ID: 1151930783

View in Genome Browser
Species Human (GRCh38)
Location 17:77230270-77230292
Sequence TGGAAGGCTCGGTGATGCTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151930774_1151930783 10 Left 1151930774 17:77230237-77230259 CCGGGCCGGCCTGTGGGGACGGC No data
Right 1151930783 17:77230270-77230292 TGGAAGGCTCGGTGATGCTGCGG No data
1151930775_1151930783 5 Left 1151930775 17:77230242-77230264 CCGGCCTGTGGGGACGGCACCCT No data
Right 1151930783 17:77230270-77230292 TGGAAGGCTCGGTGATGCTGCGG No data
1151930776_1151930783 1 Left 1151930776 17:77230246-77230268 CCTGTGGGGACGGCACCCTGCCT No data
Right 1151930783 17:77230270-77230292 TGGAAGGCTCGGTGATGCTGCGG No data
1151930772_1151930783 11 Left 1151930772 17:77230236-77230258 CCCGGGCCGGCCTGTGGGGACGG No data
Right 1151930783 17:77230270-77230292 TGGAAGGCTCGGTGATGCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151930783 Original CRISPR TGGAAGGCTCGGTGATGCTG CGG Intergenic