ID: 1151930772

View in Genome Browser
Species Human (GRCh38)
Location 17:77230236-77230258
Sequence CCGTCCCCACAGGCCGGCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151930772_1151930783 11 Left 1151930772 17:77230236-77230258 CCCGGGCCGGCCTGTGGGGACGG No data
Right 1151930783 17:77230270-77230292 TGGAAGGCTCGGTGATGCTGCGG No data
1151930772_1151930785 30 Left 1151930772 17:77230236-77230258 CCCGGGCCGGCCTGTGGGGACGG No data
Right 1151930785 17:77230289-77230311 GCGGCCAGCCGGTGTCCACCAGG No data
1151930772_1151930779 0 Left 1151930772 17:77230236-77230258 CCCGGGCCGGCCTGTGGGGACGG No data
Right 1151930779 17:77230259-77230281 CACCCTGCCTCTGGAAGGCTCGG No data
1151930772_1151930784 19 Left 1151930772 17:77230236-77230258 CCCGGGCCGGCCTGTGGGGACGG No data
Right 1151930784 17:77230278-77230300 TCGGTGATGCTGCGGCCAGCCGG No data
1151930772_1151930777 -9 Left 1151930772 17:77230236-77230258 CCCGGGCCGGCCTGTGGGGACGG No data
Right 1151930777 17:77230250-77230272 TGGGGACGGCACCCTGCCTCTGG No data
1151930772_1151930778 -5 Left 1151930772 17:77230236-77230258 CCCGGGCCGGCCTGTGGGGACGG No data
Right 1151930778 17:77230254-77230276 GACGGCACCCTGCCTCTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151930772 Original CRISPR CCGTCCCCACAGGCCGGCCC GGG (reversed) Intergenic