ID: 1151930779

View in Genome Browser
Species Human (GRCh38)
Location 17:77230259-77230281
Sequence CACCCTGCCTCTGGAAGGCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151930772_1151930779 0 Left 1151930772 17:77230236-77230258 CCCGGGCCGGCCTGTGGGGACGG No data
Right 1151930779 17:77230259-77230281 CACCCTGCCTCTGGAAGGCTCGG No data
1151930765_1151930779 25 Left 1151930765 17:77230211-77230233 CCACAGCGGGAAGCAGCAGATGC No data
Right 1151930779 17:77230259-77230281 CACCCTGCCTCTGGAAGGCTCGG No data
1151930776_1151930779 -10 Left 1151930776 17:77230246-77230268 CCTGTGGGGACGGCACCCTGCCT No data
Right 1151930779 17:77230259-77230281 CACCCTGCCTCTGGAAGGCTCGG No data
1151930774_1151930779 -1 Left 1151930774 17:77230237-77230259 CCGGGCCGGCCTGTGGGGACGGC No data
Right 1151930779 17:77230259-77230281 CACCCTGCCTCTGGAAGGCTCGG No data
1151930775_1151930779 -6 Left 1151930775 17:77230242-77230264 CCGGCCTGTGGGGACGGCACCCT No data
Right 1151930779 17:77230259-77230281 CACCCTGCCTCTGGAAGGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151930779 Original CRISPR CACCCTGCCTCTGGAAGGCT CGG Intergenic