ID: 1151929822

View in Genome Browser
Species Human (GRCh38)
Location 17:77225308-77225330
Sequence ATAAGGACATACCCAAGACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 23263
Summary {0: 69, 1: 2378, 2: 4319, 3: 7516, 4: 8981}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151929817_1151929822 17 Left 1151929817 17:77225268-77225290 CCAAGGGAGGATGGTGCATTAGT No data
Right 1151929822 17:77225308-77225330 ATAAGGACATACCCAAGACTGGG 0: 69
1: 2378
2: 4319
3: 7516
4: 8981
1151929818_1151929822 -6 Left 1151929818 17:77225291-77225313 CCATCCTCATTCTGCTAATAAGG No data
Right 1151929822 17:77225308-77225330 ATAAGGACATACCCAAGACTGGG 0: 69
1: 2378
2: 4319
3: 7516
4: 8981
1151929820_1151929822 -10 Left 1151929820 17:77225295-77225317 CCTCATTCTGCTAATAAGGACAT No data
Right 1151929822 17:77225308-77225330 ATAAGGACATACCCAAGACTGGG 0: 69
1: 2378
2: 4319
3: 7516
4: 8981

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151929822 Original CRISPR ATAAGGACATACCCAAGACT GGG Intergenic
Too many off-targets to display for this crispr