ID: 1151924671

View in Genome Browser
Species Human (GRCh38)
Location 17:77186262-77186284
Sequence GACCCACAGCCCCCAGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 456
Summary {0: 1, 1: 0, 2: 6, 3: 46, 4: 403}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151924671_1151924682 28 Left 1151924671 17:77186262-77186284 CCCTCCCCTGGGGGCTGTGGGTC 0: 1
1: 0
2: 6
3: 46
4: 403
Right 1151924682 17:77186313-77186335 CGCACTCCTGAGTTCTTTCCTGG 0: 1
1: 0
2: 3
3: 20
4: 255
1151924671_1151924676 -7 Left 1151924671 17:77186262-77186284 CCCTCCCCTGGGGGCTGTGGGTC 0: 1
1: 0
2: 6
3: 46
4: 403
Right 1151924676 17:77186278-77186300 GTGGGTCCTGCCGCCACCTGAGG 0: 1
1: 0
2: 2
3: 23
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151924671 Original CRISPR GACCCACAGCCCCCAGGGGA GGG (reversed) Intronic
900148437 1:1168158-1168180 GAAGTCCAGCCCCCAGGGGAGGG + Intergenic
900208980 1:1444272-1444294 GAGCCACGGCCCCCAGTGTATGG - Intergenic
900395335 1:2451039-2451061 GAGCCACAGCCCCTATGGCAGGG - Intronic
900501086 1:3004970-3004992 CATCCACAGGCACCAGGGGAAGG + Intergenic
900614053 1:3556437-3556459 GAGCCACAGCCAGCAGGGGTAGG + Intronic
900788225 1:4663047-4663069 GCCCCACTGCCCCCCTGGGAAGG - Intronic
901063663 1:6485197-6485219 GCCCCGCGGCCCCCAGGGGAAGG - Intronic
901491707 1:9600011-9600033 GAACCAAAGGCCCCAGGAGAGGG + Intronic
901527808 1:9835284-9835306 ATCCCACAACCCCCAGGGCATGG + Intergenic
901532333 1:9861436-9861458 GCTCCAGAGTCCCCAGGGGATGG + Intronic
902338683 1:15768519-15768541 TCCCCACAGGCCCCAGCGGAGGG + Exonic
902465430 1:16614452-16614474 GACCCTCACTCCCCAGGTGAAGG - Intergenic
902800824 1:18828968-18828990 GACACACAGGCTCCCGGGGAGGG - Intergenic
903335489 1:22621731-22621753 GCCCCACAGCCCCATGGGGCAGG + Intergenic
903575144 1:24335192-24335214 GACCCACAGCCTCTGGGAGAGGG + Intronic
903796713 1:25934557-25934579 GGTCCACAGGCCCAAGGGGAGGG - Intergenic
903983042 1:27203706-27203728 GACCCACTGCACCTGGGGGAAGG - Intergenic
904044696 1:27602545-27602567 GACCCAGACCCAGCAGGGGAAGG + Intronic
905226288 1:36481275-36481297 AACACCCAGCACCCAGGGGAAGG - Intronic
905244980 1:36606598-36606620 GACCCACACCCCACTGTGGAAGG + Intergenic
905632410 1:39525965-39525987 CAGCCACAAACCCCAGGGGAGGG - Intergenic
907407924 1:54265152-54265174 CACCCACAGCCCCCAAGGAAAGG + Intronic
912525190 1:110277683-110277705 GACCCAGTACCCCCAGGAGAGGG + Intronic
913682128 1:121196041-121196063 GATCCACTGCCCCCAGCAGAAGG - Intronic
914155483 1:145084311-145084333 GATCCACTGCCCCCAGCAGAAGG + Intronic
915004359 1:152622982-152623004 GGCCCACAGCCCCCAGAGCTTGG + Exonic
915535792 1:156534601-156534623 GAGCCACAGCCCCCAGGGCATGG + Exonic
917600248 1:176566518-176566540 AACACACAGCTCCCAGAGGATGG - Intronic
918524768 1:185453451-185453473 GATCTACAGCCCCCAGGTTACGG + Intergenic
920251421 1:204624758-204624780 GACCCTCAGCTCCCGGGGGGGGG - Intronic
920341754 1:205279557-205279579 TTCCCACAGCCCCCAGGGCTTGG - Intergenic
920374996 1:205503583-205503605 AACTCACAGTCCCCAGGGAAAGG + Intergenic
920469441 1:206214550-206214572 GATCCACTGCCCCCAGCAGAAGG - Intronic
920851407 1:209630574-209630596 GACCCAGACCCTACAGGGGAGGG + Intronic
921478442 1:215636628-215636650 GCTCCACAGCACGCAGGGGAAGG + Intronic
922580844 1:226696824-226696846 GACACTCAGGCCTCAGGGGATGG - Intronic
922721834 1:227903555-227903577 GTCCCCCAGACCCCAGGGTAGGG - Intergenic
922748468 1:228060040-228060062 GAGCCACAGCCCCCGTGGAAGGG - Exonic
922822292 1:228492996-228493018 CACCCACCCTCCCCAGGGGAAGG - Intronic
923567298 1:235085797-235085819 GCTCCTCAGACCCCAGGGGAGGG + Intergenic
923790634 1:237108208-237108230 GACCCAGAACCTCCAGGAGAGGG + Intronic
924251853 1:242140886-242140908 GAGCCACAGCTCACAGGTGATGG + Intronic
924378427 1:243437981-243438003 GGCCCACTGCCTCCAGGAGAAGG - Intronic
924814712 1:247431540-247431562 GACCATCAGCTCCCCGGGGATGG + Intronic
1062842197 10:680093-680115 GTCCCACAGCCACCAGGAGGAGG + Intronic
1062880219 10:972343-972365 CACCCACTTCCACCAGGGGAAGG + Intergenic
1063081060 10:2767480-2767502 GACATACAGCACCCTGGGGATGG - Intergenic
1063081526 10:2772371-2772393 GACCCACCCACCCCAGGGAAAGG - Intergenic
1063126387 10:3140000-3140022 GAAACACAGGCCCCAGGTGAGGG - Intronic
1063568956 10:7196966-7196988 GAGCCACAGCCTCCAAGTGATGG + Intronic
1064089046 10:12367864-12367886 GGTCCACAGCCCCCAGGCCATGG - Intronic
1065879793 10:30028642-30028664 GCCCCACAGCCACCGGGGGCTGG + Exonic
1067088168 10:43253664-43253686 GGCCAACATCCCACAGGGGACGG + Intronic
1067948419 10:50706907-50706929 GACTCACATTCCCCAGGAGAAGG - Intergenic
1069542684 10:69307274-69307296 CACCCCCACCCCCCGGGGGAGGG + Intronic
1069639670 10:69946498-69946520 CACACACAGCCTCCAGTGGATGG - Intronic
1070306001 10:75239560-75239582 GGGCAGCAGCCCCCAGGGGAGGG + Intergenic
1070648192 10:78215975-78215997 GACCCACAGCCTCCTGGACAGGG + Intergenic
1070694104 10:78549030-78549052 GACAGACAGCCCACAGGAGAGGG - Intergenic
1070883738 10:79871902-79871924 GACTCACATTCCCCAGGAGAAGG - Intergenic
1071059093 10:81548621-81548643 GACCCAAAGCCCCTAGGGGAAGG + Intergenic
1071650297 10:87388212-87388234 GACTCACATTCCCCAGGAGAAGG - Intergenic
1073157173 10:101356281-101356303 GAGCCACAGCGCCCAGCAGAGGG + Intronic
1073269860 10:102253177-102253199 GAGCCACTGCCCCCAGCCGAGGG + Intronic
1076473324 10:130735374-130735396 GGCCCACAGGCACCAGGGGAGGG + Intergenic
1076867809 10:133176667-133176689 GACCCATAGCCCACAGAGGCTGG + Intronic
1077058008 11:605339-605361 TGCCCACAGCCCCCAGGGAGAGG - Intronic
1077058330 11:606621-606643 GACCAGCAGCCCACAGAGGAAGG - Intronic
1077096958 11:803131-803153 GACACACTGGCCCCACGGGAGGG - Intronic
1077111749 11:865121-865143 GACCCAGAGCACCCTGGAGAAGG - Intronic
1077341769 11:2029400-2029422 GACCCCCAGCACCCTGGGGCTGG - Intergenic
1077499572 11:2903074-2903096 GGCACACAGCCTCCCGGGGAGGG - Intronic
1077535734 11:3123066-3123088 TGCCCACGGCTCCCAGGGGATGG - Intronic
1078108900 11:8376156-8376178 GAGCGACAGCCACCAGGGCAAGG + Intergenic
1078251181 11:9617724-9617746 GAGCCACAGCGCCCTGGGGACGG + Intergenic
1082800293 11:57409467-57409489 GACCCACAGAACCCAGAAGAAGG + Intronic
1083541609 11:63515488-63515510 GCTGCTCAGCCCCCAGGGGAAGG - Intronic
1084536126 11:69758310-69758332 GACCCTCAGCTGCCTGGGGAAGG - Intergenic
1084573754 11:69975655-69975677 GTCCCACAGCTGCCAGTGGAGGG - Intergenic
1085645373 11:78219098-78219120 GGCCCTCACCTCCCAGGGGAAGG + Exonic
1088480897 11:110296109-110296131 GACCCCCAGCGCCCTGGGGACGG - Intronic
1090428618 11:126627796-126627818 AACTCACAGGCCCCAGTGGAGGG + Intronic
1091285689 11:134407505-134407527 AATCCACAGCCCCCTGGGCAAGG + Intronic
1202824755 11_KI270721v1_random:84589-84611 GACCCCCAGCACCCTGGGGCTGG - Intergenic
1092237666 12:6820202-6820224 GAAGCACAGCACCCATGGGAAGG + Exonic
1094393338 12:29977319-29977341 GCCCCACAACCCCCAGGGGTAGG - Intergenic
1095948881 12:47770724-47770746 CTCCCCCAGCCCCAAGGGGAGGG + Intronic
1096715273 12:53487336-53487358 GACACAAAGCCCCCAAAGGAAGG + Exonic
1097293763 12:57941896-57941918 GAACCACAGCCTCCAGGTCATGG - Intronic
1097895688 12:64822957-64822979 CACCCACAGCACCCAGGTTATGG - Intronic
1100125699 12:91422137-91422159 GACCCAAGGCACCCAGAGGAAGG - Intergenic
1102299336 12:111759519-111759541 GTCCCCCAGCCTCCAAGGGAGGG - Intronic
1102313460 12:111865926-111865948 GACCCACAGCCCCAAAAGCATGG + Intronic
1103852066 12:123939891-123939913 GTCCCACAGGCCCTGGGGGAAGG - Intronic
1103852239 12:123940790-123940812 GGGTCACAGCCCCCAGGGGAGGG + Intronic
1103884170 12:124188549-124188571 GCTCCAAAGCCCCCTGGGGATGG + Intronic
1103951231 12:124552460-124552482 CAGCCACAGCCCCCAGGTCAAGG + Intronic
1104690962 12:130826196-130826218 GACTCACACCCACCAGTGGACGG + Intronic
1104736046 12:131136565-131136587 GACCCACAGGCCCCCAAGGAAGG + Intronic
1104955987 12:132466070-132466092 GACACAGAGGCCCCAGGGGAGGG - Intergenic
1105465425 13:20635385-20635407 GACACTCATCCCCAAGGGGAGGG + Intronic
1105881730 13:24612062-24612084 GACCCACAGGCCCCTGATGAAGG + Intergenic
1108623520 13:52206170-52206192 TTCCCACAGCCCCAAGGGGATGG + Intergenic
1113170942 13:107502579-107502601 CATCCAAAGCCCCAAGGGGAAGG - Intronic
1114063244 14:19038468-19038490 GACCCACCGCCCCCTGGATAGGG - Intergenic
1114099011 14:19361527-19361549 GACCCACCGCCCCCTGGATAGGG + Intergenic
1114597546 14:23926245-23926267 GACCCACAGACCCCAGGAGGAGG - Intergenic
1118837392 14:69486500-69486522 GAGCTACAGCCCCCAGGGCCAGG + Intronic
1119211479 14:72835530-72835552 GACCCACAGCCACAAGGAGCTGG + Intronic
1119613626 14:76083963-76083985 GGCCCAGAGCACCCACGGGAAGG - Intronic
1121106153 14:91281296-91281318 CACGCTCAGCCCCCTGGGGAGGG + Intronic
1121302862 14:92885798-92885820 GCACCAGAGCCCCCAAGGGATGG - Intergenic
1121511144 14:94514431-94514453 GAGTCACAGCCACCAGGGGCTGG - Intronic
1122077988 14:99247871-99247893 GGCACTCAGCCCCCAGGGCAGGG + Intronic
1122272815 14:100575919-100575941 GCCCAGCAGCCCCCAGAGGACGG + Intronic
1122481389 14:102049684-102049706 AAGCAGCAGCCCCCAGGGGAAGG - Intronic
1122649689 14:103219859-103219881 GGCCCCCTGCTCCCAGGGGAAGG + Intergenic
1122657909 14:103274154-103274176 GACCCCGAGGCCCCAGGGGCTGG + Intergenic
1122862680 14:104589522-104589544 GACCCACAGGCCCCAGCTGGTGG - Exonic
1122884649 14:104705657-104705679 GTCACGCAGCGCCCAGGGGAGGG + Intronic
1122982302 14:105197192-105197214 GACCCCCAGACCCCAGGGCGGGG - Intergenic
1123003985 14:105312631-105312653 GACCCACAGCCCTCAAGAGAAGG + Exonic
1123134178 14:106012084-106012106 GTCCGCCAGCCCCCAGGGAAGGG - Intergenic
1123194821 14:106606278-106606300 GTCCGCCAGCCCCCAGGGAAGGG - Intergenic
1123478692 15:20611843-20611865 CACCCACAGCAGACAGGGGAGGG + Intergenic
1123584209 15:21742526-21742548 GTCCGCCAGCCCCCAGGGAAGGG - Exonic
1123620860 15:22185129-22185151 GTCCGCCAGCCCCCAGGGAAGGG - Intergenic
1123639321 15:22388542-22388564 CACCCACAGCAGACAGGGGAGGG - Intergenic
1124151214 15:27180077-27180099 GCCCCACAGTCTCCTGGGGAAGG - Intronic
1124213469 15:27783919-27783941 AACCCACTGCCTCCAGGGGAAGG + Intronic
1124623288 15:31292385-31292407 GAACCACAGCCCACAGGTGGTGG - Intergenic
1128675716 15:69607091-69607113 CACCCACAGCCCCCAGAATAAGG - Intergenic
1129108304 15:73323427-73323449 GAGCCACAGGCCCCGGGGGGTGG + Exonic
1129109794 15:73330688-73330710 GAGGCCCAGCCCCCAGGGGAAGG + Intronic
1129164225 15:73767235-73767257 GACCCACTGGCCAGAGGGGATGG + Intergenic
1130611215 15:85362877-85362899 GACCCACAGACCCCGGTGGGTGG - Intergenic
1130995534 15:88901769-88901791 GATCCACAGCTCCCAGGGGCAGG + Intronic
1131109805 15:89758252-89758274 TTCCCAGAGACCCCAGGGGAGGG - Intergenic
1131109985 15:89758920-89758942 GAGCCAGAGGCCCCAGGAGAAGG + Intergenic
1132500590 16:283038-283060 CGCCCCCGGCCCCCAGGGGAGGG - Intergenic
1132512268 16:349623-349645 GACCCACAGCACCCAGCACAAGG + Intronic
1132744046 16:1429409-1429431 GACCCCCAGCTTCCAGGGAAGGG - Intergenic
1132764299 16:1526548-1526570 CAGCCACGGCCCCCTGGGGAAGG - Intronic
1132862175 16:2077109-2077131 GGCCCCCGGCCCCCAGGGGCTGG - Intronic
1132872553 16:2122296-2122318 GTCCCACAGCCCCTGGGGGAAGG - Intronic
1132872830 16:2123321-2123343 GTCCCCCAGCCCCCAGGGTGTGG + Intronic
1133054286 16:3137784-3137806 GACACAGAGCCCCCAGGAGCAGG + Intronic
1133386990 16:5377680-5377702 GACCTAGAGGTCCCAGGGGAAGG + Intergenic
1133460939 16:5985599-5985621 CCCCAGCAGCCCCCAGGGGAGGG + Intergenic
1134551651 16:15141496-15141518 GTCCCACAGCCCCTGGGGGAAGG - Intergenic
1134551918 16:15142500-15142522 GTCCCCCAGCCCCCAGGGTGTGG + Intergenic
1134761287 16:16717435-16717457 GAGGCACAGCCCCCATGTGAAGG - Intergenic
1134914855 16:18060904-18060926 GACCGACAGCCCCCACAGCATGG - Intergenic
1134984772 16:18641741-18641763 GAGGCACAGCCCCCATGTGAAGG + Intergenic
1135003719 16:18800661-18800683 GACCTACAGTCACCAGGGAAGGG + Intronic
1135401773 16:22170995-22171017 GACCCACAGCTCAGAGGGGAGGG + Intronic
1135631582 16:24039726-24039748 CATACACAGCACCCAGGGGATGG + Intronic
1136391576 16:29968365-29968387 GTCACACAGCCCCCAAGGCAGGG - Intronic
1137555752 16:49469297-49469319 GAGCCACTGTTCCCAGGGGAGGG - Intergenic
1137569707 16:49557502-49557524 GACCCTCTGACCCCAGGGGGTGG + Intronic
1137988811 16:53131535-53131557 GGCCCACAGCCCCCGGGGTCGGG + Intronic
1138007882 16:53354791-53354813 GCCCCCCAGCCCCAAGGGAATGG + Intergenic
1138099904 16:54244252-54244274 GACCTAAAGCCACAAGGGGAGGG + Intergenic
1138105116 16:54283968-54283990 GGCCCACAGGCCCCTGGGGCGGG - Intronic
1138457719 16:57130961-57130983 GAACCACGGGCACCAGGGGAGGG + Intronic
1139378862 16:66517694-66517716 CACCCACTGCCCCCAAGGGTTGG + Intronic
1139576618 16:67846493-67846515 CAGCCATAGCCCCAAGGGGAGGG + Intronic
1139657496 16:68397803-68397825 GAAGCACTGCCACCAGGGGAGGG - Intronic
1140501353 16:75436111-75436133 GCCCCACAGAAACCAGGGGAGGG - Intronic
1141158050 16:81610553-81610575 GAACCACAGCCGCCAGGGGCAGG - Intronic
1141209438 16:81963097-81963119 AACCCCCAGCCCCCAGTGGTTGG + Intergenic
1141438887 16:84016643-84016665 GACCCACAGCCCTGAGGGGTCGG + Exonic
1141651925 16:85397378-85397400 GACACACCGCCCGCAGGAGACGG - Intergenic
1141901071 16:86990905-86990927 CACGCACATCTCCCAGGGGATGG + Intergenic
1142241950 16:88951569-88951591 AAGCCACAGACCCGAGGGGAGGG - Intronic
1142476633 17:192948-192970 GACCCCCAGCCCTCTGAGGAAGG - Intergenic
1142764035 17:2055987-2056009 GCCACGCAGCTCCCAGGGGAGGG - Intronic
1142903299 17:3026618-3026640 CACCCACTGCGCCCAGGGGGTGG - Intronic
1143026455 17:3944498-3944520 GACCAAGAGCCCCAGGGGGAGGG + Intronic
1144462155 17:15467047-15467069 AACCCATCACCCCCAGGGGATGG + Intronic
1144826027 17:18106163-18106185 TTCCCAAAGCCACCAGGGGAAGG - Intronic
1147186606 17:38716594-38716616 GACTTATAGTCCCCAGGGGAGGG - Exonic
1147428563 17:40357556-40357578 CACCCACGGGCTCCAGGGGAAGG - Intronic
1148119126 17:45197500-45197522 GACCCACAACCCCCAGAAAAAGG + Intergenic
1149664673 17:58357548-58357570 GAACCACATCCACCTGGGGAGGG - Exonic
1149991784 17:61387589-61387611 GATGGACAGCCCCCAGGGGTAGG - Intronic
1150691326 17:67369644-67369666 GAGCCACAGCGCCCAGCTGAAGG + Intergenic
1151139278 17:71976127-71976149 CACCCCCAGCCCCCAGGGCTTGG - Intergenic
1151147359 17:72053565-72053587 GACCCACTGCCCCCGGTGGCTGG - Intergenic
1151156225 17:72124330-72124352 GACCCACAGCCCCCAGCACTGGG + Exonic
1151392294 17:73795543-73795565 GGACCACAGCCTCTAGGGGAAGG + Intergenic
1151538045 17:74749580-74749602 CACCCACAGACCCGAGGGAAGGG - Intronic
1151705419 17:75764716-75764738 GAGCCCCAGCCCCCAGAGGGCGG + Intronic
1151726995 17:75891052-75891074 GACGCAGAGCCCCCAGGAGCAGG + Exonic
1151924671 17:77186262-77186284 GACCCACAGCCCCCAGGGGAGGG - Intronic
1152048957 17:77958282-77958304 GAGCCACAGCGCCCAGGGACCGG + Intergenic
1152255947 17:79239560-79239582 TGCCCACTGCCCCCAGGAGACGG + Intronic
1152460176 17:80438377-80438399 GACCCCCACCCTGCAGGGGAAGG - Intergenic
1152468232 17:80477267-80477289 GACTGACAGTCCCCCGGGGACGG - Intronic
1152651049 17:81493113-81493135 GGCCTGCAGCCCCCAGGGAATGG - Intergenic
1152698094 17:81806214-81806236 GACCCACCACCCGCAGGGAACGG + Intronic
1152734939 17:81992637-81992659 GAAGCACAGCCCCCAGGGCCAGG - Intronic
1152774028 17:82188638-82188660 AGCCCACAGCCCCCTGGAGAAGG + Intronic
1157310163 18:46546792-46546814 TTCCCAGAGCCCACAGGGGAGGG + Intronic
1157480081 18:48048194-48048216 GACCCCCAGCCCACAGGGATCGG - Intronic
1159783993 18:72692677-72692699 CCCCCACTGCTCCCAGGGGAGGG + Intergenic
1160463696 18:79058236-79058258 GACCCAGAGCCATAAGGGGAAGG + Intergenic
1160504347 18:79418588-79418610 GAGCCACAGCTCCCTGGAGAAGG + Intronic
1160718202 19:585849-585871 GAGCCACAGCCCAGAGTGGAGGG - Intergenic
1160865749 19:1255225-1255247 GACCCGCGGCCCCCCGGGCAGGG - Intronic
1160866890 19:1260162-1260184 TACCGGGAGCCCCCAGGGGAAGG + Intronic
1160889475 19:1369583-1369605 GACCCGCAGCCTGCAGGGGGTGG - Exonic
1160889647 19:1370578-1370600 GACCCACAGCCACCCGAGGAAGG + Intronic
1160931368 19:1571485-1571507 GGCCCAGAGCCCCCAGAAGATGG - Intergenic
1161076719 19:2289515-2289537 GCCCCACAGCCCCAAGGGGAGGG - Intronic
1161307061 19:3574056-3574078 GGCCCACAGGACCAAGGGGAGGG - Intronic
1161468548 19:4445304-4445326 TCCCCACAGCCCCCAAGGGATGG + Exonic
1161698359 19:5782616-5782638 GACACACAGCCATCAGGGCAGGG - Intergenic
1161990305 19:7680932-7680954 GACCCACACGCCCGCGGGGAAGG - Intronic
1162800932 19:13110087-13110109 GCCCCAGATCCCCCAGGGCAAGG + Intronic
1162968667 19:14167512-14167534 GAACCAGGGGCCCCAGGGGAAGG + Intronic
1163370668 19:16899603-16899625 TGACCACTGCCCCCAGGGGATGG - Intronic
1163501757 19:17680337-17680359 GACCCGAAGCCCGCTGGGGAAGG - Intronic
1163685702 19:18710522-18710544 GACCCAAAGCCCCCATGGGAGGG - Intronic
1165025354 19:32957017-32957039 GTCCCACAGCTCAAAGGGGAAGG - Intronic
1165093195 19:33397123-33397145 GACTCCCAGCCGCCAGGGTAGGG + Intronic
1165581876 19:36872412-36872434 CACCCACTGCCCCCCAGGGAGGG - Intronic
1165635678 19:37337725-37337747 GAGCCACAGCCCCCGGCCGAGGG + Intronic
1166283520 19:41810178-41810200 GACCCAGAGCCCACAGGTGAGGG - Intronic
1166368801 19:42290487-42290509 GACCCCCAGCCCCAGGGGGTGGG - Exonic
1166978803 19:46620868-46620890 CACCCCAAGTCCCCAGGGGATGG - Exonic
1167637101 19:50661588-50661610 GTCCCCCAGGCCGCAGGGGAAGG - Intronic
1168071754 19:53957281-53957303 GAAACACAGCCCCCAAGGGAAGG - Intergenic
1168128124 19:54298506-54298528 CACCCCCAGCCACCTGGGGATGG - Intergenic
925587706 2:5479757-5479779 GACAACCAGCCCACAGGGGAGGG - Intergenic
926075606 2:9940697-9940719 GCCCCAGAGCCCCCGGGGGTAGG + Intergenic
926249222 2:11144133-11144155 CACCCACACCCACCTGGGGAAGG - Exonic
927184754 2:20474087-20474109 GACCCACAGCCCTGAGAGGGTGG - Intergenic
927670372 2:25063786-25063808 GACCCTCAGGCCCCTGGAGAGGG - Intronic
927717857 2:25364033-25364055 GACCCACAGTGCCCAGTGGATGG + Intergenic
928116040 2:28545806-28545828 GACACACAGAGCCCAGGTGAGGG + Intronic
928398645 2:30962451-30962473 GCCTCAGAGCCCCCATGGGAGGG + Intronic
929431448 2:41890793-41890815 CACCCACAGCCTCCAGGGAGGGG + Intergenic
930214973 2:48685884-48685906 GACCCCCAGCCCCACAGGGAAGG - Intronic
930762443 2:55050568-55050590 GACTCACCCTCCCCAGGGGAGGG + Intronic
932314228 2:70768742-70768764 GGTCCACAGCCCCCAAGGGCAGG - Intergenic
933796104 2:85921062-85921084 AACCCACAGCCCTGAGGGCAAGG - Intergenic
936376954 2:111948899-111948921 GACACGCAGCCCCTAGGGAAAGG - Intronic
936401885 2:112170917-112170939 GGCTCACAGCCCACATGGGATGG - Intronic
938121952 2:128640274-128640296 GACCCAGAGACCCCAGTGCAGGG + Intergenic
938265224 2:129923422-129923444 GTCCCAGCGCCCCCTGGGGACGG - Intergenic
938480589 2:131658629-131658651 GACCCACCGCCCCCTGGTTAGGG - Intergenic
938768942 2:134483285-134483307 GCCCGACGGCCACCAGGGGAGGG - Intronic
938954115 2:136282773-136282795 GACCCACAGCCCAAAAGGGCAGG - Intergenic
943424071 2:187707365-187707387 GACCAACAGTACCAAGGGGATGG - Intergenic
943836869 2:192525007-192525029 GACACAGAGCACCCGGGGGAAGG + Intergenic
945302657 2:208228524-208228546 GACCCACAACCTCTAGGTGAGGG - Intergenic
946229344 2:218282059-218282081 TGCCCATAGCCCCCAGGGGGCGG + Exonic
947856324 2:233326895-233326917 GGCCCAAAGCCCCCAGAGGGAGG - Intronic
948411525 2:237766140-237766162 GAACCACAGATCACAGGGGATGG - Intronic
948750156 2:240127542-240127564 CACCCCCAACCCCCAGGTGATGG + Intronic
948755115 2:240155030-240155052 CAGCAACAGACCCCAGGGGATGG + Intergenic
948900255 2:240953087-240953109 CACACACAGCCCCCAAGAGAGGG + Intronic
1168912920 20:1464322-1464344 GAGGCACAGCCCCCAGGTAAGGG - Exonic
1168967718 20:1909275-1909297 GACCCACTGCTTCCGGGGGATGG + Intronic
1170567263 20:17614353-17614375 GAGCCACAGACCCCTGGGGCTGG + Intronic
1171882539 20:30628995-30629017 GGCCCAGAGCTCCCAGAGGAAGG - Intergenic
1172479881 20:35264914-35264936 CACCCACAGCCCACAGGCTACGG + Intronic
1172626566 20:36350813-36350835 GGCCCACAGCCCACTGGGGAAGG - Intronic
1174032035 20:47636646-47636668 GAACTACAGCCCCAAGTGGAAGG + Exonic
1174175553 20:48642322-48642344 GACCCACAGCCCCCGGGTCATGG + Intronic
1174615526 20:51832551-51832573 AACCCACAGCTCCCATGGGGTGG + Intergenic
1175278874 20:57789209-57789231 GAAGCAAAGCCCCCCGGGGACGG + Intergenic
1175895210 20:62333025-62333047 GACCCCCAGCCCCCAGGCCAAGG + Intronic
1175926521 20:62474167-62474189 GCCTCACAGCCCCCTGGGGCCGG + Intronic
1175928137 20:62480822-62480844 GCCCCAGAGACCCCAGGGCAGGG + Intergenic
1176079134 20:63262893-63262915 GACCCCCAGTCCCCAGGGTTGGG + Intronic
1176117500 20:63439454-63439476 GGTCCACAGCCCCCAGGAGCTGG - Intronic
1176295480 21:5069855-5069877 GTCCCCCAGACCCCAGGGGCTGG - Intergenic
1177332941 21:19684547-19684569 GAGCCAAGGCCCCCAGGGCATGG + Intergenic
1178003607 21:28192309-28192331 GATGGACAGCCCCTAGGGGAGGG + Intergenic
1179861570 21:44192269-44192291 GTCCCCCAGACCCCAGGGGCTGG + Intergenic
1180059580 21:45377831-45377853 GCCCCACAGTGCCCAGGGGTTGG + Intergenic
1180481736 22:15761097-15761119 GACCCACCGCCCCCTGGATAGGG - Intergenic
1181016258 22:20070568-20070590 GACCCAGACCCTCCAGGGCATGG + Intergenic
1181045957 22:20214351-20214373 GACACCCCGCCCCCATGGGAGGG - Intergenic
1181769017 22:25112213-25112235 GACCCACATGACCCAGTGGATGG + Intronic
1183051448 22:35265172-35265194 GACCCACAGCCTTCAGGGCCAGG - Exonic
1183102846 22:35594388-35594410 GGCCCACAGGCCTCATGGGAAGG - Intergenic
1183688228 22:39374251-39374273 GCCTCACACCACCCAGGGGACGG - Intronic
1183934934 22:41256665-41256687 CACCCACAGACCCCAGAGGGAGG + Intronic
1183997346 22:41645014-41645036 GAGCCACAGCCCCCAGCTCAAGG - Intronic
1184222511 22:43110093-43110115 GACCCGGAGCCCCGACGGGAGGG + Intergenic
1184424105 22:44399072-44399094 AACACACAGACGCCAGGGGAGGG - Intergenic
1184706391 22:46216565-46216587 GTCCCACAGCCCCCAGCAGCAGG + Intronic
1184748848 22:46472775-46472797 GACCCCCAGCCCCCAGGGAAAGG - Intronic
1184947452 22:47813675-47813697 AGCCCACGGCCCGCAGGGGAGGG - Intergenic
1185018157 22:48357773-48357795 GACCGACATCACCCAGAGGAAGG - Intergenic
1185119148 22:48955448-48955470 GACACACAGCCACCAGGGCTCGG + Intergenic
1185336929 22:50274907-50274929 GACCCACAGAGCCCAGGGAAGGG + Intergenic
953717505 3:45328609-45328631 GCCTCACAGCCAGCAGGGGAAGG + Intergenic
957465591 3:80586249-80586271 GACCCACGGGCCATAGGGGATGG - Intergenic
959924897 3:111910030-111910052 GATTCACAGCCCTCAGGAGAGGG - Intronic
961369137 3:126418977-126418999 CACCCACAGGCCCCAGGGCTGGG - Intronic
961772582 3:129260827-129260849 CACCCACGGCCCCCAGAGGAAGG + Intronic
963028302 3:140941946-140941968 GACGCACAGCGCCCCGGGGACGG - Exonic
963921857 3:150913340-150913362 GAGCCACAGCTGCCAGGAGATGG - Intronic
965671673 3:171154040-171154062 GACCTACAGACCCCAGGAAAAGG + Intronic
967862330 3:194161398-194161420 AACCCCAAGCCCCCAGGTGAAGG + Intergenic
968232242 3:197010908-197010930 CACCCACATTCCCCAGGGGAAGG - Intronic
968504251 4:964606-964628 GACCCACAGTGCCCAGAAGAGGG - Intronic
969501925 4:7558721-7558743 GACCAAAAGCCCCCTGGGGTAGG - Intronic
969577402 4:8044349-8044371 GACCCCCAGGCGCCAGGTGAGGG - Intronic
973366213 4:49211439-49211461 GGCCCAGAGCTCCCAGAGGAAGG - Intergenic
980742965 4:136975342-136975364 AATCCTAAGCCCCCAGGGGATGG - Intergenic
981526845 4:145715265-145715287 GACTCACAGCCACCAGGGCTCGG - Intronic
981838497 4:149082969-149082991 GACCACAAGCCCCCAGGGAAGGG + Intergenic
985570698 5:643314-643336 GACCCAAAGCCCCGCGCGGAGGG + Intronic
985675920 5:1231296-1231318 GCCCCACAGGCCCCAGGGCAGGG - Intronic
986233973 5:5890676-5890698 CTCCCAGAGCCCCCGGGGGATGG + Intergenic
987965279 5:24864654-24864676 GACCCCCGGCCCCCAGGCCAAGG - Intergenic
989592102 5:43121421-43121443 TACCCACACCCCTCAGTGGATGG - Intronic
991342335 5:65625022-65625044 GACCCACAGCCTACGGGGGCTGG - Exonic
991951189 5:71948110-71948132 GACCCAAAGGGCCCAGGGAAAGG - Intergenic
992017897 5:72594489-72594511 GTCCCTCAGCCCACAGGGGCAGG + Intergenic
992195021 5:74330553-74330575 CACCAACAGCCCCAAGGGAAGGG + Intergenic
992901567 5:81301860-81301882 GACGCACAGCCCCCAGCAGCCGG - Exonic
995848638 5:116521294-116521316 GACACACAGACCCCAGGAGATGG + Intronic
995921391 5:117318361-117318383 GACCCTTACCACCCAGGGGAAGG - Intergenic
996036301 5:118762592-118762614 GGGACACAGCCCCCTGGGGAAGG + Intergenic
996044982 5:118861967-118861989 GATCCCCAGCCCCCAGGCCATGG + Intronic
999239287 5:150118220-150118242 CCCCCACTGCCCCCCGGGGATGG - Intronic
999685859 5:154102387-154102409 CACCTGCAGCCCCCAGGGGCCGG + Intronic
999743232 5:154572966-154572988 GACCCCCAGGCCCCTGGAGAGGG - Intergenic
1000340439 5:160273170-160273192 GAACCACTGCTCCTAGGGGAAGG + Intronic
1000614232 5:163410186-163410208 GACCCACAGCACCCAGCTGCAGG - Intergenic
1001573736 5:172748346-172748368 TACCCACAGCCACCCTGGGAGGG - Intergenic
1002197948 5:177511387-177511409 GACCCAGAGTCCCCAGAGGCGGG + Intergenic
1002327099 5:178416798-178416820 AGCACACAGCCCCCAGGGCAGGG + Intronic
1002411724 5:179084258-179084280 GAACCACAGCCCACAGGAGATGG + Intergenic
1002813351 6:656296-656318 CACCCACAGCCGACTGGGGAGGG + Exonic
1004189461 6:13451318-13451340 GACCCACAGGCCTGAGAGGAGGG + Intronic
1004614932 6:17280962-17280984 GACCCCCGGCCCGCGGGGGAAGG + Intergenic
1006302117 6:33199299-33199321 GCCCCAGAGCCTCCAAGGGATGG + Exonic
1006633100 6:35443373-35443395 GACCCCCAGCCCCCTGGAGTGGG + Intergenic
1007788436 6:44295392-44295414 GGACCACAGTCCCCAGGGAAAGG + Intronic
1011161332 6:84393569-84393591 AACCCACAGCAGCCAGGGCATGG + Intergenic
1013577928 6:111503375-111503397 GAACCACAACCCCCTGGGGGTGG - Intergenic
1014255505 6:119157082-119157104 GACCCTCAGCCCCAAGGGGCTGG - Intergenic
1015965381 6:138692389-138692411 GACCCAGGGCCGCCAGGGGGCGG + Intronic
1016484081 6:144515857-144515879 GCCACCCAGCCCCCAGGGCAGGG - Intronic
1017106900 6:150896449-150896471 CACCCACAGCAGGCAGGGGAGGG - Intronic
1017787700 6:157769908-157769930 GAACAGCAGCCCCCAGGGCATGG + Intronic
1017869913 6:158478614-158478636 TGGCCACAGTCCCCAGGGGAGGG - Intronic
1018901513 6:168054102-168054124 GACCAACTGCCCCCAGGAGCAGG + Intergenic
1019062610 6:169266868-169266890 GTCCCAGGGCCCCCAGGGGTGGG + Intergenic
1019224840 6:170501161-170501183 GTCCCACAGCCATCAGGAGAGGG + Intergenic
1019224863 6:170501269-170501291 GTCCCACGGCCATCAGGGGAAGG + Intergenic
1019224880 6:170501339-170501361 GTCCCACAGACATCAGGGGAAGG + Intergenic
1019225000 6:170501951-170501973 GTCCCACAGCCATCAGGGAAAGG + Intergenic
1019225052 6:170502199-170502221 GTCCCACAGCCATCAGGGGAAGG + Intergenic
1019225235 6:170503063-170503085 GTCCCACAGCCATCAGGGGAAGG + Intergenic
1019258720 7:67904-67926 GACCCAGAGCCCCTGGAGGAAGG - Intergenic
1019313107 7:372278-372300 GACCCACAGGCCCGTGAGGATGG - Intergenic
1019644425 7:2121433-2121455 ACCTCACAGCCCCCACGGGAGGG + Intronic
1020263168 7:6542855-6542877 GACCCTCAGCCAACAAGGGAAGG - Intronic
1022639829 7:32171127-32171149 TACCCACAGTTCCCAGGAGAGGG - Intronic
1022806074 7:33824011-33824033 GAGGCACAGCCTCCATGGGATGG + Intergenic
1024217014 7:47256391-47256413 CACCCACAGCACCGAGGAGAGGG + Intergenic
1024392713 7:48833771-48833793 GACACACTGCACCCAGGAGAGGG + Intergenic
1024985176 7:55188006-55188028 GAGCCCCAGCCCCCAGGGGAAGG + Intronic
1026240763 7:68573180-68573202 GACTCACAGTCCCCAAAGGAAGG + Intergenic
1026800237 7:73395847-73395869 TACCCTCAGCGCCCAGGGCATGG + Intergenic
1026966950 7:74446164-74446186 GATCCAGAGCTCCCAGGGGCAGG + Intergenic
1027363217 7:77430842-77430864 GAGCCACAGACCCCAGGGAGAGG + Intergenic
1028154822 7:87418120-87418142 GAACCACTGTCTCCAGGGGATGG - Intronic
1028873937 7:95799495-95799517 TACCCACTTCCCCCAGAGGATGG - Intronic
1029226558 7:99033179-99033201 GCCACACAGCCCCCAGGAGCAGG + Intronic
1029408073 7:100389839-100389861 CACCCTGTGCCCCCAGGGGAGGG + Intronic
1029537395 7:101164456-101164478 GACCCACAGCCTCCCGGCGCCGG - Exonic
1029608586 7:101614647-101614669 GAGCCACAGACCCCGAGGGAGGG + Intronic
1030086033 7:105816573-105816595 TCCCCACAGCCCTCAGGGAAGGG + Intronic
1032937928 7:136755435-136755457 GAGCCATAGCCCCAAGCGGAAGG - Intergenic
1033814129 7:145051699-145051721 GCCATACAGCCACCAGGGGATGG + Intergenic
1034358587 7:150474003-150474025 GTCCCACAGGCCCAAGGGAAAGG + Exonic
1035284127 7:157795414-157795436 CAGCCTCAGCCCCCTGGGGAGGG - Intronic
1035427724 7:158792237-158792259 GAGCGACTGCACCCAGGGGAAGG - Intronic
1035645264 8:1214093-1214115 GACGCAAGGCCCCCTGGGGAGGG - Intergenic
1035755323 8:2026732-2026754 GACCCCCAGCCCCCGGAGCAGGG - Intergenic
1037503259 8:19505672-19505694 GGCCAACAGCCCCACGGGGAAGG - Exonic
1037579450 8:20235982-20236004 GACCCCCAGCACCCTGGGGGTGG - Intergenic
1038421649 8:27437660-27437682 CTCCCACCGCCCCCAGGGAAGGG + Intronic
1038729797 8:30116622-30116644 GCCCCACAACCCCCAGGCCAGGG - Intronic
1039598189 8:38809682-38809704 GTCCCACAGCCCCCAAAGAAAGG - Intronic
1039685896 8:39801656-39801678 GAGCCTGAGCCCCCAGGGGGAGG - Intronic
1040840800 8:51782140-51782162 CACCCACAGCCTCCGGGGGCTGG + Intronic
1041466148 8:58159424-58159446 GACCCACACCACTCAGGAGAAGG - Intronic
1041678713 8:60564288-60564310 TACCCACAGCACCAAGGGAAAGG - Intronic
1042928447 8:73990381-73990403 GGTCCACGGCCCCCAGAGGATGG - Intergenic
1043428885 8:80175272-80175294 GACCCAGGGCGCCCAGTGGAGGG + Intronic
1044995877 8:97837733-97837755 GAACCAGAGGGCCCAGGGGACGG + Intronic
1045600964 8:103715339-103715361 GACCAACAGGCCCCAGTGTATGG + Intronic
1047507034 8:125488159-125488181 GCCCCCCAGGCCCCAGGGGCTGG + Intergenic
1049035963 8:140076291-140076313 CACACACAGCAGCCAGGGGAGGG - Intronic
1049303292 8:141883212-141883234 TTCCCAGAGCCCCCAGGGCAGGG - Intergenic
1049312742 8:141942092-141942114 TGCCCAGAGCCCCCAGGGGTTGG - Intergenic
1049313071 8:141943660-141943682 GACCCACGGGCCACAGGGGGTGG - Intergenic
1049424663 8:142532754-142532776 AGCCCACAGGCCCCAGGCGAGGG - Intronic
1049467936 8:142761674-142761696 CACCCCCAGCCTTCAGGGGAGGG + Intergenic
1049573362 8:143379672-143379694 GAGCCTCTGCCTCCAGGGGATGG + Intronic
1049622663 8:143605624-143605646 GAGCCGCAGTCCTCAGGGGAAGG + Exonic
1051365206 9:16316960-16316982 GAGCCTCAGCTCCCAGGAGAAGG - Intergenic
1052645777 9:31231520-31231542 GAGCCACCGCGCCCAGCGGAGGG - Intergenic
1052864033 9:33454151-33454173 AACCCAGAGTCCCCAGGGTATGG - Intergenic
1052990687 9:34517870-34517892 GACCCACAGCTCCCAGCTCAGGG - Intronic
1053135999 9:35650600-35650622 GACCCACAGTCCCCAGGCCTGGG + Exonic
1053268364 9:36732599-36732621 CACCCACTGCCCACAGAGGAGGG + Intergenic
1054743430 9:68830911-68830933 GAGCCACAGGCCTCAGGGAAAGG - Intronic
1055348570 9:75361743-75361765 GACCTACGGCCCTTAGGGGAAGG - Intergenic
1056126307 9:83538701-83538723 GAGCGACAGCGGCCAGGGGAGGG - Intergenic
1056766681 9:89448458-89448480 ATCCCACATCGCCCAGGGGAGGG - Intronic
1056822184 9:89851073-89851095 GCCCCACAGACCCCAGGGGCAGG + Intergenic
1057529391 9:95830956-95830978 GACCCAGCGGCCCCAGGGGATGG - Intergenic
1058718287 9:107741137-107741159 GAACAACAGACCCCAGGGGATGG - Intergenic
1060264171 9:122100805-122100827 GACCAACAGCCCACTGGGGTGGG + Intergenic
1060488135 9:124062554-124062576 GACCCACTGCCCTCTGGGAAAGG + Intergenic
1060495949 9:124118644-124118666 GAGCCACAGCCCCATGGGGAAGG - Intergenic
1060539740 9:124421309-124421331 GAAACACAGCTCCCATGGGAGGG + Intergenic
1061295688 9:129675557-129675579 GATCCACTGCCCCCAGGGGGCGG + Intronic
1061318993 9:129815917-129815939 GACCCACAGCCACAGGGGCAGGG - Intronic
1061446332 9:130640306-130640328 GTCCCAGAGCCCCCAAGGTAGGG + Intergenic
1061502445 9:131011711-131011733 GACCCCAAGGCCACAGGGGAAGG + Intronic
1061565643 9:131437912-131437934 CACCCACAGGCCCCAGTGGTGGG - Intronic
1061816376 9:133199800-133199822 GACCCACAGGCCCCACGGAAAGG + Intergenic
1061818277 9:133208787-133208809 GGCTCCCAGCCCCCAGTGGAAGG + Intronic
1061857133 9:133448558-133448580 GACCCAGAGCCCCAAGGGACAGG - Intronic
1062067407 9:134536159-134536181 GACCCACAGTCACCAGGGGCTGG - Intergenic
1062067426 9:134536215-134536237 GACCCACAGTCACCAGGGGCTGG - Intergenic
1062082336 9:134630633-134630655 GGGCCACAGCGCCCAGGTGAAGG - Intergenic
1062242175 9:135546571-135546593 GGCTCCCAGCCCCCAGTGGAAGG - Intronic
1062279646 9:135746310-135746332 GGCCCACAGCCCCTCGGTGAGGG + Intronic
1062550477 9:137083844-137083866 AACCCACAGTCCCCAGTGGAGGG + Exonic
1185620463 X:1450570-1450592 GACCCAGAGCCCCTAGGGATGGG - Intronic
1185711178 X:2304518-2304540 CAAGCACAGCACCCAGGGGATGG - Intronic
1185747286 X:2583622-2583644 GACCCAAGGCGCCCAGGGGGTGG + Intergenic
1186112239 X:6270664-6270686 GATCCCCAACCCCCAGGGCATGG - Intergenic
1188141647 X:26558270-26558292 GCCCCACGGCCCCCTGGAGAGGG - Intergenic
1189674200 X:43444099-43444121 GAGACAGAGCTCCCAGGGGAAGG - Intergenic
1191701574 X:64047925-64047947 CAGGCAGAGCCCCCAGGGGAAGG + Intergenic
1191723107 X:64251220-64251242 GACCCATAGACCCCAAGGGCAGG - Intergenic
1191807006 X:65146890-65146912 GACCCACAGACCCCTGCTGAAGG - Intergenic
1193210079 X:78797195-78797217 AACTCACAGCCCCAAAGGGAAGG - Intergenic
1197522645 X:127519461-127519483 GGACCAGAGCCCCCAGGGGTAGG + Intergenic
1197758284 X:130011195-130011217 CACCCACAGCTCCCAAGGGCAGG + Intronic
1200071173 X:153530233-153530255 CACCCAGATCCCCCAGGGGTTGG + Intronic
1200135446 X:153872435-153872457 CAGCCAGGGCCCCCAGGGGATGG + Intronic