ID: 1151930777

View in Genome Browser
Species Human (GRCh38)
Location 17:77230250-77230272
Sequence TGGGGACGGCACCCTGCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151930765_1151930777 16 Left 1151930765 17:77230211-77230233 CCACAGCGGGAAGCAGCAGATGC No data
Right 1151930777 17:77230250-77230272 TGGGGACGGCACCCTGCCTCTGG No data
1151930774_1151930777 -10 Left 1151930774 17:77230237-77230259 CCGGGCCGGCCTGTGGGGACGGC No data
Right 1151930777 17:77230250-77230272 TGGGGACGGCACCCTGCCTCTGG No data
1151930764_1151930777 24 Left 1151930764 17:77230203-77230225 CCTGCTGGCCACAGCGGGAAGCA No data
Right 1151930777 17:77230250-77230272 TGGGGACGGCACCCTGCCTCTGG No data
1151930772_1151930777 -9 Left 1151930772 17:77230236-77230258 CCCGGGCCGGCCTGTGGGGACGG No data
Right 1151930777 17:77230250-77230272 TGGGGACGGCACCCTGCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151930777 Original CRISPR TGGGGACGGCACCCTGCCTC TGG Intergenic