ID: 1151929821

View in Genome Browser
Species Human (GRCh38)
Location 17:77225307-77225329
Sequence AATAAGGACATACCCAAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151929817_1151929821 16 Left 1151929817 17:77225268-77225290 CCAAGGGAGGATGGTGCATTAGT No data
Right 1151929821 17:77225307-77225329 AATAAGGACATACCCAAGACTGG No data
1151929818_1151929821 -7 Left 1151929818 17:77225291-77225313 CCATCCTCATTCTGCTAATAAGG No data
Right 1151929821 17:77225307-77225329 AATAAGGACATACCCAAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151929821 Original CRISPR AATAAGGACATACCCAAGAC TGG Intergenic
No off target data available for this crispr