ID: 1151929818

View in Genome Browser
Species Human (GRCh38)
Location 17:77225291-77225313
Sequence CCTTATTAGCAGAATGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151929818_1151929821 -7 Left 1151929818 17:77225291-77225313 CCATCCTCATTCTGCTAATAAGG No data
Right 1151929821 17:77225307-77225329 AATAAGGACATACCCAAGACTGG No data
1151929818_1151929825 14 Left 1151929818 17:77225291-77225313 CCATCCTCATTCTGCTAATAAGG No data
Right 1151929825 17:77225328-77225350 GGGTAACTTATAAACAGAAAAGG No data
1151929818_1151929822 -6 Left 1151929818 17:77225291-77225313 CCATCCTCATTCTGCTAATAAGG No data
Right 1151929822 17:77225308-77225330 ATAAGGACATACCCAAGACTGGG 0: 69
1: 2378
2: 4319
3: 7516
4: 8981

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151929818 Original CRISPR CCTTATTAGCAGAATGAGGA TGG (reversed) Intergenic
No off target data available for this crispr