Intergenic
926006812 2:9378951-9378973 CTGGATAAACAGACAGGGAAAGG + Exonic
926198411 2:10777094-10777116 TTGCAGAGACAGAATGGGAAAGG + Intronic
927043051 2:19249152-19249174 ATGGAGAAACAGGTGAGGAAAGG - Intergenic
927061319 2:19424946-19424968 CTGGATATACAGATGGAGACTGG - Intergenic
927107635 2:19841620-19841642 CTGGGGAGACAGATAGTGTAAGG + Intergenic
927397122 2:22665352-22665374 CTCGAGAGACAGTTGGGGGTAGG - Intergenic
927408125 2:22795637-22795659 CTGAGTAGACAGGTGGGGAAGGG - Intergenic
927503170 2:23595792-23595814 GTGGAGAGACAGCATGGGAAGGG - Intronic
928924968 2:36568163-36568185 AGGGAGAGACAGAAGGGGTAGGG + Intronic
929418984 2:41771667-41771689 CTGGTGAAGCAGATGGGAAAGGG + Intergenic
929698060 2:44136714-44136736 CACGAGAGACAGAGAGGGAATGG - Intergenic
929937596 2:46305259-46305281 CTGAAGAGTCAGGTGTGGAATGG + Intronic
930858480 2:56044385-56044407 CTGGACAGACAGCTGGGTCAGGG + Intergenic
931287080 2:60841222-60841244 CTGGAGAGACACCTGGGCACAGG + Intergenic
931400251 2:61925001-61925023 ATGGAGAGACAGACGGTCAAGGG + Intronic
932218942 2:69985447-69985469 CTGGAGTGACTGTTGGTGAAAGG - Intergenic
932800647 2:74739686-74739708 CAGGACAGACATTTGGGGAAGGG + Intergenic
933247624 2:79993739-79993761 TTGGGGAGACAGATGGGCATGGG + Intronic
933947466 2:87299002-87299024 AAGGAGAGACAGAAGGGGCATGG - Intergenic
934508246 2:94914084-94914106 CTGGAGAGACAGAGGGTGCATGG - Intergenic
934616763 2:95776165-95776187 ATGGAGAGACAAAATGGGAATGG - Intergenic
934644127 2:96048395-96048417 ATGGAGAGACAAAATGGGAATGG + Intergenic
934945209 2:98536254-98536276 GTCCAGGGACAGATGGGGAAAGG + Intronic
936170684 2:110170168-110170190 CTGGAGAGACTGAGGCGGAGAGG + Intronic
936332729 2:111562565-111562587 AAGGAGAGACAGAAGGGGCATGG + Intergenic
936658816 2:114519300-114519322 CTGTAGTGACAGATGGGGTGAGG - Intronic
937053145 2:118908496-118908518 CTGAAGATCCAGCTGGGGAAAGG + Intergenic
937316181 2:120933390-120933412 ATGGGGAGACAAATGGGGCAGGG + Intronic
937430773 2:121836191-121836213 CTGGAGAGACCCCTGGGGCAGGG - Intergenic
937471569 2:122178293-122178315 CTGAAAAGAAAGATGGTGAAAGG - Intergenic
937471576 2:122178350-122178372 CTGAAAAGAAAGATGGTGAAGGG - Intergenic
937610196 2:123851967-123851989 CTGGGAACTCAGATGGGGAAAGG + Intergenic
938006474 2:127791005-127791027 CTGTTGAGAGAGATGGGGAGAGG - Intronic
938266834 2:129934024-129934046 ATGGAGAGAGAGATGGTGAGAGG - Intergenic
938718295 2:134040964-134040986 CAGGAGAGACAGTGAGGGAAGGG + Intergenic
939858901 2:147394170-147394192 ATTGACAGACACATGGGGAAAGG - Intergenic
940280151 2:151980334-151980356 TTGGAGAGAGTGAAGGGGAAAGG - Intronic
940286579 2:152038549-152038571 CTGGAGGCACAGAAGAGGAAAGG + Intronic
940295658 2:152121495-152121517 CTGGATTGGGAGATGGGGAAGGG - Intronic
940495963 2:154429028-154429050 GTGGAGCGAGAGATAGGGAATGG - Intronic
940495968 2:154429058-154429080 GTGGAGCGAGAGATAGGGAATGG - Intronic
940812684 2:158263053-158263075 CTAGAGAGACAGAGAGGGCAAGG - Intronic
941573821 2:167205036-167205058 CTAGAGAGAAAGATGCAGAAAGG - Intronic
941987961 2:171526436-171526458 GTGGGGAGAGAGAGGGGGAAAGG - Intronic
942394000 2:175526968-175526990 ATGCAGATAAAGATGGGGAAGGG - Intergenic
943797652 2:192017209-192017231 CTGGAGAGGCAGGTGGGGCCAGG + Intronic
944103878 2:196058449-196058471 GTGGAGAGACACATGGGGATAGG - Intronic
944396019 2:199267038-199267060 CTGGCAAAGCAGATGGGGAAGGG + Intergenic
944697720 2:202217973-202217995 CTGGAGAGGGAGACGGGGATGGG + Intronic
946072124 2:217043403-217043425 CCTGAGAGACACATGGGAAAGGG - Intergenic
946201025 2:218070876-218070898 CTGGGGAGAGGGATGGGGAAGGG - Intronic
946348074 2:219127290-219127312 CTGGAGAGTCCCATGAGGAAGGG - Intronic
946552849 2:220822564-220822586 CTGGAGGGACAGATGAGGAAGGG - Intergenic
946587055 2:221201494-221201516 CAGGAGAGACAGAAAGGCAAAGG + Intergenic
946641931 2:221793170-221793192 CTGGAGGGATTGGTGGGGAATGG + Intergenic
948076477 2:235168709-235168731 CAGCAGGGCCAGATGGGGAAGGG + Intergenic
948824935 2:240569430-240569452 CTGGAGTGTCAGCTGCGGAAGGG + Intronic
948948285 2:241232974-241232996 CTGGGGAGGAAGAAGGGGAAGGG + Intronic
949019652 2:241734229-241734251 CTGGGGAGGCCGCTGGGGAAAGG + Intergenic
1169303515 20:4468196-4468218 TTGGAGTGAAAGATGGAGAAAGG + Intergenic
1169495671 20:6112759-6112781 TTGAAGAAACAGAAGGGGAAAGG + Intronic
1169905691 20:10600977-10600999 ATGGACAGACAGATGAGAAAAGG + Intronic
1171211855 20:23323055-23323077 CTGGAGACTCAGAAGGGGTAGGG + Intergenic
1171307746 20:24120451-24120473 CTGTAGTGCCACATGGGGAAGGG - Intergenic
1171330725 20:24336482-24336504 CTGGGGAGAGTGATGGGGAGGGG + Intergenic
1171428564 20:25064150-25064172 CAGGAGAGGCAGCTTGGGAATGG - Intergenic
1171560501 20:26120491-26120513 GTGGAGGGAGGGATGGGGAAGGG - Intergenic
1172641322 20:36442096-36442118 CTGGAGATACAGATTAGGGATGG - Intronic
1173406358 20:42769335-42769357 GTGGAGAGACAGCTAGGCAAAGG + Intronic
1173493859 20:43504907-43504929 ATGGGGAAACAGAAGGGGAATGG - Intergenic
1173577794 20:44124208-44124230 CTGGGAGGAGAGATGGGGAAAGG - Intronic
1173939995 20:46902581-46902603 CAGGGCAGACAGATGGAGAAAGG - Intronic
1174289268 20:49496212-49496234 GTGGAAAGACAGATGGTGTACGG - Intergenic
1174503996 20:51004996-51005018 CTGGAGAGAGAGATGAGGAGCGG - Intronic
1175221207 20:57417525-57417547 ATGGAGAAATGGATGGGGAATGG + Intergenic
1175382676 20:58574641-58574663 ATGGAGAGATAGATGGAGGAAGG - Intergenic
1175440117 20:58984470-58984492 TTGGATAGACAGATGGGAGATGG + Intronic
1175895977 20:62335744-62335766 CTGGAGAGAGTGTTGGGGTACGG - Intronic
1176650654 21:9543915-9543937 GTGGAGGGAGGGATGGGGAAAGG + Intergenic
1178046749 21:28703363-28703385 CTGGCTGGACAGATGGGGAGGGG + Intergenic
1178360824 21:31947530-31947552 CTGGGGAGACAGGAGAGGAATGG - Intronic
1178421161 21:32444485-32444507 ATGAAGAGACACATAGGGAAAGG + Intronic
1178911491 21:36677780-36677802 CAGTAGAGTCTGATGGGGAATGG + Intergenic
1179145084 21:38760994-38761016 CTGGAGTGAAAGAAGGAGAAAGG - Intergenic
1179154483 21:38838257-38838279 CTGCAGAGACAGTTGGAGCATGG - Intergenic
1179438073 21:41375593-41375615 CTGGAGACACACAGGGAGAAGGG - Intronic
1179538473 21:42067987-42068009 AGGGAGAGAGAGATGGGGGAGGG + Intronic
1179541138 21:42083873-42083895 CTGGAAGGACAGATGGGCAGAGG + Intronic
1179621559 21:42619808-42619830 CTGGAGAGCCAGCTGAGGAAAGG - Intergenic
1180081860 21:45490813-45490835 CTGGAGAGACAGGAAGGAAATGG - Intronic
1180231752 21:46430556-46430578 CTGGAGAGTGAGCAGGGGAAGGG + Exonic
1180465065 22:15603517-15603539 ATGGAGAGAGAGATGGTGAGAGG + Intergenic
1180649939 22:17369451-17369473 CCGGAGAAACAGATGGGGCTAGG - Exonic
1180814489 22:18781143-18781165 CTTGAGAGAGGCATGGGGAAGGG - Intergenic
1181200677 22:21215479-21215501 CTTGAGAGAGGCATGGGGAAGGG - Intronic
1181534327 22:23533903-23533925 CTGGAGAGAGAAAAGGGGAGAGG + Intergenic
1181701064 22:24621494-24621516 CTTGAGAGAGGCATGGGGAAGGG + Intronic
1182017051 22:27049467-27049489 CTGGTCTGATAGATGGGGAACGG - Intergenic
1182347826 22:29679208-29679230 CTGCAGAGTCAGATGGGTGAGGG - Intronic
1182380350 22:29882959-29882981 ATGGCTAGACAGATGGGAAATGG - Intergenic
1182739977 22:32560640-32560662 CAGGTCAGAAAGATGGGGAAGGG + Intronic
1182876360 22:33694707-33694729 GTGGAGAGACAGGAGGGGGAAGG + Intronic
1182910621 22:33981231-33981253 CAGGAGAGGCAGATGGGGCAGGG - Intergenic
1183445022 22:37847933-37847955 ATGCAGATACCGATGGGGAAGGG + Intronic
1183667671 22:39254794-39254816 CTGGAGAGAAAGCTGGGCCAAGG - Intergenic
1183711175 22:39504381-39504403 CGGGAGAGGCAGCTGGAGAAGGG + Exonic
1183902707 22:41018556-41018578 CTGAAGAGGCAGATGGGTAGTGG + Intergenic
1183941982 22:41301246-41301268 CTTTTGACACAGATGGGGAAGGG + Intergenic
1184094639 22:42309956-42309978 CTGGAGAGACAGGGCTGGAAGGG - Intronic
1184293036 22:43508463-43508485 ATGGATGGACAGATGGGGGATGG - Intergenic
1184362197 22:44025197-44025219 GTGGAAAGGCAGATGGAGAAAGG + Intronic
1184615618 22:45636227-45636249 CTGGAAGGTCAGATGGGGATGGG + Intergenic
1184643557 22:45884554-45884576 CTGCAGGGACAGCTTGGGAAGGG + Intergenic
1184674322 22:46032240-46032262 CAGGATTGACAGATGTGGAACGG + Intergenic
1185120219 22:48961834-48961856 CAGGAGAGAGAGAGAGGGAAGGG + Intergenic
1185375030 22:50478726-50478748 CTGGAGGGGCAGGTAGGGAAGGG - Intergenic
1203226240 22_KI270731v1_random:79956-79978 CTTGAGAGAGGCATGGGGAAGGG + Intergenic
1203264588 22_KI270734v1_random:6830-6852 CTTGAGAGAGGCATGGGGAAGGG - Intergenic
949136787 3:576862-576884 GGGGAGAGAGAGGTGGGGAAGGG + Intergenic
949167874 3:962626-962648 CTGCATGGAGAGATGGGGAAAGG - Intergenic
949458378 3:4263486-4263508 CTAGAGAGACAGATTGGGGCTGG - Intronic
949487955 3:4558695-4558717 CTGGAGAGGCATTTGGGAAAAGG + Intronic
949490968 3:4588652-4588674 CTTGGGAGACAGATGGGCACTGG - Intronic
949906734 3:8864220-8864242 CTGTGGAGAGAGAGGGGGAAGGG - Intronic
950039519 3:9911024-9911046 CTCGAGAGTCAGATGGGGTGAGG + Exonic
950403755 3:12791437-12791459 TTGGAGATACAGATGGGGGAAGG - Intergenic
951362655 3:21742774-21742796 CTGAAAAGCCACATGGGGAATGG - Intronic
951740502 3:25917058-25917080 CTGGTGACACTGAAGGGGAAGGG - Intergenic
952376002 3:32767934-32767956 TGGGAGAGACAGATGGGGTCAGG + Intronic
952504818 3:33998300-33998322 CAGGAGAGCAAGATGTGGAAGGG + Intergenic
952833780 3:37587533-37587555 ATGGAGAGATAAATGGTGAATGG - Intronic
952861456 3:37816125-37816147 CTGGAGAGTCACATGGTAAAGGG + Intronic
952944785 3:38472132-38472154 CTGAAGAGACAGATGGGGCCAGG - Intronic
952952472 3:38536283-38536305 CTGGAGAGCTAGAGGGGGAGAGG - Intronic
953048130 3:39314225-39314247 AAGGAAAGACAGATAGGGAAAGG + Intergenic
953335364 3:42089706-42089728 CAGGAAAGGGAGATGGGGAAAGG - Intronic
953849814 3:46456921-46456943 TTCCACAGACAGATGGGGAATGG + Intronic
954197020 3:49002958-49002980 CTGGAGAGATGGATGGAGCAGGG - Intronic
954995222 3:54875173-54875195 CTGGAGAGACACTCTGGGAAGGG - Intronic
955380680 3:58435425-58435447 CTGGATGGATAGATGGGGTAAGG + Intergenic
955980030 3:64515515-64515537 TTCTAGAGACAGATGGGGATGGG - Intergenic
956623597 3:71245567-71245589 CTTCAGAGAAAGATGGGGAGGGG - Intronic
956781746 3:72608737-72608759 CTGAAGAGACTGATGGAGAGGGG + Intergenic
956890081 3:73604732-73604754 CTGGAGAGAAAGAGGGAGATAGG + Intronic
957296126 3:78335190-78335212 CTGCAAAGACAGATGGGTAATGG - Intergenic
957404427 3:79758746-79758768 CTTAGGAGACAGGTGGGGAAAGG + Intronic
959204776 3:103292458-103292480 ATTCAGAGACAGATGGGGGAAGG + Intergenic
959259445 3:104056511-104056533 CTGGTGAGGAAGTTGGGGAAAGG + Intergenic
959788274 3:110327910-110327932 CAAGAGAGACAGAGAGGGAAGGG - Intergenic
960236067 3:115283662-115283684 CTGGTGAGAAAGATGAGCAATGG - Intergenic
961061814 3:123834955-123834977 CTGGACAGAGAGCTGGGCAATGG + Intronic
961387362 3:126530122-126530144 ATGGAGGGACAGATGGGCACAGG - Intronic
961826240 3:129600624-129600646 CTGGAGAAACAGATAGGGCTTGG - Intronic
962329569 3:134465416-134465438 CTGGAAAGAGAGAGAGGGAAAGG - Intergenic
962456511 3:135570209-135570231 CTGGAGAGGGAGGTGAGGAATGG - Intergenic
963932456 3:151017785-151017807 GGGGAAAGACAGAAGGGGAAAGG - Intergenic
964155692 3:153582451-153582473 TGGGTGAGACAGAAGGGGAATGG - Intergenic
964278828 3:155039095-155039117 ATGCAGAGACAAATGAGGAAGGG + Intronic
964346966 3:155763684-155763706 CTGGAGAGAAATATGGAAAAAGG - Exonic
965263237 3:166510341-166510363 CCTGAGAGCCACATGGGGAAGGG + Intergenic
965817872 3:172655513-172655535 AAGGAGAGAGAGTTGGGGAAAGG + Intronic
967050585 3:185780214-185780236 CTGGAAAGACAGATAATGAAAGG + Intronic
967052227 3:185795343-185795365 CTGGAGAAACAAATGTGGTATGG - Intronic
967081026 3:186049597-186049619 CTGGAGACGCAGAGGGGGAAGGG + Intronic
968142198 3:196267357-196267379 CTGGAGAGACTGGGGGGAAATGG + Intronic
968580086 4:1385704-1385726 CTTCAGAGACAGATGGGCGACGG - Intronic
968928105 4:3560607-3560629 GTGGATGGACAGATGGGGAATGG - Intergenic
969203020 4:5621058-5621080 CAGAAGAGAGAGATGGGAAAGGG + Intronic
969500685 4:7550857-7550879 CGGGTGAGACAGATGGAAAAAGG - Intronic
969525547 4:7702220-7702242 CCTGGGAGACAGATGGGCAAGGG + Intronic
969571386 4:8010741-8010763 ATGGAGAGGCAGAGGGGGCAGGG + Intronic
969709817 4:8836269-8836291 CAGGAAACACAGGTGGGGAATGG - Intergenic
970273164 4:14368493-14368515 ATGGAGAGCCAGAAGGGGGATGG + Intergenic
970659069 4:18264251-18264273 CTGGAGACACAGAGAGTGAAGGG + Intergenic
971213714 4:24644331-24644353 CAGGAGAGAGAGAGAGGGAAGGG - Intergenic
971229653 4:24790787-24790809 TTGGAGAGACATATGTGCAAGGG - Intronic
971853086 4:32009950-32009972 CCTGAGAGCCACATGGGGAAGGG + Intergenic
972366004 4:38375063-38375085 CTGGAGGTTCAGTTGGGGAAAGG - Intergenic
974832567 4:67207483-67207505 CTGGACATACAGATTTGGAAGGG - Intergenic
975201557 4:71596249-71596271 TTGGAGAGAGAGAAAGGGAAGGG + Intergenic
975314728 4:72938692-72938714 CTAGAGGGACAGATGGGAAGGGG - Intergenic
975905354 4:79204716-79204738 CTGGAGACTCAGAAGGGGAGTGG - Intergenic
976171927 4:82313263-82313285 TTGGAGACTCAGAAGGGGAAGGG + Intergenic
976180548 4:82394889-82394911 ATGAAGAGACACATGGGGAGAGG + Intergenic
977292924 4:95182516-95182538 GAGGAGAGACAGATGGAGGATGG + Intronic
977459610 4:97308951-97308973 CAGGGGAGAGAGAAGGGGAAGGG - Intronic
977707636 4:100088998-100089020 CTGGAGACTCAGAACGGGAAGGG - Intergenic
978069081 4:104444005-104444027 GTGGAGAGATAGAAGGGGCAAGG - Intergenic
978502155 4:109421031-109421053 CAGGAGAGACAGAGAGTGAAGGG + Intergenic
978553279 4:109950742-109950764 GAGGAGAGACAGCTGGTGAAGGG - Intronic
979398989 4:120224497-120224519 CTGGACAAACAGATGGGGCGGGG - Intergenic
980050206 4:128032295-128032317 TTGAAGTGACTGATGGGGAATGG - Intronic
980744743 4:136999719-136999741 CTTGAGAGCCACATGGGGCAGGG - Intergenic
981631773 4:146827169-146827191 CCTGAGAGCCACATGGGGAAGGG - Intronic
982765029 4:159336328-159336350 TTGGAGACTCAGAAGGGGAAGGG - Intronic
983504086 4:168533684-168533706 CTGGAGAGATAGCTGGGCCATGG + Intronic
983517707 4:168674937-168674959 GAGGAGAGTAAGATGGGGAAAGG + Intronic
983739974 4:171118055-171118077 CTGGAAAGACAGATGTGACATGG + Intergenic
984190218 4:176596614-176596636 CTGGAGAGAGGGATAGGGGAAGG - Intergenic
984594945 4:181656201-181656223 CTGCAGAGGAAGATGGGAAATGG + Intergenic
984881443 4:184413166-184413188 CAGGAGAGACTGCTGTGGAAAGG - Intronic
985356630 4:189126764-189126786 CTGGAGAGAGAGAGAGTGAAGGG + Intergenic
985497025 5:214524-214546 ACGGAGAGAGAGATGGGGAAAGG + Intronic
985738544 5:1600434-1600456 ACGGAGAGAGAGACGGGGAAAGG - Intergenic
985767174 5:1786211-1786233 CTGGGGGGTCAGATGGGGCAGGG - Intergenic
985961893 5:3308849-3308871 CTTGAGAGACAAAGGGGAAAGGG - Intergenic
985985596 5:3513461-3513483 CGGGAGAGGCAGAAGGAGAAGGG + Intergenic
988059417 5:26148453-26148475 CCTGAGAGCCACATGGGGAAGGG + Intergenic
988205339 5:28126516-28126538 ATGGAGAGCCAGAAGGGGGATGG - Intergenic
988261536 5:28892551-28892573 ATGGAGACACAGACGGGAAAGGG + Intergenic
988707846 5:33743154-33743176 CTGGAGAGGCAGAAAAGGAAGGG + Intronic
988835535 5:35028772-35028794 GTGCAGAGAAAGATGTGGAAGGG + Intronic
989091951 5:37743181-37743203 CTTGAGAGCCACACGGGGAAGGG + Intronic
989162223 5:38402320-38402342 CAAGGCAGACAGATGGGGAATGG - Intronic
990229401 5:53695361-53695383 CAAGAGAGACAGTTGGGGAGAGG - Intergenic
991325173 5:65423154-65423176 CTGGAGATTCAGAAGGGGGAAGG + Intronic
992180561 5:74193263-74193285 AAGGAGAGACAGAGGTGGAAGGG + Intergenic
993332495 5:86617926-86617948 CTGAAAAGAAAGATGGGAAATGG - Intronic
993716319 5:91278806-91278828 CTGGAGAGGCTGAGGCGGAAGGG + Intergenic
995002927 5:107157668-107157690 CCTGAGAGCCACATGGGGAAGGG + Intergenic
995111077 5:108429039-108429061 CCTGAGAGCCATATGGGGAAGGG - Intergenic
995178065 5:109201433-109201455 CAGGAGCTAGAGATGGGGAAGGG + Intergenic
995500068 5:112794906-112794928 ATGAAGAGACATATGGGGCAAGG + Intronic
995680985 5:114718965-114718987 ATGGAGAGACAGATGAGGTGAGG - Intergenic
995729573 5:115223549-115223571 CTGGAGACACTGTTGGCGAAAGG + Intronic
996618556 5:125471660-125471682 CTGGTGAGGGAGTTGGGGAAAGG - Intergenic
996922628 5:128786792-128786814 CTGGAGAGAAAGATGATGTAAGG + Intronic
997022239 5:130015168-130015190 CAGGAGAGACAGAAAGTGAAGGG - Intronic
997690605 5:135825413-135825435 CTGCAGAGACAGAGGAGGCAAGG + Intergenic
997796564 5:136816805-136816827 CAGGGGAGGCAGATGTGGAAGGG - Intergenic
997893963 5:137699353-137699375 CTGGAGAGGTAGATGGGGCCAGG + Intronic
998594580 5:143515571-143515593 GGAGAGAGAGAGATGGGGAAAGG - Intergenic
998672392 5:144368412-144368434 ATGGAGAGAGACATGGGAAAAGG + Intronic
999068544 5:148717497-148717519 CAGGAGAGGCAGAAGGTGAAGGG - Intergenic
999089416 5:148922314-148922336 CTACAGAGACAGAGGAGGAAAGG - Intergenic
999620568 5:153468427-153468449 CTGGAGAGAATGAAGGGGAAAGG - Intergenic
1000122675 5:158212202-158212224 GGGCAGAGAGAGATGGGGAAAGG + Intergenic
1000333387 5:160223745-160223767 AGGGAAAGAGAGATGGGGAATGG - Intronic
1000801349 5:165730383-165730405 CTGAGGAGACAGAAGAGGAAGGG - Intergenic
1001172476 5:169433451-169433473 CCAGAGAGACAGATTGGCAAGGG + Intergenic
1001651675 5:173320334-173320356 CTGGAGAGAGAGAGGGCCAAGGG - Intronic
1002195114 5:177497159-177497181 CTGTGGAGACAGATGGGGGCTGG + Intronic
1002475712 5:179464583-179464605 ATGGGGAGCCAGAAGGGGAATGG + Intergenic
1002755527 6:156129-156151 CTTGAGGGACAGATGTGCAAAGG + Intergenic
1002887537 6:1310598-1310620 CTCGGGAGCCAGGTGGGGAATGG - Intergenic
1003015175 6:2462316-2462338 CTGGTGAGAAAGCTGAGGAAGGG + Intergenic
1003116253 6:3285621-3285643 CTGGAAGGGCAGCTGGGGAACGG + Intronic
1003320755 6:5049058-5049080 CTGCAGAGGAAGATTGGGAAAGG + Intergenic
1003497062 6:6673422-6673444 CTAGACAGACAGATGGGGCAGGG - Intergenic
1004257081 6:14074294-14074316 CAGGAGAGACAGATTGTGAGAGG - Intergenic
1004496888 6:16172878-16172900 ATGGAGAGACAGAAGAGAAAAGG - Intergenic
1004679009 6:17874223-17874245 CTGCAGAGACAGAAGGGGAAAGG - Intronic
1005322000 6:24664749-24664771 CAAGAGAGAAAAATGGGGAAGGG - Intronic
1005913124 6:30327613-30327635 GTGGTGAGAGAAATGGGGAAAGG - Intronic
1006302710 6:33202129-33202151 AGGAAGAGACAGATGGGGATGGG + Intronic
1006443050 6:34063838-34063860 CTGGGGAGACAGATGGACAGAGG + Intronic
1006902194 6:37510469-37510491 CTGGAGAGACAGATGTGCCTGGG + Intergenic
1007116727 6:39348312-39348334 ATGGAGAGATGGATGGGGCAGGG + Intronic
1008392937 6:50973813-50973835 CTGAAGAGAGAGACTGGGAAAGG - Intergenic
1008487583 6:52052458-52052480 CTGGAGAGACAGAAAGGACAAGG + Intronic
1008902701 6:56640340-56640362 CTGGAGTGACAGATGGAGTCAGG + Exonic
1009180032 6:60506298-60506320 CTGGAGAGAGAGAAGAGGTAGGG + Intergenic
1010073603 6:71773390-71773412 TTGGAGAAGCAGAAGGGGAAAGG - Intergenic
1010155086 6:72783181-72783203 CTGTAGAGAGAGATGGTGGAGGG + Intronic
1010678326 6:78769789-78769811 GTGGAGTGGCAGAGGGGGAAAGG + Intergenic
1010700090 6:79033935-79033957 AAGGAGAGAAAAATGGGGAAGGG + Intronic
1011308188 6:85952511-85952533 CGGGAGACACAGAAGGGGAAGGG - Intergenic
1011336109 6:86261410-86261432 TTGGAGGGAGAGCTGGGGAATGG - Intergenic
1011869663 6:91876925-91876947 AAGGAGAGAAAGATGGGAAAAGG - Intergenic
1012535191 6:100287570-100287592 TTGGAGAGGCAGCTGGGGAAGGG + Intergenic
1013489261 6:110629397-110629419 GTGGAGTGACAGTTGGGGAGGGG - Intronic
1013675100 6:112450635-112450657 CTGGAAAGAGGAATGGGGAAGGG - Intergenic
1013830817 6:114270591-114270613 CTGTAGAGACAGCTCTGGAATGG + Intronic
1014419847 6:121229941-121229963 CTGGAGAGAGAGAGAGTGAAGGG - Intronic
1015052941 6:128863720-128863742 CTGCAGGGAGAGATGGGGAGGGG + Intergenic
1015102670 6:129499923-129499945 TTGGAGAGACAGAGGGGGGCAGG + Intronic
1015335110 6:132028003-132028025 CGGAAGAGAGAGATGAGGAAGGG + Intergenic
1015431701 6:133138394-133138416 TGGGAGAGAGAGAAGGGGAAAGG - Intergenic
1015469800 6:133591128-133591150 GTAGTCAGACAGATGGGGAAAGG - Intergenic
1015680979 6:135808138-135808160 CTGGAGAGACAGAGGGTGACTGG - Intergenic
1016300222 6:142622302-142622324 CCAGAGAGACAGATGGAGACTGG + Intergenic
1016693040 6:146961360-146961382 CTGGAGACTCAGAAGGGTAAGGG + Intergenic
1016727281 6:147387906-147387928 CTGGGGAGACAGCTGAGGAAAGG + Intergenic
1016739883 6:147515545-147515567 ATGGAGAGATGGATGGGTAAAGG - Intronic
1017454946 6:154593261-154593283 CTGGGGAGAGAGCTGGGGGAGGG - Intergenic
1017702676 6:157090872-157090894 CTGGAGAGGGAGAAGGGGAGGGG - Intronic
1018347817 6:162921206-162921228 CAGGAGAGACAGAGTGGGGAGGG + Intronic
1018366618 6:163126963-163126985 CTGGGGTGAGAGATGGGGAGGGG - Intronic
1018500870 6:164410048-164410070 CTGAAGAGACTGAAGGGAAACGG - Intergenic
1018632787 6:165835101-165835123 GTGCAGAGAGAGGTGGGGAAGGG + Intronic
1018748388 6:166780358-166780380 ATGGGGAGAGAGATGGGGGAAGG + Intronic
1018933448 6:168257694-168257716 CATGAGAGACAAATGGGGAATGG - Intergenic
1018953750 6:168394592-168394614 ATGGAGAGAGAGATGGGGGAAGG + Intergenic
1019113619 6:169738539-169738561 CCTGAGAGCCACATGGGGAAGGG - Intergenic
1019480760 7:1265657-1265679 TTGGAGAGACAGATTGTGTATGG + Intergenic
1019834639 7:3370674-3370696 CTGGTGAAACAGATTGCGAATGG + Intronic
1020476800 7:8605234-8605256 CTGGAATGCCAGTTGGGGAATGG + Intronic
1020838522 7:13184948-13184970 CAGGAGAGAGAGAGGGGGATTGG - Intergenic
1021298589 7:18941236-18941258 CTGGAGAGAGGGAGGGAGAAAGG - Intronic
1021775735 7:24053564-24053586 CTGAAGAAAGAGATGGGTAAAGG - Intergenic
1022215539 7:28257147-28257169 CTGGTGAGAGAGATGAGAAAAGG - Intergenic
1022615012 7:31920354-31920376 CTGGAGAGACAGGAGCAGAATGG - Intronic
1023087078 7:36581503-36581525 TTGGAAAAACAGATGGGAAATGG + Intronic
1023740749 7:43278621-43278643 GTGGAGAGAGAGGAGGGGAAGGG - Intronic
1023869608 7:44255980-44256002 CTGGACAGAAAAATGGGGAAAGG - Intronic
1023956073 7:44887635-44887657 ATGGAGGGACAGATTGGAAAGGG + Intergenic
1024015512 7:45311214-45311236 CTGGGGACAGAGATGGGGATTGG + Intergenic
1025120088 7:56294529-56294551 ATGGAGAGACAGATGGATAAAGG + Intergenic
1025277333 7:57594873-57594895 GTGGAGGGAGGGATGGGGAAGGG + Intergenic
1026336652 7:69399454-69399476 CAGAAGGGATAGATGGGGAAAGG - Intergenic
1026494106 7:70887993-70888015 GTGGAGGGACAGATTGGGAAAGG + Intergenic
1026494114 7:70888023-70888045 AGGGATAGAGAGATGGGGAAAGG + Intergenic
1026742250 7:72986186-72986208 CAGGAAAGGCAGATGGGGGAGGG - Intergenic
1026802098 7:73406606-73406628 CAGGAAAGGCAGATGGGGGAAGG - Intergenic
1026921961 7:74162345-74162367 CTGCAGAGACAGAGGGGCACTGG + Intergenic
1027028374 7:74870925-74870947 CAGGAAAGGCAGATGGGGGAAGG - Intergenic
1027101485 7:75378892-75378914 CAGGAAAGGCAGATGGGGGAGGG + Intergenic
1027122459 7:75531708-75531730 GGGGAGACACAGATTGGGAAAGG - Intergenic
1027210047 7:76139088-76139110 CTGGAGAGGGAGATAGGAAAGGG - Intergenic
1027267235 7:76501132-76501154 CTGGAGATACTGTTGGGGGAGGG + Intronic
1027781918 7:82530650-82530672 CAGGAGAGACAAGTGGGGAGGGG - Intergenic
1028371719 7:90099923-90099945 CTGCTGAGATAGATGGGCAACGG + Intergenic
1028584645 7:92440551-92440573 CTGGGGGGTCAAATGGGGAAGGG - Intergenic
1028927769 7:96378165-96378187 CAGGAGAGACAGAGAGGGAGAGG + Intergenic
1029067782 7:97869479-97869501 ATGCAGAGACAGATGTGGCATGG - Intronic
1029067963 7:97871768-97871790 CTACAGAGACAGGTGGGGACTGG + Exonic
1029361975 7:100094367-100094389 CAGAAGAGGGAGATGGGGAAGGG + Intronic
1029453892 7:100657459-100657481 GAAGAGAGACAGATGGAGAAAGG - Intergenic
1029928469 7:104344418-104344440 TTGGAGATTCAGAAGGGGAAGGG - Intronic
1030426930 7:109389800-109389822 CAGGAGAGACTCAAGGGGAATGG + Intergenic
1030516548 7:110545300-110545322 CAGGAGAGAGAGATGGGGAGGGG - Intergenic
1031334504 7:120510994-120511016 AGAGAGAGAGAGATGGGGAAAGG - Intronic
1031356595 7:120794473-120794495 CCGGAGAGAGAGATGGGGGGTGG - Intronic
1031970140 7:128058871-128058893 CTGCTGAGACAGATCGGGGATGG - Intronic
1032418648 7:131759490-131759512 CTGGAGAAAGAGCAGGGGAAAGG - Intergenic
1032625124 7:133583689-133583711 CTGAAGGGAGAGATGGGGAAAGG + Intronic
1032863780 7:135905729-135905751 TTGGAGATGCAGATGGGGATTGG + Intergenic
1033239096 7:139662559-139662581 CAGGAGAGACAGCTAGGGACAGG - Intronic
1033524056 7:142192732-142192754 CTGAAGAGAAAGATGGCGATGGG - Intronic
1034234626 7:149557100-149557122 CCCCAGAAACAGATGGGGAATGG + Intergenic
1034239406 7:149598332-149598354 CCCCAGAAACAGATGGGGAATGG + Intergenic
1034263825 7:149772306-149772328 CTGGGGAGACAGAGGGGGAAGGG - Intronic
1034406115 7:150903471-150903493 ATGGAGAGAGAGATGGAGAGAGG - Intergenic
1034918858 7:155062369-155062391 CTGGAGAAAGAGCTAGGGAAGGG + Intergenic
1034931301 7:155166005-155166027 CTGGGGAGCCAGAAGGGGGATGG - Intergenic
1035049530 7:155990509-155990531 CTGGAGGAGCAGCTGGGGAAGGG + Intergenic
1035421219 7:158730205-158730227 ATGGACAGACAGATGGACAAAGG + Intergenic
1036009140 8:4701432-4701454 CTGGAGAGTCTGATGGGGAGGGG + Intronic
1036044084 8:5120198-5120220 CTGGAGAGACAGAGAAGGAATGG + Intergenic
1036125976 8:6062270-6062292 CTGGAGACACAGAAAGAGAAAGG + Intergenic
1036222999 8:6936672-6936694 CTAGAGAGACGGATGGGAGATGG - Intronic
1036576805 8:10035152-10035174 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1037917453 8:22781290-22781312 CGGGAGAGCCGGAGGGGGAAGGG + Intronic
1038017970 8:23530538-23530560 CTGGAGGGACATATGGGTGATGG - Intronic
1038578022 8:28722119-28722141 CTGGAGGGATGTATGGGGAATGG + Intronic
1038740952 8:30216140-30216162 CTGTAGAGACAGAGGAGGGAGGG - Intergenic
1039419152 8:37421186-37421208 CTGCAGAGCCAGATGGGGAGGGG - Intergenic
1039550494 8:38439712-38439734 TTGGAGAGAGAGAAGGAGAAAGG - Intronic
1039815875 8:41094038-41094060 CTGGAGAGAGAGAAGGGAAGCGG - Intergenic
1039979273 8:42392395-42392417 CAGGAGACGCAGACGGGGAAAGG - Intronic
1040352964 8:46587029-46587051 CTGGTGAGACAGAAGGTGTAAGG - Intergenic
1041653308 8:60322623-60322645 GTGGAGAGACCCATGTGGAAAGG - Intergenic
1041741148 8:61158311-61158333 CTGGAGGAACAGACTGGGAAGGG + Intronic
1042281801 8:67064070-67064092 CTGGAAAGAAAAATGGGGAGGGG - Intronic
1042849788 8:73205196-73205218 GAGGTGAGAAAGATGGGGAAGGG - Intergenic
1043147230 8:76673836-76673858 CAGGAGAGAGAAATGGGGGAGGG + Intergenic
1043367596 8:79553275-79553297 TTGGAGACTCAGAAGGGGAAGGG + Intergenic
1044295287 8:90519806-90519828 CAGGAGAGACAGAGGGTGAAGGG - Intergenic
1045499873 8:102737023-102737045 CTGGGGTGACAGATGGGCATTGG - Intergenic
1045790644 8:105978941-105978963 CTGGATGGGCAAATGGGGAAGGG + Intergenic
1046564199 8:115877896-115877918 ATGGAGAGAGAGTGGGGGAAAGG + Intergenic
1046857778 8:119053618-119053640 CTGGAGACACAAATGGAGAATGG - Intronic
1047753511 8:127900409-127900431 ATGAAGAGAAGGATGGGGAATGG - Intergenic
1048707769 8:137173295-137173317 CTGGAGACACATATGGAAAAGGG - Intergenic
1048773287 8:137918841-137918863 CAGGAGAGAGAGAAGGAGAAGGG - Intergenic
1048936517 8:139362149-139362171 CTGGAGACAGCCATGGGGAAGGG + Intergenic
1049155314 8:141062628-141062650 GTAGATAGACAGATGGGGGAGGG + Intergenic
1049364272 8:142229175-142229197 ATGGATGGACAGATGGTGAATGG + Intronic
1049464907 8:142746690-142746712 GTGGATAGATAGATGGGGGATGG + Intergenic
1049503130 8:142978725-142978747 CTGGAGAGACAGAGGGGACATGG + Intergenic
1049938525 9:522647-522669 CTGCAGGGACAGATCTGGAAGGG + Intronic
1049971590 9:826570-826592 CTGGAGAGCGGGGTGGGGAAGGG - Intergenic
1050262986 9:3860604-3860626 CAGGAGAAGCAGATGGGCAAAGG + Intronic
1051013755 9:12450367-12450389 GTGGAGAGACCCATGTGGAAAGG - Intergenic
1051507959 9:17846201-17846223 CTGCAGAAAGAGAGGGGGAAAGG - Intergenic
1051600038 9:18863396-18863418 GTGAAGAGACATTTGGGGAATGG + Intronic
1051887167 9:21905266-21905288 GTGGTGAGCCAGAAGGGGAATGG + Intronic
1052375440 9:27713419-27713441 ATGGAGAGGCAGGTGGTGAAGGG + Intergenic
1053180722 9:35966780-35966802 CAGGGGTTACAGATGGGGAAGGG - Intergenic
1053184766 9:36006218-36006240 TTGGAGAGACAAATGTGGCAAGG + Intergenic
1053302421 9:36961379-36961401 ACAGAGAGACAGCTGGGGAAGGG - Intronic
1053487411 9:38470431-38470453 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1053525064 9:38820818-38820840 TTGGAGACTCAGAAGGGGAAGGG - Intergenic
1054197295 9:62045240-62045262 TTGGAGACTCAGAAGGGGAAGGG - Intergenic
1054462037 9:65470548-65470570 GTGGATTGAGAGATGGGGAATGG + Intergenic
1054641114 9:67543442-67543464 TTGGAGACTCAGAAGGGGAAGGG + Intergenic
1054743088 9:68828200-68828222 CAGGAGAAACAGAAGAGGAAGGG - Intronic
1054862988 9:69972250-69972272 CAGGAGTAACAGAGGGGGAAGGG - Intergenic
1055361580 9:75496741-75496763 CTGGAGAGAGACAAGGGCAAAGG - Intergenic
1055427354 9:76210165-76210187 CAGGAGAGTCAGATAGGGAAGGG + Intronic
1056276980 9:85002970-85002992 TTGGAGAAACAGTTGGGGGACGG + Intronic
1057711952 9:97453556-97453578 CCTGAGAGCCACATGGGGAAGGG + Intronic
1057999741 9:99852837-99852859 CTGGAAAGACAGATGGTGGAGGG - Intronic
1059212224 9:112524061-112524083 GTGGAGATATAGATGGGAAATGG - Intronic
1059620533 9:116000056-116000078 CTAGAGTGATAGATGGGGACCGG + Intergenic
1059740216 9:117142854-117142876 CTGGAGACACAGATGGAGGGAGG - Intronic
1060104819 9:120866966-120866988 CTGGAGAGACAGAGGAGCCAAGG + Intronic
1060110989 9:120906050-120906072 CTGGGGAAACAGGTGGGGCAGGG - Intronic
1061238829 9:129357666-129357688 GTGGGGAGACGGAGGGGGAAGGG - Intergenic
1061888635 9:133606071-133606093 CTGGAGAGTCAGGTGGGGTCCGG - Intergenic
1062104065 9:134743140-134743162 TTGGAGAGGCACACGGGGAAGGG - Intronic
1062137586 9:134937973-134937995 TTGGAGAGGCAGAGGGGGAAAGG - Intergenic
1062453000 9:136623348-136623370 CTGGAGAGAAGGAAGGAGAAAGG - Intergenic
1203628393 Un_KI270750v1:47468-47490 GTGGAGGGAGGGATGGGGAAAGG + Intergenic
1186230155 X:7445077-7445099 CTGTGGTGACAGAAGGGGAAGGG - Intergenic
1186427810 X:9478002-9478024 CAGGAGAGGAAGGTGGGGAAAGG + Intronic
1186524741 X:10238212-10238234 CTGGGGGTACAGCTGGGGAAAGG + Intergenic
1186898559 X:14029835-14029857 TTGGAGAGACAGAGGGGGAGTGG + Exonic
1187281213 X:17860104-17860126 ATGGAGAGAGGGATGGGGCACGG - Intronic
1188079231 X:25815553-25815575 CAGGGGAGAGAGAGGGGGAAGGG - Intergenic
1188422657 X:30008612-30008634 CTGGAGAGAAAGGGAGGGAAGGG + Intergenic
1188640792 X:32501754-32501776 CTGGTGGAACAGATGGTGAATGG - Exonic
1188821786 X:34784979-34785001 CTGGAGACAGAGATAGGGAAAGG + Intergenic
1189379388 X:40491056-40491078 CTGGAGGGAGACTTGGGGAAAGG + Intergenic
1189424101 X:40882610-40882632 CTTCAGGTACAGATGGGGAAAGG + Intergenic
1189729560 X:44004712-44004734 CTGGAGAGAGAAGGGGGGAAAGG + Intergenic
1190267596 X:48836533-48836555 AAGGAGAGACATATGGGGAGAGG - Intergenic
1190369951 X:49730975-49730997 CTAGAGATACAGCTGGGGCAGGG + Intergenic
1190702956 X:53001678-53001700 AGGGAGAAAAAGATGGGGAAGGG - Intergenic
1191673177 X:63768135-63768157 TTGGAGACTCAGAAGGGGAAGGG - Intronic
1192084057 X:68078073-68078095 CTGGAGAGAGAGAGAGAGAAGGG - Intronic
1192223449 X:69212740-69212762 CTGGAGGGCCTGGTGGGGAAGGG - Intergenic
1193048468 X:77077403-77077425 CTTGAGAACCACATGGGGAAGGG - Intergenic
1193239711 X:79153535-79153557 TTAGAGAGAGAGATGGGGAACGG + Intergenic
1193777045 X:85656367-85656389 CAGGAGAGAGAGATAGCGAAGGG - Intergenic
1194014304 X:88600235-88600257 CAGGAGAGACAGAGAGAGAATGG + Intergenic
1194461594 X:94176359-94176381 CAGGAGAGAAAGATAGTGAATGG + Intergenic
1194711175 X:97238068-97238090 CAGAAGAGACAGCAGGGGAAGGG + Intronic
1194740314 X:97564722-97564744 TTGCAGAAACAAATGGGGAAAGG + Intronic
1195303348 X:103554476-103554498 ATTGGGAGACAGATGGGAAAAGG - Intergenic
1195559639 X:106268963-106268985 GTGGTCAGACAGATGGGCAATGG + Intergenic
1195562322 X:106297376-106297398 GTGGTCAGACAGATGGGCAATGG - Intergenic
1196278160 X:113792883-113792905 CTGGACAGATAGCTGGGAAAAGG + Intergenic
1197043310 X:121966655-121966677 CTGAAGAGACAGAGGTAGAAAGG + Intergenic
1197046565 X:122004575-122004597 CCTGAGAGCCACATGGGGAAGGG - Intergenic
1197290715 X:124653899-124653921 CTTGAAAGACAGATGGGGTGGGG - Intronic
1197440112 X:126477130-126477152 CTGGAGAAAGAGAAGGTGAAGGG + Intergenic
1197761654 X:130032354-130032376 CTGGAGAGATCCATGGGGCAGGG - Intronic
1197878665 X:131140453-131140475 ATAGAGAGAGAGAAGGGGAAGGG + Intergenic
1198233104 X:134712263-134712285 CTGGGAAGTCAGATGGGGTATGG - Intronic
1198417189 X:136432612-136432634 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1199110821 X:143931843-143931865 TTGGAGATTCAGAAGGGGAAGGG - Intergenic
1199684971 X:150257643-150257665 CTGGAGAACAAGATGGAGAAGGG - Intergenic
1199894243 X:152116501-152116523 CTGGAGTGACAGCAGGGGCAGGG + Intergenic
1200310955 X:155076672-155076694 CAGGAGAGACACCTGGTGAAAGG - Intronic
1200353995 X:155528489-155528511 CTGGAGACTCAGAAGGGGAGAGG - Intronic
1200371714 X:155733017-155733039 GTGGGGAGAGAGAAGGGGAATGG + Intergenic