ID: 1151925674 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:77194445-77194467 |
| Sequence | CTGGGGAGGCTGAGGTAGGA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 10768 | |||
| Summary | {0: 5, 1: 90, 2: 940, 3: 3161, 4: 6572} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1151925668_1151925674 | -7 | Left | 1151925668 | 17:77194429-77194451 | CCTGTAGTCCCAGCTACTGGGGA | 0: 3999 1: 108004 2: 233354 3: 246148 4: 165777 |
||
| Right | 1151925674 | 17:77194445-77194467 | CTGGGGAGGCTGAGGTAGGATGG | 0: 5 1: 90 2: 940 3: 3161 4: 6572 |
||||
| 1151925664_1151925674 | 12 | Left | 1151925664 | 17:77194410-77194432 | CCGGATGAGGTGGCATATACCTG | 0: 3 1: 2 2: 119 3: 2255 4: 18772 |
||
| Right | 1151925674 | 17:77194445-77194467 | CTGGGGAGGCTGAGGTAGGATGG | 0: 5 1: 90 2: 940 3: 3161 4: 6572 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1151925674 | Original CRISPR | CTGGGGAGGCTGAGGTAGGA TGG | Intronic | ||
| Too many off-targets to display for this crispr | |||||