ID: 1151929825

View in Genome Browser
Species Human (GRCh38)
Location 17:77225328-77225350
Sequence GGGTAACTTATAAACAGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151929820_1151929825 10 Left 1151929820 17:77225295-77225317 CCTCATTCTGCTAATAAGGACAT No data
Right 1151929825 17:77225328-77225350 GGGTAACTTATAAACAGAAAAGG No data
1151929818_1151929825 14 Left 1151929818 17:77225291-77225313 CCATCCTCATTCTGCTAATAAGG No data
Right 1151929825 17:77225328-77225350 GGGTAACTTATAAACAGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151929825 Original CRISPR GGGTAACTTATAAACAGAAA AGG Intergenic
No off target data available for this crispr