ID: 1151926729

View in Genome Browser
Species Human (GRCh38)
Location 17:77203028-77203050
Sequence GAGTGGGAATTGAGGGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 479
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 447}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151926729 Original CRISPR GAGTGGGAATTGAGGGAAGC TGG Intronic
900159428 1:1216474-1216496 CAGTGGGAGCTCAGGGAAGCCGG - Intergenic
900208140 1:1440191-1440213 GAAGGGGAATCGCGGGAAGCTGG + Exonic
900635336 1:3662095-3662117 GAGTGGCAATTTGGGGCAGCAGG - Intronic
901242918 1:7705144-7705166 GAGTGGGAAGTGTGGGGATCCGG + Intronic
901246118 1:7732572-7732594 GAGCGGGAATGGAGGGAGCCAGG + Exonic
901252908 1:7795403-7795425 GAGCGGGAGTTCTGGGAAGCGGG + Intronic
901433642 1:9233497-9233519 GGCTGGGAACTGAGGGGAGCTGG - Intergenic
902337307 1:15760907-15760929 CAGTGGGACGGGAGGGAAGCCGG + Intronic
902474748 1:16676563-16676585 GATGGGGAATGGAGGCAAGCCGG + Intergenic
902494861 1:16863684-16863706 GATGGGGAATGGAGGCAAGCCGG - Intronic
902761789 1:18585894-18585916 GAGTGGGGGTGGGGGGAAGCTGG + Intergenic
903216721 1:21847520-21847542 GAGAGGGAGTGGAGGGACGCTGG + Intronic
905417156 1:37811916-37811938 GGTTGGGCATTGAGGGAAGGTGG - Exonic
905446356 1:38030598-38030620 GAGGGGGACTGGAGGAAAGCTGG - Intergenic
905961918 1:42050143-42050165 GGATGGGAGTAGAGGGAAGCTGG + Intergenic
906073411 1:43034442-43034464 GAAAGGGAAGGGAGGGAAGCGGG - Intergenic
906209112 1:44002491-44002513 AGGTGGGAAGTGAGGGAAACCGG - Exonic
908420794 1:63956559-63956581 TAGTGGGAATTAAGGGAATTTGG - Intronic
909659290 1:78064380-78064402 CACTGGCATTTGAGGGAAGCAGG - Intronic
909925005 1:81428581-81428603 GAGAGGGAAGTGGGGGATGCAGG + Intronic
910985684 1:93002663-93002685 GAATGGGAATAGAGGGAGGTGGG - Intergenic
910989032 1:93035915-93035937 GAGTGGGAACTGAGGAAGGATGG + Intergenic
911723802 1:101220238-101220260 TGGGGAGAATTGAGGGAAGCAGG + Intergenic
912422980 1:109558854-109558876 GAGTGGGAAAGAAGGGATGCAGG + Intronic
912483394 1:110003498-110003520 GAGTGGGGATGGAGGGTAGGGGG + Intronic
912588046 1:110784705-110784727 TAGTGGGAATTGAGAGAAACAGG - Intergenic
914013672 1:143798304-143798326 GATGGGGAATGGAGGCAAGCCGG + Intergenic
914164152 1:145162883-145162905 GATGGGGAATGGAGGCAAGCCGG - Intergenic
914652296 1:149706913-149706935 GATGGGGAATGGAGGCAAGCCGG + Intergenic
914678487 1:149922206-149922228 GAGTGGATATTGAGGGAAGCTGG - Intergenic
915013587 1:152712777-152712799 GAGTGGGAATGGAGGTAAGGAGG + Intergenic
915635813 1:157185694-157185716 GAGTGGGCTTTGAGAAAAGCAGG + Intergenic
916592379 1:166204859-166204881 CAGTGGGAGTTGGGGGAAGAGGG - Intergenic
918216312 1:182394465-182394487 GGGTGGCAATTTAGGGAAGAAGG - Intergenic
918309841 1:183278068-183278090 GACTTGGCATTGAGGGAACCAGG - Intronic
918513448 1:185336573-185336595 GATTGGGAAGAGAGGGAGGCTGG + Intergenic
918522954 1:185434965-185434987 GAGAGGGAAGAGAGGGAAGAGGG - Intergenic
919512794 1:198487698-198487720 GAGTGGGAAATAAGGTCAGCTGG - Intergenic
919534142 1:198765757-198765779 GAGTGGGAATAGAGGCAAGGAGG - Intergenic
919980076 1:202637539-202637561 GGCTGGGACTTGAGGGCAGCCGG - Intronic
920696867 1:208187426-208187448 GATTTGGAAGGGAGGGAAGCAGG + Intronic
920867036 1:209761786-209761808 GAGTGGGGAGTGAGGGGATCTGG - Intronic
920877152 1:209847367-209847389 GAGTGGGGATAGAGAGAAGATGG - Intronic
921440113 1:215175641-215175663 GAGTGGGAAGGGAGGGAAGGGGG - Intronic
921959860 1:221023240-221023262 CAGTGGGAATTGGTGGATGCTGG - Intergenic
922176960 1:223204515-223204537 GAGGGGGAATTGAGGGACAAAGG - Intergenic
922194875 1:223351366-223351388 GAGTGGGGACTGAGGGCACCTGG - Intronic
923110543 1:230886417-230886439 GAGTGGGAAGAGAAGGAACCTGG - Intergenic
924424668 1:243940385-243940407 GACTGGGAAGGGAGGGAAGGAGG + Intergenic
1063665187 10:8056386-8056408 ATGTGCGAATTGAGGGACGCTGG - Intronic
1064048822 10:12042854-12042876 GAGGGGGAGCTGAGGGAAGGCGG - Intronic
1064356553 10:14624102-14624124 GAGAGGCAGGTGAGGGAAGCTGG + Intronic
1066107019 10:32165248-32165270 GAGTGGGAGGAGAGGGAGGCTGG + Intergenic
1068612884 10:59079861-59079883 GAGTGAGAAATCTGGGAAGCTGG - Intergenic
1069646352 10:70001342-70001364 GAGTGGGAGCTGAGGGAAGGGGG - Intergenic
1069913432 10:71773280-71773302 GAGTGGGAACTGTGGGATGGGGG - Intronic
1070542346 10:77425311-77425333 GAGGGGGCATTTAGGGAAACTGG - Intronic
1070822810 10:79372360-79372382 GATTGGGAAGTGAGGGGAGAGGG + Intergenic
1071301768 10:84261457-84261479 GAGTGGGAATTGGGGGGTGTGGG - Intergenic
1071531297 10:86391991-86392013 GAGAGGGAGCAGAGGGAAGCAGG + Intergenic
1073585395 10:104704999-104705021 GGTTGGGAAATGAGGGAAGAGGG - Intronic
1073605919 10:104895544-104895566 GAGTGTGAGCTGAGGGATGCTGG - Intronic
1073787306 10:106903958-106903980 AAGTGAGGATTGAGGGAAGAAGG - Intronic
1074414214 10:113253123-113253145 GAGGGGGAAGGGAGGGAGGCAGG - Intergenic
1074473216 10:113745888-113745910 GTGTGTGTATTGGGGGAAGCAGG + Intergenic
1074629829 10:115239940-115239962 GAGTGGGAGTTGAGGGATGAAGG + Intronic
1075360354 10:121826760-121826782 GAGTGGGGAGAGAGGGAAGGTGG - Intronic
1075814527 10:125254670-125254692 GAGGAGGAATTGGGGGAGGCGGG - Intergenic
1075831905 10:125419144-125419166 GAGTGGGAATTGGGGTAGACCGG + Intergenic
1076808532 10:132873266-132873288 GAGTGGGAAATTAGGAAAGTTGG + Intronic
1077574978 11:3376106-3376128 GAGTTGGGATGGAAGGAAGCTGG - Intronic
1078454310 11:11463142-11463164 CAGTGATAACTGAGGGAAGCAGG - Intronic
1079089064 11:17468108-17468130 GAATGGGAGCTGGGGGAAGCAGG - Intronic
1079803036 11:24895504-24895526 GAGTGGGGAGTGAGGGAGGCAGG - Intronic
1080156995 11:29122953-29122975 TAGTAGGAATTTAGGGAAGTGGG - Intergenic
1081534557 11:43987549-43987571 GTCTGGGAATGGAGGGAAGCAGG + Intergenic
1082954744 11:58857855-58857877 GAGTAGGGAATGAGGGTAGCAGG - Intronic
1083305187 11:61758317-61758339 GAGAGGGGAGTGAGGGAGGCCGG - Intronic
1083684636 11:64368938-64368960 GAGTGGAATTTGAGGGGAGTAGG + Intronic
1084399738 11:68936719-68936741 TCGTGGGAATTGAGGGAAGGAGG - Exonic
1084433497 11:69124164-69124186 GCGGGGGCATTGAGGGCAGCTGG + Intergenic
1085083839 11:73653798-73653820 GAGTGGGTAAGGAGGGAAGGAGG + Intronic
1085479098 11:76806962-76806984 GAGAGGGAAGGGAGGGAAGGAGG + Intergenic
1086522302 11:87683339-87683361 GACTGGGGATTGAGTGAAACAGG + Intergenic
1086572901 11:88305712-88305734 GAGATGGAATTGAGTGAAGTAGG - Intronic
1088908871 11:114175693-114175715 CAGTGGGAAATGAGAGAGGCAGG + Intronic
1089311648 11:117562000-117562022 GAGTGGGGACAGTGGGAAGCAGG + Intronic
1089396745 11:118141096-118141118 GAATGGGAATGGGGGGAAGGAGG + Intronic
1089401081 11:118165083-118165105 GAGGAGGAGTGGAGGGAAGCAGG - Exonic
1089615819 11:119694202-119694224 TAGTGGGAATCAGGGGAAGCAGG + Intronic
1089714045 11:120338692-120338714 GAGCGAGAATTGAATGAAGCAGG - Intronic
1090287082 11:125509273-125509295 GAGAGGGAAGTGAGGGATGTAGG + Intergenic
1090806993 11:130209006-130209028 GGGTGGGTATGAAGGGAAGCAGG + Intronic
1090900535 11:131026959-131026981 AAGTGGGAACTGAAGAAAGCTGG + Intergenic
1091300480 11:134504065-134504087 GAGTGGGCTTGGAGGGATGCTGG + Intergenic
1091303527 11:134523105-134523127 GAGTGGGGATGGAAGGAAGGTGG + Intergenic
1092913749 12:13171375-13171397 GTGTGGGAATGGCAGGAAGCGGG + Intergenic
1092968482 12:13668986-13669008 GAGAGGGAATGGAGGGGAGGTGG + Intronic
1096248842 12:50013663-50013685 GTGTGGGACTTGAGGGAAATAGG - Intronic
1096518265 12:52170264-52170286 GAGTGGGCATGGAGGGAGGAAGG + Exonic
1096589374 12:52647333-52647355 CAGTGAGTATTGAGGGCAGCTGG - Intronic
1097053373 12:56236754-56236776 GGGTGGGAACGGAGGGAAGCAGG + Intronic
1097386986 12:58962014-58962036 GAGTGGGGAGAGAGGGCAGCAGG - Intergenic
1098841939 12:75487707-75487729 GAGTAGGAAGTGAGGCAAGAGGG - Intronic
1100393674 12:94165879-94165901 GAGGAGGAAGTGAGGGAAGAGGG + Intronic
1100746353 12:97650559-97650581 GAGTAGCAATTGGGAGAAGCAGG - Intergenic
1101331550 12:103761573-103761595 GAGTGGGGATGGCAGGAAGCAGG - Intronic
1102439482 12:112950274-112950296 GGGAGGGAATTGATGGAAACAGG + Intronic
1102531354 12:113548570-113548592 GAGTGGGAAGGGAGGGAGCCAGG + Intergenic
1102580374 12:113882636-113882658 GACTGAGAATTATGGGAAGCGGG + Intronic
1103282563 12:119772002-119772024 CAGTTGGAATTTAGGGGAGCTGG + Intronic
1103305823 12:119963181-119963203 GTGGGGGAAGTGAAGGAAGCAGG + Intergenic
1104420671 12:128631987-128632009 GAGTGGGGATGGGGGGAAGGGGG + Intronic
1104928840 12:132327946-132327968 GAGTGGGAGGTGACGGGAGCTGG - Intronic
1105007336 12:132729522-132729544 GAGGGGGAGGTGAGGGAAGGGGG + Intronic
1105007347 12:132729544-132729566 GAGGGGGAGGTGAGGGAAGGGGG + Intronic
1105831874 13:24169721-24169743 GAATGGGAGGTGAGGGAAGAAGG + Intronic
1105953481 13:25255947-25255969 GAGTGGGAATGGAGGCTAGGAGG - Intronic
1106665557 13:31847084-31847106 GGGTGGGGACCGAGGGAAGCGGG + Intergenic
1108427089 13:50313342-50313364 GGGAGGGAAGTGGGGGAAGCAGG + Intronic
1109272703 13:60272238-60272260 GTGTGGATTTTGAGGGAAGCTGG - Intergenic
1110633448 13:77737016-77737038 GAGTTGGAGTTCAGGGAAGAGGG - Intronic
1110668149 13:78142274-78142296 GTGTGGGAGTTGAAGGAAGAAGG + Intergenic
1110680730 13:78309069-78309091 AAGTGGGAGGTGAGGGAAGGAGG + Intergenic
1111542551 13:89688515-89688537 AAAAGGGAAATGAGGGAAGCAGG + Intergenic
1112326057 13:98443546-98443568 GAGTGGGAACTGGGAGAGGCTGG - Intronic
1112369551 13:98782728-98782750 GGGTGGGAATTGGAGGAAGTGGG + Intergenic
1112416304 13:99206086-99206108 GAGAGGGAATGCAGAGAAGCAGG + Intronic
1112494155 13:99892822-99892844 CTGTGGGAATTGAGAGAAGTGGG - Exonic
1112823966 13:103370306-103370328 CAGTGGGAGATGAGGGTAGCTGG + Intergenic
1115441689 14:33443088-33443110 CAGTGTTAACTGAGGGAAGCTGG - Intronic
1115926628 14:38442966-38442988 GAGTGGGAAGGGTGGGAAGAGGG - Intergenic
1116426814 14:44800440-44800462 GAGTGGGGAGAGAGGGAAGGGGG + Intergenic
1119046825 14:71325850-71325872 AAGTTGAAATTGCGGGAAGCAGG + Intronic
1120647236 14:87088626-87088648 AAGTGGGAAGTGGGGGAAGTTGG + Intergenic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1121780798 14:96620937-96620959 GAATGGGCATGGAGTGAAGCCGG - Intergenic
1122033840 14:98933371-98933393 GAGGGAGCATTGAGGAAAGCAGG + Intergenic
1122279125 14:100610799-100610821 GAGGGGGTACTGAGGGGAGCAGG + Intergenic
1122373262 14:101241202-101241224 GAGTGGGACCTGCAGGAAGCGGG - Intergenic
1123993319 15:25701034-25701056 GACTGGGAATGGTGGGAATCTGG + Intronic
1124495689 15:30185584-30185606 GGCTGGGACTTGAGGGCAGCTGG - Intergenic
1124747884 15:32353062-32353084 GGCTGGGACTTGAGGGCAGCTGG + Intergenic
1125721934 15:41849374-41849396 GAGTGGGGATTGGGGAAAGCAGG + Intronic
1128986276 15:72224048-72224070 GAGTGGTCTTTGAGGGAAGTAGG - Intronic
1129210136 15:74063662-74063684 GAGTGGGCAAAGAGGGAAGGAGG - Intergenic
1129403885 15:75301740-75301762 GAGTGGGCAAAGAGGGAAGGAGG + Intergenic
1129713465 15:77833364-77833386 GAGTGGGCATTGAGGGGTCCAGG + Intergenic
1129842075 15:78750106-78750128 GAGTGGGCAAAGAGGGAAGGAGG + Intergenic
1130063735 15:80588087-80588109 CAGTGAGAATGGAGGAAAGCAGG + Intronic
1130970362 15:88727475-88727497 GAGTGATGATTAAGGGAAGCTGG + Intergenic
1131451174 15:92541530-92541552 GAGCAGGGAGTGAGGGAAGCCGG - Intergenic
1133325176 16:4937571-4937593 TGGTGGCAATTGAGGGAAGGGGG + Intronic
1133443126 16:5837127-5837149 CAGGGGGATTTGAGCGAAGCAGG - Intergenic
1133732117 16:8586900-8586922 GTGTGGGAGTTGAGGAAAGGTGG - Intronic
1134301935 16:12999819-12999841 GAAAGGGCATTGCGGGAAGCAGG - Intronic
1134507276 16:14818490-14818512 CAGTGGGAGTTTAGGGAAGATGG - Intronic
1134694977 16:16217248-16217270 CAGTGGGAGTTTAGGGAAGATGG - Intronic
1134976854 16:18577404-18577426 CAGTGGGAGTTTAGGGAAGATGG + Intergenic
1136565772 16:31069306-31069328 GAGTGGGAGGTGAGGTAGGCAGG - Intronic
1136637880 16:31537431-31537453 GAGTGGGAACTGAGAGGCGCCGG - Intergenic
1136655556 16:31707066-31707088 GGGAGAGAAGTGAGGGAAGCCGG + Intergenic
1136984389 16:35085137-35085159 AGGTGGAAAGTGAGGGAAGCTGG + Intergenic
1137961402 16:52885385-52885407 GGATGGGAAAGGAGGGAAGCAGG - Intergenic
1138438779 16:57021874-57021896 GTGTGGGAATTGCGGGGGGCGGG + Intronic
1139133090 16:64169644-64169666 GAGTGGGAAATGGGGGGAGGAGG - Intergenic
1139593241 16:67944546-67944568 GAGTGGGGTTTGAAGGCAGCCGG - Exonic
1139662436 16:68430205-68430227 GAGGGGGCATAGAGGGAAGAGGG - Intronic
1140191708 16:72823091-72823113 GAGTGGGGAGTGAGAGAAGGGGG + Intronic
1140417624 16:74787412-74787434 GAGTGGGAACAGGGGGAAGAAGG - Intergenic
1140565599 16:76037494-76037516 GAATGAGAATTGAGCGAAGGGGG + Intergenic
1140943861 16:79749198-79749220 GAGTGGGAAGTGAGAGAGGGAGG - Intergenic
1141127282 16:81409548-81409570 GAGGGGGTATTGGGAGAAGCAGG + Intergenic
1141153956 16:81583912-81583934 GAGAGGGAATCGTTGGAAGCAGG + Intronic
1141634422 16:85306361-85306383 GAGCGGCAGTTGAGGGAAGTGGG + Intergenic
1141884041 16:86879585-86879607 GAGATGGACGTGAGGGAAGCAGG - Intergenic
1142608433 17:1095121-1095143 GAGGGGGAAATAAGGGAAGCAGG + Intronic
1143473336 17:7190014-7190036 GAGTGGGAAATGCGGGAGGGAGG - Exonic
1143508974 17:7384787-7384809 GAGAGCGAATGGAGGGAAGAGGG - Intronic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1145835569 17:27952125-27952147 GCGTGGGATGAGAGGGAAGCAGG + Intergenic
1145978357 17:28997154-28997176 GCGTGGGAATTGAGGGAAGGGGG + Intronic
1147133020 17:38419905-38419927 GACTGGGAAAGGAGGGGAGCCGG - Intergenic
1147742081 17:42675499-42675521 GAGGGGGGAGGGAGGGAAGCAGG - Intronic
1147797993 17:43059551-43059573 GAGTGGGAAAGGCAGGAAGCAGG - Intronic
1148284144 17:46372984-46373006 GAGCGGGACTTGAGGGTAGCAGG + Intergenic
1148306365 17:46590905-46590927 GAGCGGGACTTGAGGGTAGCAGG + Intronic
1148468410 17:47878438-47878460 GAGAGGGAACTGAAGGAATCAGG - Intergenic
1149588392 17:57809180-57809202 GAGTGGGGAGAGAGGGAGGCAGG + Intergenic
1151304137 17:73252103-73252125 GAGTGGGAATAAAGGGATGAGGG + Intronic
1151926729 17:77203028-77203050 GAGTGGGAATTGAGGGAAGCTGG + Intronic
1152231778 17:79117522-79117544 GTGTGGGTGTGGAGGGAAGCGGG - Intronic
1152806620 17:82359831-82359853 GAGGGGAACTTGAGGGAAACTGG - Intronic
1153063039 18:1013752-1013774 GAGTGGGTTTTGGAGGAAGCTGG + Intergenic
1153997394 18:10454412-10454434 GAGAGGGGAAGGAGGGAAGCGGG + Intergenic
1154070453 18:11148353-11148375 GAGTGGGAAGTGAGAGAGCCAGG + Intronic
1155068062 18:22285659-22285681 GAGTGGGAAGTGAGGGGAAGGGG + Intergenic
1155968538 18:32058758-32058780 TAGTGGGGATTGGGGGAAGTGGG - Intronic
1156524669 18:37755699-37755721 AACTGGGAATGGAGGAAAGCTGG - Intergenic
1156683914 18:39621542-39621564 GAGAGGGAATGGAGGGCAGTTGG - Intergenic
1156914443 18:42448491-42448513 GAGTGGTGATTTAGGGTAGCAGG - Intergenic
1157349226 18:46870045-46870067 GAGGAGGAATTGAGTGAAGGGGG - Intronic
1157584212 18:48790929-48790951 GAGCAGGGATTGGGGGAAGCTGG - Intronic
1157798334 18:50597116-50597138 GAATGGGAATTGACTGAAGGGGG - Intronic
1158213041 18:55071234-55071256 GAATGGAAATCGAGGGCAGCTGG - Intergenic
1158855797 18:61542430-61542452 GGGAGGGAAGTGAAGGAAGCAGG + Intronic
1160059234 18:75514597-75514619 GAGTGGGGCCTGAGGGAAGTTGG + Intergenic
1160390494 18:78527699-78527721 GAGTGGGAGCTGTGGGGAGCAGG - Intergenic
1160614644 18:80115730-80115752 AACTGGGAAGTGATGGAAGCAGG - Intronic
1160972459 19:1775634-1775656 GAGTGGGCATGGAGGGAGGAAGG - Exonic
1161258896 19:3324720-3324742 TAGTGGGAAGAGAGGGAAGAAGG - Intergenic
1161540002 19:4844805-4844827 GAGAGAGAAGTGAGGGAAGGAGG + Intronic
1163680962 19:18682340-18682362 GAGTGGTAAGCCAGGGAAGCAGG - Intergenic
1165095385 19:33407166-33407188 GATCGGGAAGTGAGGGAGGCAGG + Intronic
1165452053 19:35889509-35889531 GAGAGGGAATTGAAGGGAACAGG + Intronic
1167867152 19:52337497-52337519 GAGAAGGAATAGAGGGAAGAGGG + Intronic
1167889633 19:52528924-52528946 GAGAAGGAATAGAGGGAAGAAGG + Intronic
1167903111 19:52637103-52637125 GAGAAGGAATAGAGGGAAGAAGG - Intronic
1167958804 19:53089891-53089913 GAGAAGGAATGGAGGGAAGAAGG - Intronic
1168472685 19:56652243-56652265 CAGCGGGGAGTGAGGGAAGCTGG + Intronic
925425639 2:3746973-3746995 GAGAGGGCCCTGAGGGAAGCAGG + Intronic
925814260 2:7732369-7732391 AAGTGGGAATGGAGAGGAGCAGG - Intergenic
926123943 2:10260003-10260025 GAGCGGGCAATGAGGGAACCGGG + Intergenic
926776781 2:16430987-16431009 GGGTGAGAATTTAGGGAAGTGGG - Intergenic
927694729 2:25232074-25232096 GGGTGGGGAGTGGGGGAAGCAGG - Exonic
927966994 2:27276562-27276584 GAGTGGGATTTGTGGCTAGCAGG - Intronic
930685186 2:54300207-54300229 GAGTGGTAATTGATGGAACAAGG - Intronic
932356064 2:71069093-71069115 GAGTGGGAGTGGGGAGAAGCGGG + Intronic
932497306 2:72152613-72152635 GAGTGGGCATTGAGGGACTCTGG - Intergenic
933315942 2:80715205-80715227 CAGTGGCATTTGAGGAAAGCAGG + Intergenic
937060385 2:118976465-118976487 GAGGGGAAATTGAGGGATCCAGG - Intronic
937627913 2:124064536-124064558 GAGTGAAAATTGATGGATGCAGG - Intronic
938765792 2:134459851-134459873 AGCTGGGAATTGAGGGGAGCAGG - Intronic
939571788 2:143848498-143848520 GAGTGAGAAAAGAGGGAAGGAGG - Intergenic
940025178 2:149199111-149199133 GAGGGAGAAATGCGGGAAGCAGG + Intronic
941122367 2:161545654-161545676 TAGTGGTAACTGAGGGAGGCAGG + Intronic
942189739 2:173457848-173457870 GAGTGGGAATGGGGGGAGGGCGG - Intergenic
942503050 2:176612140-176612162 GAGTGAGAATTGTGGGAAGTGGG - Intergenic
943949861 2:194119900-194119922 GAGAGGGAAATGAGGGATGTAGG + Intergenic
944155726 2:196605457-196605479 GAGAGGGGATTCTGGGAAGCTGG + Intergenic
944679653 2:202065406-202065428 GATTGGGGATTGATGGAAGAGGG - Intergenic
944912776 2:204326710-204326732 GAGTGTGTATTGAGGGTAGAGGG + Intergenic
946121906 2:217523490-217523512 GCCTGGGAAGGGAGGGAAGCTGG + Intronic
946164077 2:217853253-217853275 GAGAGGGACTTAAGGGAGGCTGG + Intronic
946953705 2:224905782-224905804 GAGTGGGCAGAGAGGAAAGCGGG - Intronic
947455751 2:230252427-230252449 AAGAGGGAAATGAGGGAGGCAGG + Intronic
948996272 2:241581189-241581211 GAGTGGGAATTGGAGGGAGTGGG - Intergenic
1168744072 20:221336-221358 GGGAGGGAATGGAGGGAAGGAGG + Intergenic
1170100037 20:12688837-12688859 TAGTGGGGATTGAGGAAAGGTGG - Intergenic
1170938122 20:20827198-20827220 CAGTGGGAACTCAGGGAAGAGGG + Intergenic
1171394357 20:24821966-24821988 GAGTGGGGATTGGAGGAAGATGG - Intergenic
1172116424 20:32576043-32576065 GAGAGGGAATTGAGAGCAGTGGG + Intronic
1172292959 20:33789373-33789395 GGGTGGGAAGTGAGGCAGGCAGG - Intronic
1172460285 20:35112956-35112978 GAGTGGGAAAGGAGGGAGGGAGG + Intergenic
1172674718 20:36660306-36660328 GGGTTGGAAGTGAGGGAAGAAGG + Intronic
1173495316 20:43514140-43514162 GAGACGGAAGTGGGGGAAGCTGG + Intronic
1174359343 20:50018082-50018104 GAGTAGGAATGGAGGGAGGGAGG - Intergenic
1174589902 20:51636649-51636671 CAGCTGGAATTGAGGGGAGCTGG - Intronic
1174898733 20:54476352-54476374 GAGTGGGAAAAGAGGGGAACCGG - Intronic
1177572629 21:22906960-22906982 CAGTGGGAATTTAGAGAATCAGG - Intergenic
1178408400 21:32344860-32344882 GAGTGGGTAGTGTGGGGAGCAGG - Intronic
1180156115 21:45978014-45978036 GAGGGGGAAAGGAGGGAAGGGGG + Intergenic
1180177544 21:46097976-46097998 GAGGGGGATGGGAGGGAAGCGGG - Intergenic
1181118719 22:20650840-20650862 GTGTGGGAATTGTGGGGAGAAGG - Intergenic
1181311603 22:21947761-21947783 GAGTGGGAAGTAAGAGATGCAGG + Intronic
1183346670 22:37311975-37311997 GGGTGGGAAGAGAGGGAGGCTGG - Intronic
1183361331 22:37384741-37384763 GAGTGGGAATTGGGGTCAGGTGG - Intronic
1184096712 22:42320016-42320038 TGGTGGGAATGGAGGGAAGATGG - Intronic
1184127990 22:42501054-42501076 GAGTGGAAATTTAGGGCAGGCGG - Intergenic
1184136779 22:42554369-42554391 GAGTGGAAATTTAGGGCAGGCGG - Intronic
1185164402 22:49251912-49251934 GAGTGTGAGCTGAGGGAAGGAGG + Intergenic
1185391046 22:50562086-50562108 GAGTGTGCAGTGAGGGGAGCGGG + Intronic
949508006 3:4744832-4744854 AAATGGGAATTCAGGGAAACAGG + Intronic
949566312 3:5248061-5248083 GACTGGGTATTCAGTGAAGCAGG - Intergenic
949908567 3:8880386-8880408 GGGTGGGAGTTGGGGGATGCTGG + Exonic
949916876 3:8971965-8971987 CAGTGAGAAAGGAGGGAAGCTGG + Intergenic
952482165 3:33772654-33772676 GATTGGGAGAAGAGGGAAGCAGG + Intergenic
952683243 3:36120213-36120235 GGGTAGGTATTGGGGGAAGCTGG + Intergenic
952722231 3:36545371-36545393 AGGTGGGAAGTGAGGGATGCAGG - Intronic
953135112 3:40175497-40175519 GAATGGGAAAGGAGGGCAGCAGG - Intronic
953447100 3:42977979-42978001 GGTTGGGAAATGAGGGAAGAGGG - Intronic
954722761 3:52579775-52579797 CAGTGGGAATTGAGAGCAGGAGG - Intronic
954844011 3:53538953-53538975 GAGTGGTGACTGAGGGAAGTGGG - Intronic
954954518 3:54507705-54507727 GTCTGGGAATGGAGGGAGGCTGG + Intronic
955047403 3:55373031-55373053 AAGGGGGCATTGAAGGAAGCTGG - Intergenic
955163498 3:56488066-56488088 TAGTGGGAATTGAGGCAGGAGGG - Intergenic
955754304 3:62212625-62212647 GAGTTGGGAGTGAGGAAAGCTGG + Intronic
956027765 3:65001791-65001813 CAGTGTGAATTGAGGCAAGGTGG - Intergenic
957467081 3:80608087-80608109 GAGGGGGAAGGGAGGGAAGGAGG + Intergenic
957794188 3:84981671-84981693 GAATGGGAAGGGAGGGAAGGAGG - Intronic
957997280 3:87706482-87706504 GAGTGGGAGATGTGGGAAGATGG - Intergenic
958449072 3:94250941-94250963 GAGAGGGAAATGGGGGATGCAGG + Intergenic
959015147 3:101125124-101125146 GAGAAGGAATTTGGGGAAGCTGG - Intergenic
959899871 3:111648739-111648761 GAGTGGGTAGTGGGGGAAGGAGG - Intronic
959984945 3:112561898-112561920 GAGTGAGAAGGAAGGGAAGCCGG - Exonic
961145012 3:124586210-124586232 GGCTGGGAATTGAGGGAAAGGGG + Intronic
961543507 3:127616812-127616834 GAGTGGGAAGTGAGAGGAGGAGG - Intronic
961609026 3:128121868-128121890 GAGTGGAAATTGAGGGAGAATGG - Intronic
961871911 3:129994562-129994584 AAAGGGGAATTGAGGGAACCTGG - Intergenic
962053699 3:131846490-131846512 GAATGGGGATAAAGGGAAGCTGG - Intronic
962214133 3:133505162-133505184 GAGTGGGGATTTTGGGATGCTGG + Intergenic
962480375 3:135792813-135792835 CAGTGGAAGATGAGGGAAGCTGG - Intergenic
962702637 3:138014251-138014273 GAGAAGGATTTTAGGGAAGCTGG + Intronic
962850035 3:139301511-139301533 CAGAGGGAATGAAGGGAAGCTGG - Intronic
963289449 3:143473130-143473152 CAGTGGGAAATGAGAGGAGCTGG - Intronic
963513807 3:146282330-146282352 AAGTGGGAATTGATAGAAGAAGG + Intergenic
963621456 3:147612458-147612480 GAGAGGGCATTGATGGAAGTGGG + Intergenic
964242343 3:154611261-154611283 GAGGGGGAAGGGAGGGAAGAAGG - Intergenic
964301294 3:155288375-155288397 GAGTGGCAATTTTGGGAGGCGGG - Intergenic
965267152 3:166558911-166558933 GAATGGGAAAAGAAGGAAGCAGG - Intergenic
965382272 3:168004708-168004730 GAGTAGGAATGGAGGGAAGGAGG - Intergenic
965397796 3:168181227-168181249 GAGTGGGGAATGAAGGAAGCTGG + Intergenic
966467846 3:180251763-180251785 GAGTGGGGATTTGGGGAAACCGG - Intergenic
966738806 3:183212584-183212606 GAGAGTGAATCTAGGGAAGCTGG + Intronic
966869972 3:184284031-184284053 GAGATGGCATGGAGGGAAGCTGG - Intronic
966916554 3:184587486-184587508 GAGAGAGATTGGAGGGAAGCTGG + Intronic
967092424 3:186146480-186146502 GAGCGGGAGTTGGGGGAAGGAGG - Intronic
967115320 3:186332373-186332395 CAGTGGAAATTTAAGGAAGCAGG + Intronic
967267250 3:187701649-187701671 GAGTTGGAACTGAAGGAAGGAGG - Intronic
967365559 3:188682564-188682586 GAATGGGGTTTGAGGGAAGCTGG + Intronic
968808319 4:2788822-2788844 GAGTGGGGATTGGGGGAGGTAGG + Intergenic
968953839 4:3708340-3708362 GAGTGAGAATGGAGAGAGGCGGG - Intergenic
969602179 4:8182951-8182973 GAGTGGGTTTTGAAGGAGGCAGG + Intronic
971109681 4:23571576-23571598 TACTGGGAATTGAGGTAAACTGG + Intergenic
973015396 4:45131063-45131085 AAGTGGCAATGAAGGGAAGCTGG - Intergenic
973142058 4:46781680-46781702 GAGAGGGAATGGTGGGAACCTGG + Intronic
974067369 4:57091435-57091457 TAATGGGAATTGAATGAAGCTGG - Intronic
974142762 4:57908701-57908723 AAGTGGGGATGGAGAGAAGCAGG + Intergenic
974429769 4:61780640-61780662 CAGTGGGAATGGATGGAAGAAGG - Intronic
974732488 4:65886628-65886650 TAGTGGAAATTGAGAGAATCTGG - Intergenic
975366401 4:73534205-73534227 GAGTGGGAACTGTGGGCAGGAGG + Intergenic
975599363 4:76083233-76083255 GAGTGGAAATTGAGGAAAGGTGG - Intronic
975958065 4:79866163-79866185 GATAGGGAATTGAGAAAAGCAGG - Intergenic
976400408 4:84600870-84600892 GAATGGAAATGGAGGGAGGCTGG + Intronic
980294329 4:130891159-130891181 GAGAGGGATTTGAAGGAAGAGGG + Intergenic
983855861 4:172643579-172643601 TAGTGGGAATTGTTGGAAGCTGG - Intronic
983991871 4:174129681-174129703 TAGTGGGAATGGAGAGAAGTGGG - Intergenic
985338539 4:188922213-188922235 TGGTGGGAATTGAGGCAAGGAGG - Intergenic
985933479 5:3077713-3077735 GAGTGGGAAAGGAGGGAGGCTGG + Intergenic
986212821 5:5690188-5690210 GTGAGGGAAGTGAGGGAAGCAGG - Intergenic
986503913 5:8429896-8429918 GAGTGGGGGCTGAGGGAGGCTGG - Intergenic
986662887 5:10074860-10074882 GAATGGGAGGTGAGGGAGGCAGG + Intergenic
987066610 5:14296117-14296139 GTGTGGGAAGTGAGAGAAGGGGG + Intronic
988716107 5:33829817-33829839 CTTTGGGAATTGAGGAAAGCTGG - Intronic
989137419 5:38168637-38168659 GAGTGGAAATTGAGGCAGGGAGG - Intergenic
989188460 5:38646844-38646866 TTTAGGGAATTGAGGGAAGCAGG + Intergenic
989195963 5:38716601-38716623 CAGGGAGAATTGAGGGATGCTGG + Intergenic
989997210 5:50849962-50849984 GAGAGGGATGAGAGGGAAGCAGG - Intergenic
990544967 5:56814459-56814481 GAGTGGGGACAGAGGGAACCCGG + Intergenic
990956393 5:61344402-61344424 AAGTGAGACTTGAGGGCAGCAGG + Intronic
992228910 5:74644135-74644157 GAAGGGGAAGGGAGGGAAGCAGG + Intronic
994135391 5:96280818-96280840 GAGTAGGAATTGAGGTAACAGGG - Intergenic
994140929 5:96340337-96340359 GAGTGGGGGTTGAGGGCAGAAGG - Intergenic
995949919 5:117699165-117699187 GAGTGGGAAATGAGAGATGAGGG - Intergenic
998091527 5:139373679-139373701 GAGAGGGCACTGAGGGAAGGTGG + Intronic
998116716 5:139543433-139543455 ACGTGGGTATAGAGGGAAGCTGG - Intronic
1001558744 5:172655339-172655361 GAGGGGGAAAGGAGGGAAACAGG - Intronic
1001777781 5:174341864-174341886 GACAGGGAATTGAGGGATGATGG + Intergenic
1002046086 5:176542634-176542656 GGCTGGGAAGTGAGGGAAGGAGG - Exonic
1002437781 5:179242747-179242769 GACTGGGATCTGAGGGAAGAGGG - Intronic
1002971465 6:2026247-2026269 GAGTTTGAAGTGAGAGAAGCTGG - Intronic
1003112589 6:3261978-3262000 ATGTGGGAGTTTAGGGAAGCTGG - Intronic
1004193544 6:13485674-13485696 GCCTGGGAGTTGAGGGGAGCAGG + Intronic
1004612621 6:17258972-17258994 GAGTGTCAATTAAGGAAAGCAGG - Intergenic
1005631890 6:27716115-27716137 TAGGGGGAATTGAGGGAATGGGG + Intergenic
1006451070 6:34106010-34106032 GAGTGGCAAGTGTGGGAGGCCGG - Intronic
1006970195 6:38035975-38035997 GAGAGGTAATGGATGGAAGCTGG - Intronic
1007029650 6:38616526-38616548 GAGTGGGAGGTGAGGCCAGCTGG + Intronic
1007818960 6:44545850-44545872 CAGTGGTAATAGAGGGAATCTGG - Intergenic
1007837640 6:44686510-44686532 CAGTGGGAAAGGAGGGAAGGGGG - Intergenic
1008437226 6:51490528-51490550 AAGTGGGGCTTGGGGGAAGCTGG - Intergenic
1008523431 6:52384081-52384103 GACTGGGGTTTCAGGGAAGCGGG + Intronic
1011238665 6:85246814-85246836 GAGGGGGAAGGGAGGGAAGGGGG - Intergenic
1012601454 6:101102590-101102612 GGGTGGGAACAGAGTGAAGCTGG - Intergenic
1012861520 6:104565830-104565852 GAGTGGAAGAAGAGGGAAGCAGG - Intergenic
1013289080 6:108705506-108705528 GTGTGGGATGTGAGGGAAGAGGG - Intergenic
1013345178 6:109253175-109253197 GAGTGCAAAGTGAGGGAAGGTGG - Intergenic
1013544229 6:111140004-111140026 GAGTGGGAAGAGTGGGAAGAGGG + Intronic
1014534702 6:122600787-122600809 GAGTAGGCATGCAGGGAAGCAGG + Intronic
1015244534 6:131062599-131062621 GCGTGGGGACTGCGGGAAGCCGG - Intronic
1016513117 6:144865127-144865149 AAGTGGGATTTTAGGAAAGCTGG + Intergenic
1017587081 6:155938269-155938291 AAGTGGGATTGGAGGGAAGGTGG + Intergenic
1017835499 6:158173794-158173816 GAGTGGGGAGGGTGGGAAGCAGG + Intronic
1017979779 6:159390565-159390587 GATTGAGAACTGAGGGGAGCAGG + Intergenic
1019103388 6:169649991-169650013 GAGGGGGAATAGAGGGATGGAGG - Intronic
1020035216 7:4959810-4959832 GAGTGGAAAGTGGGGGAAGTTGG + Intergenic
1020382820 7:7565670-7565692 GAGTGGGCATGGAGAGAAGTGGG - Intergenic
1021123147 7:16819717-16819739 GAGTGGGGAGGGAGGGAAGAGGG - Intronic
1021655734 7:22871932-22871954 TAGTGGGAATAAAGGGAAGGGGG - Intergenic
1022624919 7:32025366-32025388 GAGTGGGAGTTGAGGGTAGGGGG + Intronic
1023737577 7:43248471-43248493 TAGTGGAAGTTTAGGGAAGCTGG - Intronic
1025002742 7:55331123-55331145 GAGTGGGAGGGGAGGGAAGTTGG - Intergenic
1026148907 7:67771711-67771733 GAGTGAGAACTGAGGGATCCAGG - Intergenic
1026307541 7:69154908-69154930 GAGGGGGAAGGGAGGGGAGCAGG - Intergenic
1027426884 7:78070018-78070040 GTTTGGGAATTGAGGAAGGCTGG + Intronic
1027941963 7:84694096-84694118 GGCTGGGAATTGAGGGAATTGGG - Intergenic
1028492293 7:91425596-91425618 GTGTGGGAAGTCAGGGAAGTGGG - Intergenic
1028582959 7:92425561-92425583 GAGTTGGAATGCAGGGAAACTGG + Intergenic
1028600301 7:92593512-92593534 GAGTGGGAAGGGAGGGAAGTGGG - Intergenic
1030205138 7:106945102-106945124 AAGTGGGAGTTGGGGGAAGGAGG - Intergenic
1030346364 7:108437274-108437296 GAGTGGGAAGTGGGGGAAATGGG + Intronic
1031214600 7:118873951-118873973 GAGTGGGGCTAGAGGGAAGGTGG - Intergenic
1031448063 7:121879348-121879370 GAGAGGGCAATGAGGGATGCAGG + Intronic
1031633216 7:124069245-124069267 GAGTGGGGAGTGTGAGAAGCAGG + Intergenic
1031749742 7:125556937-125556959 GAGTGATAATTTAGGGTAGCTGG - Intergenic
1032499291 7:132388009-132388031 CGGTGGGAATTGATTGAAGCTGG - Intronic
1032777895 7:135134075-135134097 GGATGGGAAAGGAGGGAAGCAGG + Intronic
1033063037 7:138126194-138126216 GAATCTGAAGTGAGGGAAGCAGG - Intergenic
1035112018 7:156491146-156491168 GAGGGGGAGTTGGGGGATGCGGG + Intergenic
1035299379 7:157887413-157887435 GAGTGGGTACTGGGGGAAGTGGG - Intronic
1035299413 7:157887522-157887544 GAGCGGGTACTGGGGGAAGCGGG - Intronic
1036020709 8:4842214-4842236 GTGTGGGAATTAAGGGAACCAGG + Intronic
1036285893 8:7443889-7443911 CAGTGGGTATTGGGAGAAGCCGG - Intronic
1036335580 8:7867640-7867662 CAGTGGGTATTGGGAGAAGCCGG + Intronic
1037305544 8:17499394-17499416 GAGAGAGAATGGAGGGAAGAGGG - Intronic
1037917617 8:22781964-22781986 GAGGGGGAACTGAGGTCAGCAGG - Intronic
1037982100 8:23261641-23261663 GAGTGGGGACTGCAGGAAGCAGG - Exonic
1039094062 8:33864265-33864287 GAATGGTAAATGAGGAAAGCAGG - Intergenic
1039603793 8:38864603-38864625 AAGTGGGAATTTCAGGAAGCTGG + Intergenic
1041713337 8:60912281-60912303 AAGTGGGGAGTGAGGAAAGCAGG + Intergenic
1042186153 8:66138199-66138221 GAGTGGGAAATGAGGATAACGGG - Intronic
1042210422 8:66375177-66375199 GGGTGGGAATTGAGGAAGGAGGG - Intergenic
1043461738 8:80467412-80467434 GAGGGAGAATTGAGAGAAGTTGG - Intergenic
1043814212 8:84781693-84781715 CAGTGGGAATTGAGGGAGGTGGG + Intronic
1044291671 8:90478919-90478941 CAGTGGGAAATGAGGAAATCAGG - Intergenic
1044803773 8:95983755-95983777 GAGAGGGAATGGAGGGGAGGGGG + Intergenic
1045541879 8:103094425-103094447 GAGGGGGAAGGGAGGGAAGGTGG - Intergenic
1048226363 8:132590198-132590220 GGGAGGCAATGGAGGGAAGCTGG + Intronic
1048908233 8:139109196-139109218 GACTGGGAAATGAGGTTAGCTGG - Intergenic
1049227888 8:141466378-141466400 GAGTGGGCAGTGAGGCAAGAGGG + Intergenic
1049702431 8:144021268-144021290 GAGAGGGACCTGAGGGAAGGGGG - Intronic
1049702490 8:144021494-144021516 GAGAGGGATCTGAGGGAAGGAGG - Intronic
1049702697 8:144022341-144022363 GAGAGGGATCTGAGGGAAGGAGG - Intronic
1050310297 9:4345810-4345832 GAGTGAGAATTTGGGGAAGTGGG + Intronic
1050530127 9:6581347-6581369 GACAGGGAAGTGAGGAAAGCTGG - Intronic
1052518917 9:29518177-29518199 GAGTGGGAAGGGAGGGGAGATGG - Intergenic
1053188675 9:36040770-36040792 ATGTGGGAAGTGAGGGAAGAAGG + Intronic
1053360968 9:37486383-37486405 GAGAGGGAAATGGGGGAGGCGGG - Intronic
1053617124 9:39779858-39779880 GCCAGGGATTTGAGGGAAGCAGG - Intergenic
1053897335 9:42755407-42755429 GCCAGGGATTTGAGGGAAGCAGG + Intergenic
1054236393 9:62562500-62562522 GCCAGGGATTTGAGGGAAGCAGG + Intergenic
1054267044 9:62927579-62927601 GCCAGGGATTTGAGGGAAGCAGG + Intergenic
1054550535 9:66597030-66597052 GCCAGGGATTTGAGGGAAGCAGG + Intergenic
1055990563 9:82101772-82101794 GAGTGGGAAATGGGGAGAGCAGG + Intergenic
1056017142 9:82401737-82401759 GAGTGGGAATTTGGGGAAAAGGG + Intergenic
1056136269 9:83632189-83632211 GAGTGGGAATGGCGGGGAGATGG - Intronic
1056628540 9:88274032-88274054 GGGTGGGGATGGAGGGAGGCTGG + Intergenic
1056726399 9:89122805-89122827 GAGTAGGAATTGTGGGAAGGAGG + Intronic
1057369441 9:94456935-94456957 GGGTGGGAAAAGAGGGAAGAAGG - Intronic
1057886479 9:98833653-98833675 GAGTGGGAATTGGGGAAGGAAGG + Intronic
1057958797 9:99434810-99434832 GAGTTGGAATAGATGGAATCTGG + Intergenic
1058287118 9:103192014-103192036 GGGTGGGAATGAAGAGAAGCTGG + Intergenic
1059918320 9:119129135-119129157 GAGGGGAAAATGAGGGAAACTGG + Intergenic
1061466039 9:130780589-130780611 GAGAGGGAGATGAGGGAAGAGGG - Intronic
1062180924 9:135190766-135190788 GAGTGGCCATTGAGGAAGGCAGG - Intergenic
1062550702 9:137085037-137085059 GGGTGGGGATTGAGGAAAGGGGG + Intergenic
1186393696 X:9186373-9186395 CAGTGAGAAGGGAGGGAAGCAGG + Intergenic
1187039669 X:15580299-15580321 CAGAGGGGAATGAGGGAAGCAGG - Intronic
1187455935 X:19441313-19441335 GGGGAAGAATTGAGGGAAGCTGG + Intronic
1188520343 X:31031581-31031603 GAGTGGTGATAGAGAGAAGCAGG + Intergenic
1188697722 X:33216445-33216467 GAGGGGGAATGGAGGGAAGCGGG + Intronic
1188775813 X:34217001-34217023 GAGTTGGAATTTGGGAAAGCCGG - Intergenic
1189121386 X:38398986-38399008 GGGAGGGAATTGAGGGAAAAAGG - Intronic
1190328819 X:49223303-49223325 GAGTAAGAAGTGGGGGAAGCTGG + Intronic
1190339558 X:49286076-49286098 GAGTGAGAATGGAGGGGGGCTGG + Exonic
1191178219 X:57529461-57529483 AAGTGGGACTTGAGTGAAGGAGG - Intergenic
1192550878 X:72052621-72052643 GAGAGGGACATGGGGGAAGCTGG - Intergenic
1192914286 X:75636737-75636759 AAGAGGGAATTGAGGGTAGAAGG + Intergenic
1193918688 X:87399686-87399708 GAGAGGTAATTTAGGGAATCTGG + Intergenic
1194766861 X:97851812-97851834 GAATGAGAATTGAGTGAAGGGGG + Intergenic
1197169949 X:123421708-123421730 CAGTGGGAGCTGAGGGAAGGTGG - Intronic
1197354861 X:125425911-125425933 GTGGGGGAATTGAAGGAAGATGG + Intergenic
1197844123 X:130783016-130783038 TAGTGGGTATTGAGGGGAACAGG + Intronic
1198131440 X:133699342-133699364 GAATGGGGATAGAGGGAACCTGG + Intronic
1199264872 X:145818178-145818200 CAGTGGGGATTGAGGGTAGAGGG - Exonic
1199668254 X:150119332-150119354 TAGTGGGTGTTGAGGGGAGCTGG + Intergenic
1199992152 X:152993364-152993386 GGGTGGGGATTGGGGGGAGCAGG - Intronic
1201650538 Y:16280004-16280026 AAATGGGAATGGAGGGAAGGAGG - Intergenic
1201741285 Y:17326410-17326432 GAGGGGGAAGGGAGGGAGGCGGG + Intergenic