ID: 1151934880

View in Genome Browser
Species Human (GRCh38)
Location 17:77255481-77255503
Sequence GCTTAAACCCCCACTGGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151934880_1151934895 23 Left 1151934880 17:77255481-77255503 CCTCCCCCAGTGGGGGTTTAAGC No data
Right 1151934895 17:77255527-77255549 CCCGGCGCCCTCTGTCTCCACGG No data
1151934880_1151934888 5 Left 1151934880 17:77255481-77255503 CCTCCCCCAGTGGGGGTTTAAGC No data
Right 1151934888 17:77255509-77255531 GTGGGCTGCCTCCCCGACCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151934880 Original CRISPR GCTTAAACCCCCACTGGGGG AGG (reversed) Intergenic
No off target data available for this crispr