ID: 1151923513

View in Genome Browser
Species Human (GRCh38)
Location 17:77175701-77175723
Sequence TCCCTGTGTTGAGGGAGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 4, 1: 24, 2: 41, 3: 41, 4: 218}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151923513 Original CRISPR TCCCTGTGTTGAGGGAGTGC TGG Intronic
900002936 1:24932-24954 GCCCTGTGGTGGGGGCGTGCCGG - Intergenic
900022657 1:195457-195479 GCCCTGTGGTGGGGGCGTGCCGG - Intergenic
901020411 1:6252472-6252494 TCCCTGTGCAGATGGAGGGCAGG - Intronic
901652777 1:10752538-10752560 TCCCTGTACTGTGGGAGTGGAGG + Intronic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
902806248 1:18863105-18863127 GACCTGAGTTGAGGGAGGGCAGG - Intronic
904889050 1:33764256-33764278 TGCCAGAGTTGAGGGAGTCCAGG - Intronic
910636091 1:89409629-89409651 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
911762275 1:101630130-101630152 TCCCTGAGTTCAGGGAATACAGG + Intergenic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
914927950 1:151905650-151905672 TCCTTTTGTTGAGGGAGTGCTGG - Intronic
915054964 1:153119856-153119878 TCCCTGTGTTGAAAGAGTGCTGG + Intergenic
915268618 1:154735817-154735839 GCCCTGTGCTGAGGCAGTGGTGG + Intronic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
916490697 1:165299896-165299918 TCCCTGTCTTGGGGGAGGTCAGG - Intronic
916527883 1:165628825-165628847 TCCCTATGTGGAGGGAGTGCTGG + Intergenic
918323293 1:183384938-183384960 TCCCAGTGTTTTGGGAGTCCAGG + Intronic
918453285 1:184681569-184681591 TTCCTGTGTTGAGGGAAGTCAGG - Intergenic
918612728 1:186511673-186511695 CCCCTGTGTTGCGGGTCTGCTGG + Intergenic
919058961 1:192606808-192606830 TCCCTGTGATGAGACAATGCTGG + Intergenic
923664979 1:235991759-235991781 TCCCTGTGGGCAGGGAGTTCAGG - Intronic
1063506511 10:6605052-6605074 ACCCTGGGTTGCGGGAGTGGGGG + Intergenic
1064104523 10:12489959-12489981 TCCCTGGCTTGAGGGAGCGTGGG + Intronic
1067296859 10:44979663-44979685 CCCCTGTGGTGAGGGCGCGCCGG + Intronic
1068389132 10:56370462-56370484 TCCTAATGTTAAGGGAGTGCTGG - Intergenic
1068661491 10:59627530-59627552 TCCCTGTGCTGTGGGATTACAGG + Intergenic
1070750086 10:78958899-78958921 TCTCTGTGTAGAGGCTGTGCTGG - Intergenic
1071275603 10:84051729-84051751 TGTGTGTGTTGAGGGGGTGCGGG - Intergenic
1073137026 10:101225796-101225818 GCCCTGTTTTCGGGGAGTGCAGG + Intergenic
1073390776 10:103174572-103174594 TTCTTTTTTTGAGGGAGTGCTGG - Intronic
1073803894 10:107074199-107074221 GCCCGGTGTTGGGGGAGTGCAGG - Intronic
1074278052 10:112023733-112023755 TCCCTGCATTGGGGCAGTGCTGG - Intergenic
1074448201 10:113537771-113537793 TGCCTGGGTTGAGGGAGGGCAGG - Intergenic
1074971381 10:118542292-118542314 TCCCTGGGATGATGGGGTGCTGG - Intergenic
1075161635 10:120029578-120029600 TCTCTCTGTTGAGGCAGGGCAGG - Intergenic
1075444196 10:122502561-122502583 TCCCTCTGTTGAGAGACTTCTGG + Intronic
1075618294 10:123907466-123907488 TCCCTGTGCTGCGGGAGGGTGGG - Intronic
1075717817 10:124567031-124567053 TCCCGGTGGAGAGGGAGGGCGGG + Intronic
1076836001 10:133021220-133021242 GCCCTGGGTTGAGGGAGGGCTGG + Intergenic
1077001109 11:322757-322779 TCCCTGTGTTAAGGGAGTGCTGG + Intronic
1077648106 11:3944450-3944472 TGCCTGTGTAGTGGGAGTGGAGG + Intronic
1079101006 11:17542458-17542480 TCCCTGTGTGCAGGCAGGGCAGG - Intronic
1079816964 11:25073398-25073420 TCCCTGTGTGGAGGAAGTGCTGG + Intronic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1082960885 11:58917796-58917818 TCCCTTTGTGGAGGGAATGCTGG + Intronic
1084538406 11:69772381-69772403 TCCCTGTGTTTAGGGAGCTTTGG - Exonic
1085276374 11:75302733-75302755 TCCCTGTGTTGAGTCACTACTGG - Intronic
1085336532 11:75701006-75701028 GCCCTGTGATGTTGGAGTGCTGG + Intergenic
1086536007 11:87847613-87847635 TCCCTGTGTGGAGTGAGTAGGGG + Intergenic
1087032212 11:93717008-93717030 TCCCTATGTTGAAGGAGTGCTGG + Intronic
1087812826 11:102626557-102626579 CCCATGTGTTGAGGGAGGGAGGG + Intergenic
1087871257 11:103295458-103295480 TCCCTAAGTTGAGGGAGTGCTGG - Intronic
1091102344 11:132886705-132886727 TCCCTGTGCTGGGGGAGTCGTGG + Intronic
1091191812 11:133701889-133701911 TTCCTGTGATGGGGAAGTGCTGG - Intergenic
1091376355 12:26995-27017 GCCCTGTGGTGGGGGCGTGCCGG - Intergenic
1091458101 12:623204-623226 TCACTGTCAGGAGGGAGTGCTGG - Intronic
1091545594 12:1499563-1499585 TCCCTGTGGACAGGGAGGGCTGG - Intergenic
1092436925 12:8456080-8456102 TCCCTGTGTTGAGAAGGTCCAGG - Exonic
1093548951 12:20383901-20383923 TCTCTGTGTTGAGTGAGAGTAGG + Intronic
1093815685 12:23543375-23543397 TTCCTGTTTTCAGGAAGTGCTGG - Exonic
1094070960 12:26412418-26412440 ATCCTGAGTTGAGGGTGTGCGGG + Intronic
1094348151 12:29494392-29494414 TACCTGTGTTGAGAGAGTGTTGG + Intronic
1094524560 12:31223025-31223047 TACCTGTGGTGAGTGGGTGCCGG - Intergenic
1094638655 12:32251673-32251695 TCCCTGTGTTAATGGAGTCTTGG + Intronic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1096567961 12:52496827-52496849 TCCCAGTGTGGAGGGAGGACAGG + Intergenic
1096810623 12:54167395-54167417 TCCCTGGGTTGTGGGGGAGCTGG - Intronic
1096840341 12:54376003-54376025 TATCTGTGTTGGGGGAATGCTGG - Intronic
1097101289 12:56591373-56591395 TCCTAGGGGTGAGGGAGTGCGGG + Exonic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1098405580 12:70122983-70123005 TCCCTCTGTGGATGGGGTGCTGG - Intergenic
1099799190 12:87435728-87435750 TTACTTTGTTGAGTGAGTGCTGG - Intergenic
1102397898 12:112602992-112603014 TTCCTGTGATGAGGGTGTGATGG + Intronic
1103380153 12:120487940-120487962 TCCCTATGTTGAGGGAGTACTGG + Intronic
1104630546 12:130397758-130397780 TCTCTGTCTCGAGGGAGTGCGGG + Exonic
1104722585 12:131053205-131053227 TCACTGTGATGACGGAGTGCAGG + Intronic
1107333237 13:39324516-39324538 GCCCTGTGTGGACGGAGTGAGGG - Intergenic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1108337790 13:49463826-49463848 TCTCTATGTTGAGGGAGTGCTGG + Intronic
1109404146 13:61875595-61875617 TCGCTATGTTGAGGGAATGCTGG + Intergenic
1109487402 13:63045043-63045065 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1109997975 13:70154684-70154706 TCTCTTTGTTGAGGGATTGCTGG - Intergenic
1111826241 13:93271340-93271362 TCACTGTCTTGGGGGAGGGCAGG - Intronic
1113987242 13:114328036-114328058 TGCCTCACTTGAGGGAGTGCTGG + Intergenic
1115632613 14:35260406-35260428 TCCTTATGTTGAGGGAGTACTGG - Intronic
1116395984 14:44449209-44449231 TCCTTATGTTGAGGGAGTGTTGG + Intergenic
1116599552 14:46902380-46902402 TCCCTGTAGTGAGGGAGGGAGGG - Intronic
1117477966 14:56116914-56116936 TCCCTTTAGTGAAGGAGTGCTGG + Intergenic
1117665596 14:58052914-58052936 TCCCTGAGATGAGAGAGAGCAGG - Intronic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1121320574 14:92989425-92989447 TCCCTGTCTTCAGGGACAGCAGG - Intronic
1122299262 14:100722814-100722836 TCCCTGTGTTGAGGGCTTACAGG - Intergenic
1122596390 14:102895905-102895927 TCTCCGTGTTGAGGGTGAGCAGG + Intronic
1122647539 14:103205378-103205400 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1123218635 14:106836579-106836601 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1123220007 14:106845812-106845834 TCCTTATGCTGAGGGAGTGCTGG + Intergenic
1123752901 15:23372558-23372580 TCCCGGTGTTTTGGGATTGCAGG - Intergenic
1125603678 15:40928551-40928573 TCCCTGAGGTGGGGGAGGGCGGG - Intergenic
1127627332 15:60793011-60793033 TCTCTCTTTTGAGGGAGTGGTGG - Intronic
1128600568 15:68992161-68992183 TCCTTATGTTGAGGGAGTGCTGG + Intronic
1129145281 15:73641488-73641510 TCCTTGTGTGGAGGGAGAACTGG - Intergenic
1129523931 15:76202304-76202326 TCTCTGGGTTTAGGGATTGCTGG - Intronic
1129641276 15:77381053-77381075 TCTCTGTGAAGAGGGAGAGCAGG - Intronic
1129981769 15:79878709-79878731 TCCCTATGTGGAGGGAGTGGTGG + Intronic
1131053930 15:89364663-89364685 TTGGTGAGTTGAGGGAGTGCAGG + Intergenic
1132668114 16:1091053-1091075 CCCCTGTGGGGAGGGAGTGGGGG + Intronic
1135743105 16:24993649-24993671 TCCCTGTTTCGTGGGTGTGCAGG + Intronic
1137526663 16:49242247-49242269 GCCCTGAGTTGGGGAAGTGCTGG - Intergenic
1137575140 16:49594384-49594406 TCCCTCTGTTGAGAGAGGCCTGG - Intronic
1139736212 16:68991113-68991135 TCCCTCTGTTGAGGCTGTGTTGG + Intronic
1141764939 16:86052020-86052042 TGCTTGTGTTGAGGGTGTGCAGG + Intergenic
1141839533 16:86565938-86565960 TCCCGGTCTTCTGGGAGTGCGGG + Intergenic
1143131269 17:4678994-4679016 TCCCTCTGTTGAGGGTGTTGAGG - Intronic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1145361109 17:22213165-22213187 TCCCAATGTTGAGGGAGTGCTGG - Intergenic
1145882846 17:28364682-28364704 TCCCTGGGTGGAGGGGATGCTGG - Intronic
1146387349 17:32389070-32389092 TCCCTCTCTTGAGGGGGAGCTGG - Intergenic
1147610909 17:41801369-41801391 TCCCGGTGTGCAGGGTGTGCAGG - Intergenic
1147992835 17:44345549-44345571 TCCCTGCTTTGGGGGAATGCTGG - Intronic
1148335478 17:46838047-46838069 CCCCTGTGTTGAGGGGGTGGAGG + Intronic
1148446845 17:47743090-47743112 CTCCTGTGTTGGGGGAGTCCGGG - Exonic
1149180689 17:53932520-53932542 TCCTGGTGTTGAGGGAGGGGTGG + Intergenic
1151923513 17:77175701-77175723 TCCCTGTGTTGAGGGAGTGCTGG + Intronic
1152694791 17:81738706-81738728 GCCCAGTGTCGAGGGAGGGCCGG - Intergenic
1203165616 17_GL000205v2_random:90264-90286 TCCCTGTGTTGGGGGAGTGTTGG + Intergenic
1155023114 18:21914739-21914761 TCCCAGTGTTTAGGGAGGCCAGG - Intergenic
1155732701 18:29180717-29180739 TCCGTATGTTGAGGGAATGCTGG + Intergenic
1155823518 18:30408708-30408730 TCCCTATGTTTAGGAAGTGCTGG - Intergenic
1156762450 18:40609648-40609670 TACATGTGTGGTGGGAGTGCTGG - Intergenic
1159054777 18:63452762-63452784 TCCCTATGTTGAAGGAGTGCTGG - Intergenic
1159899036 18:74025114-74025136 TCCCTGTGAGGAGGGAGGGGAGG - Intergenic
1160432432 18:78821023-78821045 TGCCTGTGTACAGGGGGTGCTGG - Intergenic
1160634687 19:66540-66562 GCCCTGTGGTGGGGGCGTGCCGG - Intergenic
1160759395 19:775391-775413 TCCCTGGGGTCAGTGAGTGCTGG + Intergenic
1160786263 19:901384-901406 TCCCCGTGTGGAGGGAGTGAGGG + Intronic
1161220001 19:3114068-3114090 TCCCGGTGCTGGGGGAGGGCCGG - Intronic
1161749326 19:6083028-6083050 TCCCTGGGCTCAGGGAGTACGGG + Intronic
1161893826 19:7064833-7064855 TCACTGTCTTGAGGAAGTGTTGG - Intergenic
1162408670 19:10491458-10491480 TTCCTGTCTTCAGGGAGTGGAGG - Intronic
1163045635 19:14639672-14639694 TCCCAGTGTGCAGGGATTGCAGG + Intronic
1163270093 19:16247876-16247898 TCGCTGTGTTCAGAGAGGGCTGG - Intergenic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1163680956 19:18682306-18682328 TCCCTCTCTTGAGGGAGGGAGGG + Intergenic
1164044060 19:21519279-21519301 TCCCTATGTTGAGGGAATGCTGG - Intronic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1165638722 19:37365635-37365657 TCCTTATGTTGAGGGAGTGCTGG + Intronic
1166185243 19:41135259-41135281 TCCCTGAGATGCGGGAGTCCAGG - Intergenic
1166246812 19:41534199-41534221 TCCCTACATTGAAGGAGTGCTGG + Intergenic
1166352198 19:42204674-42204696 TCCCAGTGTTGTGGGAGCACAGG - Intronic
1167496281 19:49820597-49820619 TCTCTATGTTGAGGGAGTGCTGG + Intronic
925353828 2:3223288-3223310 TGCATGTGTGGGGGGAGTGCAGG - Intronic
925751701 2:7095434-7095456 ACCCTGTGAGGAGGGAGGGCAGG + Intergenic
927132717 2:20073982-20074004 TCCCTATGTTGAGGGAGGGCTGG - Intergenic
929124765 2:38513078-38513100 TCCCTGTGTAGAGAGAGGGAGGG + Intergenic
930284169 2:49407309-49407331 ACTCTGTGTTGAGTGAGTACAGG - Intergenic
930778198 2:55196378-55196400 TCTCTGGGTTGGGGGAGTGGTGG - Intronic
932651349 2:73561334-73561356 TCCCTGTGTTGAAGGAGTGCTGG + Intronic
933031083 2:77329574-77329596 TCTCTGTGCAAAGGGAGTGCAGG - Intronic
933083890 2:78030079-78030101 TCCTTATGTTGTGGGAGTGCTGG + Intergenic
933532744 2:83531092-83531114 TCCCTCTGTAGAGGGAGTGCTGG - Intergenic
933592461 2:84247917-84247939 TCCCTGTGTTGGAGAAGGGCTGG - Intergenic
934566072 2:95342103-95342125 ACCCTGAGATGAGAGAGTGCTGG + Intronic
936566790 2:113588487-113588509 GCCCTGTGGTGGGGGCGTGCCGG + Intergenic
937303055 2:120854989-120855011 GCTCTGTGTGGAGGGTGTGCAGG - Intronic
938251684 2:129820777-129820799 TCCCTGTGTTGAGGGAGTCCTGG + Intergenic
946766917 2:223049515-223049537 TCCCTGTCATGAGTGAGGGCTGG + Intergenic
947849962 2:233278595-233278617 TTTCTGTGGTGAGGGAGTGGTGG + Intronic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
949052890 2:241906714-241906736 TCCCTATATTGAGGGAGTGCTGG + Intergenic
1171972324 20:31572199-31572221 TCTCTGTGTTGAGGAAGAGGAGG + Intronic
1173679081 20:44863619-44863641 TCCCTGTGTTGAGGGAGTGCTGG - Intergenic
1173987655 20:47274971-47274993 TTCCTGTGTGAAGGGAGTGAGGG + Intronic
1174159234 20:48538997-48539019 CCCCTGTGTTCATGGAATGCAGG - Intergenic
1174328993 20:49802783-49802805 CACCTGTGTTGAGGGTGTACCGG + Intergenic
1175039414 20:56032861-56032883 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1176369054 21:6051719-6051741 TCCCTGTTTTGAGGCACTCCAGG - Intergenic
1176406138 21:6368815-6368837 TCCCTGTGTTGGGGGAGTGTTGG - Intergenic
1176687636 21:9865287-9865309 TCCCTATGTTGAGGGAGCCCTGG - Intergenic
1178677204 21:34641340-34641362 TTTCTATGTTGAGGGAGTGCTGG - Intergenic
1179754465 21:43486822-43486844 TCCCTGTTTTGAGGCACTCCAGG + Intergenic
1179776915 21:43670567-43670589 TGCCTCTGTAGAGGGAGAGCAGG + Intronic
1180894164 22:19316210-19316232 TCCTTATGTGGAGGGAGTGCTGG - Intergenic
1181905363 22:26190689-26190711 TCCATGTGTTGGGGGAGGTCAGG - Intronic
1182394929 22:30028386-30028408 TCTCTGTGTGGAGAGAGGGCGGG - Intronic
1183506335 22:38211133-38211155 ATCCTGTGTTGAGGAAGGGCGGG + Intronic
949498238 3:4653965-4653987 TCACTGTGGTCACGGAGTGCTGG + Intronic
950622144 3:14214555-14214577 TTCCTGTGTTGCGGAAGTGTGGG + Intergenic
951590176 3:24255895-24255917 CCACTGTGTTGAGGGGGTGAGGG + Intronic
952107110 3:30083634-30083656 TCCTTCTGGTGAGGCAGTGCTGG - Intergenic
954403173 3:50330058-50330080 ACCCTGAGGTCAGGGAGTGCTGG - Exonic
955133431 3:56192604-56192626 TCTCTGTGTTTAGGGAGGCCTGG - Intronic
955133824 3:56196277-56196299 TCTCTGTGAGGAGGGAGTGTGGG - Intronic
956099285 3:65750217-65750239 TCACTGTGCTGATGGAGGGCAGG + Intronic
959700889 3:109298321-109298343 TCCCTGAGTTCAGGGATTACAGG - Intronic
959961255 3:112302004-112302026 TCCCTGTGTTGAGGGGGTGCTGG - Intergenic
959962002 3:112308059-112308081 TCCCTGTGTTGAGGGAGTGCTGG - Intergenic
959962313 3:112312426-112312448 TCCTTATGTTGAGAGAGTGCTGG - Intergenic
961305156 3:125953783-125953805 TCCCTCTGCTGAAGGAGGGCGGG + Intergenic
961317765 3:126052264-126052286 ACCCTATGTGGAGGGTGTGCAGG - Intronic
963853076 3:150226853-150226875 TCTCTGTGTAGGGAGAGTGCAGG + Intergenic
964484516 3:157174228-157174250 TCCCTGGGCTGACGGAGTTCAGG + Intergenic
964691648 3:159456301-159456323 TCTCTATGTTGAGGGAATGATGG + Intronic
964753560 3:160074620-160074642 TCCCTGTGTGGAAGGAATGTGGG - Intergenic
965850194 3:173013860-173013882 TCCCTAGGTTGAGGGAGTGCTGG + Intronic
966559002 3:181297858-181297880 TGCCTGTGTGGAGGGAGGGCAGG - Intergenic
967036065 3:185649079-185649101 TCTCTGTTTTCAGGGAGTGGAGG + Intronic
967639511 3:191844538-191844560 ACCCTGTGTTCAGCGAGTGTTGG - Intergenic
968702120 4:2062155-2062177 TCCCTGGTGTGAGGGAGTGGAGG + Intronic
968722483 4:2217876-2217898 TCTCTGGGTTTAGGGAGTGGAGG - Intronic
969723973 4:8908331-8908353 TCCCTGGGTGGAGGGACTGGCGG - Intergenic
970359519 4:15294605-15294627 TTCCTGATTTGAGGGAGTTCAGG + Intergenic
971278853 4:25224407-25224429 TCCTTATGTTGAGGGAGTGCTGG + Intronic
972651754 4:41024631-41024653 TCCCTATGTTGAAGGAGGGCTGG - Intronic
972694597 4:41433477-41433499 TCCCTGTGTTCAGTTGGTGCCGG + Intronic
972997664 4:44902114-44902136 TCCCTGAGTTAAGATAGTGCTGG - Intergenic
973966264 4:56165080-56165102 TCACTGTGTTAAGGAAGTTCAGG + Intergenic
974989277 4:69064290-69064312 TCCCTATGTTGAAGGAGTTTTGG - Intronic
975048777 4:69832919-69832941 TCTCTATATTGAGGGAGTGCTGG + Intronic
976710484 4:88065696-88065718 TCTCTGTGTTGAGGGTGAACTGG + Intronic
977919031 4:102623904-102623926 TTCATTTGTTGAGGGAATGCTGG - Intergenic
978533346 4:109736183-109736205 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
980350988 4:131683103-131683125 TCCCTATGTTGAGGGAGCCCTGG - Intergenic
980822972 4:138040145-138040167 TCCATCTGATGATGGAGTGCTGG + Intergenic
982717860 4:158827694-158827716 TTAGCGTGTTGAGGGAGTGCTGG + Intronic
982819281 4:159926446-159926468 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
985475049 5:74144-74166 TCCGTGTGTGGAGGGAGCCCCGG - Intergenic
985632415 5:1020938-1020960 GCCCTGTAGTGAGGGAGTGAGGG + Intronic
985724788 5:1510476-1510498 TCACTGTGCTGTGGGACTGCGGG - Intronic
985947061 5:3194090-3194112 TCTCTGTGTAGAGGGAGGGATGG + Intergenic
985990920 5:3560585-3560607 GCCCAGTGTTGTGGGAGTGGAGG - Intergenic
986327566 5:6687802-6687824 TCCCTGAGATGTGGGAGAGCTGG - Intergenic
987714867 5:21554904-21554926 TCCATGTGTTGAAGGAGTGCTGG + Intergenic
988214506 5:28253575-28253597 TTGCTGTGGTGAGGGAGAGCAGG - Intergenic
989758360 5:44983678-44983700 TTCTTATGTTCAGGGAGTGCTGG + Intergenic
991676116 5:69091448-69091470 TTCCTGTGATGAGGCAGTTCTGG - Intergenic
991969571 5:72126113-72126135 TCCCTGTGTTGAGGGAAGCAGGG + Intronic
992205537 5:74427147-74427169 TCCCTGAGGTTAGGGAGGGCAGG - Intergenic
992759559 5:79939455-79939477 TCCATATCTTGAGGGATTGCAGG - Intergenic
993516411 5:88841249-88841271 TCCCAAAGTTCAGGGAGTGCAGG - Intronic
993635386 5:90336700-90336722 ACCCTGTGATGAGGAAGGGCTGG - Intergenic
997364704 5:133318549-133318571 TGCCTGTGTGGAGGGTCTGCAGG + Intronic
997640349 5:135444918-135444940 TTCCTGTGTGGATGGAGTGTTGG + Exonic
997800962 5:136861635-136861657 TCCCTGGGTGGTGGGAGTGAGGG + Intergenic
1000914654 5:167066053-167066075 TCCCTGGGTGGTGTGAGTGCTGG + Intergenic
1000942949 5:167384967-167384989 TCCCTGTACTGCGGGAGTGTGGG - Intronic
1001226727 5:169951040-169951062 TCACTGTGGTGTGGGAATGCAGG - Intronic
1001389684 5:171368912-171368934 TCCCTGAGTTGAGGTAGCGTTGG + Intergenic
1002103536 5:176868972-176868994 TCCCTGTGACCAGGGAGTCCCGG - Intronic
1003213976 6:4091954-4091976 TCGCTATGTTGAGGGAGTGCTGG - Intronic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1003645722 6:7911364-7911386 TCCCTGAGTTGAGGCCGGGCAGG - Intronic
1004036163 6:11926156-11926178 TTCCTGTCCTCAGGGAGTGCAGG - Intergenic
1004603193 6:17170418-17170440 TCCCTGTGCTGAGGGAGTGAAGG + Intergenic
1005423301 6:25675158-25675180 TCCCTTTGTTGAGGGAGTGCTGG - Intronic
1005922515 6:30415111-30415133 TCCCTGTGTGGGCTGAGTGCCGG - Intergenic
1006059681 6:31410944-31410966 TCCCTGTGTGGGCTGAGTGCCGG - Intronic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1007623042 6:43226393-43226415 CCCCTGTGTTGAGGGAAAGCTGG + Exonic
1011504960 6:88031282-88031304 TCCTTATTTTGAGAGAGTGCTGG - Intergenic
1012187476 6:96237314-96237336 TCCCTGTGTTGAGGGAAGGTGGG - Intergenic
1013155446 6:107488963-107488985 TCCCTGGGTTGAGGCATTGGGGG - Intergenic
1013391364 6:109689441-109689463 ACCCTGTGTTCAGGGAGAGTAGG - Intronic
1015806968 6:137119458-137119480 TCCCAAGGTTGAGGGAGTGCTGG - Intergenic
1018123825 6:160662645-160662667 TCTGTGTGTGTAGGGAGTGCAGG - Intronic
1018570435 6:165204140-165204162 CCCATGTGTTGAGGGAGGGAGGG - Intergenic
1018838355 6:167501649-167501671 TCACTATGTTGAGGGAGAGAAGG + Intergenic
1019897345 7:3992505-3992527 TCCCTGCATTGAGAGAGTGCAGG + Intronic
1022674064 7:32481929-32481951 TCCGTATGTTGAGGGAATGCTGG - Intergenic
1023091865 7:36625026-36625048 ACCCTGGGATGAGTGAGTGCTGG + Intronic
1023287723 7:38636715-38636737 TCCTTGTGTTCAAGGAGGGCGGG - Intergenic
1024423614 7:49199979-49200001 TCTGTATGTTGAGGGAGTGCTGG - Intergenic
1027602559 7:80257195-80257217 TCCCTGTGCTGAGAGAGTCAAGG + Intergenic
1027688636 7:81311666-81311688 TCCCTGAGTTGATGCATTGCCGG + Intergenic
1032335239 7:131018690-131018712 ACCCTGGGGTGAGAGAGTGCTGG - Intergenic
1032670497 7:134077950-134077972 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1033106294 7:138528335-138528357 TCCCCATGTTGGGGGAGTGCTGG + Intronic
1033714805 7:143989221-143989243 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
1034398847 7:150848184-150848206 TCGCTGTGCTGAGGAAGGGCAGG - Intronic
1037722891 8:21459844-21459866 TCACTGTGTTGAGGGCGCCCTGG - Intergenic
1038036575 8:23691361-23691383 TCCCTGTGGTGAGGGGCTGTAGG + Intergenic
1039133365 8:34292932-34292954 TCCCTGTACTGAGGAAGTTCTGG - Intergenic
1039500578 8:38013574-38013596 TCCCTATGTTGAGGAAGTGCTGG + Intergenic
1040063497 8:43125013-43125035 TCCCTATGTTGAGGAAGTGCTGG + Intergenic
1041400856 8:57443210-57443232 TCCCTATGTTGCCAGAGTGCTGG + Intergenic
1041507350 8:58614285-58614307 TCCCTATGTTAAAGGAGTGCTGG - Intronic
1041559045 8:59193555-59193577 ACCCAGTGTAGAGTGAGTGCTGG - Intergenic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1045376930 8:101583499-101583521 GCCAAGTGTTGAGGGAGTGGAGG + Intronic
1046611143 8:116426827-116426849 TCCTTGTTCTGATGGAGTGCAGG - Intergenic
1046658656 8:116924768-116924790 TCCCTGTGTTGAGGGAGTGCTGG + Intergenic
1047398826 8:124528798-124528820 TCCTTATGTTGAGGGAGTGCTGG - Intronic
1048326380 8:133442450-133442472 TCCCAGTGCTGAGGGAGAGTAGG - Intergenic
1048815941 8:138333688-138333710 TTCATGTCTTGAGGGACTGCTGG - Intronic
1048974164 8:139661916-139661938 TTCCTGTGGGGAGGGACTGCTGG + Intronic
1048977584 8:139681605-139681627 ACCCTGTGCTGAGGGGCTGCAGG + Intronic
1050508087 9:6368353-6368375 GCCCTGGGATGAGGGAGTGGTGG - Intergenic
1053290983 9:36879547-36879569 TCCCTGGGTGTGGGGAGTGCTGG + Intronic
1053414928 9:37941500-37941522 TCCCTCTGTTGGGGGAGTCATGG + Intronic
1053781720 9:41616612-41616634 TCCCTATGTTGAGGGAGCGCTGG + Intergenic
1054169668 9:61826766-61826788 TCCCTATGTTGAGGGAGCCCTGG + Intergenic
1054458502 9:65449550-65449572 GCCCTGTGCAGAGAGAGTGCAGG + Intergenic
1054667870 9:67754049-67754071 TCCCTATGTTGAGGGAGCCCTGG - Intergenic
1055018087 9:71640769-71640791 TCTCTGGGTTGTGGGAGTTCTGG - Intergenic
1055323362 9:75103640-75103662 TCCCTCTGTTGCTAGAGTGCTGG + Intronic
1056578648 9:87874182-87874204 TCCTTATGTTGAGGGAGTGCTGG - Intergenic
1057414048 9:94845728-94845750 GCCATTTGTTGAGGGAGGGCTGG + Intronic
1058007789 9:99938065-99938087 CTCCAGTGTTGAGTGAGTGCTGG + Intronic
1059368040 9:113801810-113801832 TCCCTGGGGTGAGGGAGAGAAGG + Intergenic
1060097519 9:120805362-120805384 TCCTGATGTTGAGGGAGTGCTGG + Intergenic
1061425012 9:130493260-130493282 TCCCTGTGTACAGTGAGGGCTGG + Intronic
1185673119 X:1827078-1827100 CCCCAGTGTTGGGGGGGTGCTGG - Intergenic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1186967691 X:14805613-14805635 TGCCTGTGCTGAGGCAGAGCTGG - Intergenic
1188807985 X:34614874-34614896 TCCAGGTGTTGAGGGAGGGTGGG - Intergenic
1189226348 X:39416480-39416502 TGCCTGTGTGGAGGGATTTCAGG - Intergenic
1190535046 X:51417646-51417668 TCCTTACGTTGAGGGAGTGCTGG + Intergenic
1191588092 X:62850699-62850721 TCCCTGTTCTGTGGGAGTGAGGG + Intergenic
1191645369 X:63474910-63474932 TCCTTATGTTGAGGGAGTGCTGG - Intergenic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1193809109 X:86030676-86030698 TCCCTCTGTAGAGGGAGTCATGG + Intronic
1197360224 X:125492637-125492659 TCCTTATGTTGAGAGAGTGCTGG - Intergenic
1199440077 X:147857822-147857844 TCCCAATGTTGAGGGAGACCCGG - Intergenic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1201264905 Y:12196680-12196702 TCTGTATGCTGAGGGAGTGCTGG - Intergenic
1201428291 Y:13878603-13878625 TCCCTATATTGAGGGAGTGCTGG + Intergenic
1201667838 Y:16478969-16478991 TTCCTGTGTTGAGGGAATTAAGG - Intergenic
1202237472 Y:22728550-22728572 TCCCTGCGTTGAGGGTGTGCTGG - Intergenic