ID: 1151929011

View in Genome Browser
Species Human (GRCh38)
Location 17:77219120-77219142
Sequence CCTCCGTGTCCCCAGGCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151929011_1151929017 -4 Left 1151929011 17:77219120-77219142 CCTGGAGCCTGGGGACACGGAGG No data
Right 1151929017 17:77219139-77219161 GAGGCTGTTGGGAAGAGGATCGG No data
1151929011_1151929016 -9 Left 1151929011 17:77219120-77219142 CCTGGAGCCTGGGGACACGGAGG No data
Right 1151929016 17:77219134-77219156 ACACGGAGGCTGTTGGGAAGAGG No data
1151929011_1151929022 16 Left 1151929011 17:77219120-77219142 CCTGGAGCCTGGGGACACGGAGG No data
Right 1151929022 17:77219159-77219181 CGGGTTGAGGGGAGCAGACCAGG No data
1151929011_1151929020 4 Left 1151929011 17:77219120-77219142 CCTGGAGCCTGGGGACACGGAGG No data
Right 1151929020 17:77219147-77219169 TGGGAAGAGGATCGGGTTGAGGG No data
1151929011_1151929023 24 Left 1151929011 17:77219120-77219142 CCTGGAGCCTGGGGACACGGAGG No data
Right 1151929023 17:77219167-77219189 GGGGAGCAGACCAGGCCCTCTGG No data
1151929011_1151929019 3 Left 1151929011 17:77219120-77219142 CCTGGAGCCTGGGGACACGGAGG No data
Right 1151929019 17:77219146-77219168 TTGGGAAGAGGATCGGGTTGAGG No data
1151929011_1151929018 -3 Left 1151929011 17:77219120-77219142 CCTGGAGCCTGGGGACACGGAGG No data
Right 1151929018 17:77219140-77219162 AGGCTGTTGGGAAGAGGATCGGG No data
1151929011_1151929021 5 Left 1151929011 17:77219120-77219142 CCTGGAGCCTGGGGACACGGAGG No data
Right 1151929021 17:77219148-77219170 GGGAAGAGGATCGGGTTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151929011 Original CRISPR CCTCCGTGTCCCCAGGCTCC AGG (reversed) Intergenic
No off target data available for this crispr