ID: 1151925674

View in Genome Browser
Species Human (GRCh38)
Location 17:77194445-77194467
Sequence CTGGGGAGGCTGAGGTAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 10768
Summary {0: 5, 1: 90, 2: 940, 3: 3161, 4: 6572}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151925668_1151925674 -7 Left 1151925668 17:77194429-77194451 CCTGTAGTCCCAGCTACTGGGGA 0: 3999
1: 108004
2: 233354
3: 246148
4: 165777
Right 1151925674 17:77194445-77194467 CTGGGGAGGCTGAGGTAGGATGG 0: 5
1: 90
2: 940
3: 3161
4: 6572
1151925664_1151925674 12 Left 1151925664 17:77194410-77194432 CCGGATGAGGTGGCATATACCTG 0: 3
1: 2
2: 119
3: 2255
4: 18772
Right 1151925674 17:77194445-77194467 CTGGGGAGGCTGAGGTAGGATGG 0: 5
1: 90
2: 940
3: 3161
4: 6572

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151925674 Original CRISPR CTGGGGAGGCTGAGGTAGGA TGG Intronic
Too many off-targets to display for this crispr