ID: 1151930765

View in Genome Browser
Species Human (GRCh38)
Location 17:77230211-77230233
Sequence GCATCTGCTGCTTCCCGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151930765_1151930769 -4 Left 1151930765 17:77230211-77230233 CCACAGCGGGAAGCAGCAGATGC No data
Right 1151930769 17:77230230-77230252 ATGCTGCCCGGGCCGGCCTGTGG No data
1151930765_1151930773 2 Left 1151930765 17:77230211-77230233 CCACAGCGGGAAGCAGCAGATGC No data
Right 1151930773 17:77230236-77230258 CCCGGGCCGGCCTGTGGGGACGG No data
1151930765_1151930770 -3 Left 1151930765 17:77230211-77230233 CCACAGCGGGAAGCAGCAGATGC No data
Right 1151930770 17:77230231-77230253 TGCTGCCCGGGCCGGCCTGTGGG No data
1151930765_1151930771 -2 Left 1151930765 17:77230211-77230233 CCACAGCGGGAAGCAGCAGATGC No data
Right 1151930771 17:77230232-77230254 GCTGCCCGGGCCGGCCTGTGGGG No data
1151930765_1151930778 20 Left 1151930765 17:77230211-77230233 CCACAGCGGGAAGCAGCAGATGC No data
Right 1151930778 17:77230254-77230276 GACGGCACCCTGCCTCTGGAAGG No data
1151930765_1151930779 25 Left 1151930765 17:77230211-77230233 CCACAGCGGGAAGCAGCAGATGC No data
Right 1151930779 17:77230259-77230281 CACCCTGCCTCTGGAAGGCTCGG No data
1151930765_1151930777 16 Left 1151930765 17:77230211-77230233 CCACAGCGGGAAGCAGCAGATGC No data
Right 1151930777 17:77230250-77230272 TGGGGACGGCACCCTGCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151930765 Original CRISPR GCATCTGCTGCTTCCCGCTG TGG (reversed) Intergenic