ID: 1151930785

View in Genome Browser
Species Human (GRCh38)
Location 17:77230289-77230311
Sequence GCGGCCAGCCGGTGTCCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151930781_1151930785 4 Left 1151930781 17:77230262-77230284 CCTGCCTCTGGAAGGCTCGGTGA No data
Right 1151930785 17:77230289-77230311 GCGGCCAGCCGGTGTCCACCAGG No data
1151930775_1151930785 24 Left 1151930775 17:77230242-77230264 CCGGCCTGTGGGGACGGCACCCT No data
Right 1151930785 17:77230289-77230311 GCGGCCAGCCGGTGTCCACCAGG No data
1151930776_1151930785 20 Left 1151930776 17:77230246-77230268 CCTGTGGGGACGGCACCCTGCCT No data
Right 1151930785 17:77230289-77230311 GCGGCCAGCCGGTGTCCACCAGG No data
1151930780_1151930785 5 Left 1151930780 17:77230261-77230283 CCCTGCCTCTGGAAGGCTCGGTG No data
Right 1151930785 17:77230289-77230311 GCGGCCAGCCGGTGTCCACCAGG No data
1151930782_1151930785 0 Left 1151930782 17:77230266-77230288 CCTCTGGAAGGCTCGGTGATGCT No data
Right 1151930785 17:77230289-77230311 GCGGCCAGCCGGTGTCCACCAGG No data
1151930774_1151930785 29 Left 1151930774 17:77230237-77230259 CCGGGCCGGCCTGTGGGGACGGC No data
Right 1151930785 17:77230289-77230311 GCGGCCAGCCGGTGTCCACCAGG No data
1151930772_1151930785 30 Left 1151930772 17:77230236-77230258 CCCGGGCCGGCCTGTGGGGACGG No data
Right 1151930785 17:77230289-77230311 GCGGCCAGCCGGTGTCCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151930785 Original CRISPR GCGGCCAGCCGGTGTCCACC AGG Intergenic