ID: 1151930764

View in Genome Browser
Species Human (GRCh38)
Location 17:77230203-77230225
Sequence TGCTTCCCGCTGTGGCCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151930764_1151930768 -3 Left 1151930764 17:77230203-77230225 CCTGCTGGCCACAGCGGGAAGCA No data
Right 1151930768 17:77230223-77230245 GCAGCAGATGCTGCCCGGGCCGG No data
1151930764_1151930770 5 Left 1151930764 17:77230203-77230225 CCTGCTGGCCACAGCGGGAAGCA No data
Right 1151930770 17:77230231-77230253 TGCTGCCCGGGCCGGCCTGTGGG No data
1151930764_1151930767 -7 Left 1151930764 17:77230203-77230225 CCTGCTGGCCACAGCGGGAAGCA No data
Right 1151930767 17:77230219-77230241 GGAAGCAGCAGATGCTGCCCGGG No data
1151930764_1151930777 24 Left 1151930764 17:77230203-77230225 CCTGCTGGCCACAGCGGGAAGCA No data
Right 1151930777 17:77230250-77230272 TGGGGACGGCACCCTGCCTCTGG No data
1151930764_1151930773 10 Left 1151930764 17:77230203-77230225 CCTGCTGGCCACAGCGGGAAGCA No data
Right 1151930773 17:77230236-77230258 CCCGGGCCGGCCTGTGGGGACGG No data
1151930764_1151930766 -8 Left 1151930764 17:77230203-77230225 CCTGCTGGCCACAGCGGGAAGCA No data
Right 1151930766 17:77230218-77230240 GGGAAGCAGCAGATGCTGCCCGG No data
1151930764_1151930771 6 Left 1151930764 17:77230203-77230225 CCTGCTGGCCACAGCGGGAAGCA No data
Right 1151930771 17:77230232-77230254 GCTGCCCGGGCCGGCCTGTGGGG No data
1151930764_1151930769 4 Left 1151930764 17:77230203-77230225 CCTGCTGGCCACAGCGGGAAGCA No data
Right 1151930769 17:77230230-77230252 ATGCTGCCCGGGCCGGCCTGTGG No data
1151930764_1151930778 28 Left 1151930764 17:77230203-77230225 CCTGCTGGCCACAGCGGGAAGCA No data
Right 1151930778 17:77230254-77230276 GACGGCACCCTGCCTCTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151930764 Original CRISPR TGCTTCCCGCTGTGGCCAGC AGG (reversed) Intergenic