ID: 1151937854

View in Genome Browser
Species Human (GRCh38)
Location 17:77274276-77274298
Sequence CCTGCCAAGAATGGAGGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 186}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151937854_1151937863 26 Left 1151937854 17:77274276-77274298 CCAGACCCTCCATTCTTGGCAGG 0: 1
1: 0
2: 1
3: 17
4: 186
Right 1151937863 17:77274325-77274347 GTTGGACAGTTCCTCCCTGTGGG 0: 1
1: 0
2: 0
3: 12
4: 165
1151937854_1151937862 25 Left 1151937854 17:77274276-77274298 CCAGACCCTCCATTCTTGGCAGG 0: 1
1: 0
2: 1
3: 17
4: 186
Right 1151937862 17:77274324-77274346 AGTTGGACAGTTCCTCCCTGTGG 0: 1
1: 0
2: 0
3: 5
4: 152
1151937854_1151937860 8 Left 1151937854 17:77274276-77274298 CCAGACCCTCCATTCTTGGCAGG 0: 1
1: 0
2: 1
3: 17
4: 186
Right 1151937860 17:77274307-77274329 CCTCCTCTGTCAGTTACAGTTGG 0: 1
1: 0
2: 0
3: 10
4: 157
1151937854_1151937864 29 Left 1151937854 17:77274276-77274298 CCAGACCCTCCATTCTTGGCAGG 0: 1
1: 0
2: 1
3: 17
4: 186
Right 1151937864 17:77274328-77274350 GGACAGTTCCTCCCTGTGGGAGG 0: 1
1: 0
2: 4
3: 19
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151937854 Original CRISPR CCTGCCAAGAATGGAGGGTC TGG (reversed) Intergenic
900166914 1:1247541-1247563 TCTGGCAAGAGGGGAGGGTCTGG - Intergenic
901781613 1:11598199-11598221 CCTTCCAAGGATGGAGTCTCAGG + Intergenic
902686655 1:18081749-18081771 CCTGCCAGGAATGGTGAGTGTGG + Intergenic
905690076 1:39936572-39936594 CCTGGCTGGAATGGAGGGTGGGG + Intergenic
906166764 1:43692234-43692256 CCTGCCAAGAAAGGAGAGGGAGG - Exonic
906210533 1:44010317-44010339 CCACCCAAGTATGGAGGCTCTGG - Intronic
906705155 1:47889226-47889248 GCTGCCCAGAATGGGAGGTCAGG + Intronic
907258160 1:53196150-53196172 CAAGCCAAGAATGGATGTTCAGG + Intergenic
907261368 1:53220889-53220911 CCTGGAAAGAACTGAGGGTCAGG - Intergenic
908001495 1:59684630-59684652 CCTGCCAAGTATGTGGGGTGAGG + Intronic
914936923 1:151989691-151989713 CCACCCAAGAACGGAGGGCCAGG - Intronic
916987748 1:170209357-170209379 CCTCCAAAGAATGGAGGACCTGG - Intergenic
918564904 1:185917889-185917911 ACTGCCAAGAATGAAGGAGCAGG - Intronic
919574121 1:199285487-199285509 CTTGCTAAGAATGGTGTGTCAGG - Intergenic
924631284 1:245743126-245743148 CCTGCTCAGAATGGATGCTCAGG - Intergenic
1065852913 10:29805618-29805640 CATGCCAAGATTTGAGGGGCAGG + Intergenic
1068886441 10:62102800-62102822 CCTGCCCAGAGTGGAAGCTCAGG + Intergenic
1070734256 10:78852626-78852648 CCTGCCGGGCATCGAGGGTCAGG - Intergenic
1072720047 10:97774816-97774838 CCTGCCAAGCCTGGAGGGGTGGG - Intergenic
1072804662 10:98416939-98416961 CCAGCCAAGCATGAAGGGGCTGG + Exonic
1075108162 10:119556825-119556847 TCTGACAAGAATGCAGGGACTGG + Intergenic
1076833218 10:133007310-133007332 CCTCCCAAGAGTGGAGGCCCAGG - Intergenic
1081870325 11:46380250-46380272 CCTCCCAGGAGTGGAGGGGCTGG + Exonic
1084968884 11:72758675-72758697 CCTGCCTACAAGGGAGGGTGTGG + Intronic
1085013892 11:73159832-73159854 CCTGCCTGGAATGGGGGATCTGG - Intergenic
1085743984 11:79099283-79099305 CCTGCAAAGGAGAGAGGGTCTGG - Intronic
1087282481 11:96227410-96227432 CATGCCAAGAATGCAGGGAGTGG + Intronic
1088090390 11:106031960-106031982 CCAGCCAAGAATGGTAGTTCTGG + Intergenic
1088921614 11:114263387-114263409 CTTGCCCAGAAGGGAGTGTCTGG - Intronic
1092228690 12:6765401-6765423 CCAGCCAAGAATAGAGGGCCAGG + Intronic
1096078677 12:48819676-48819698 CTTGCCCAGCATGGAGGGCCTGG + Intronic
1096785213 12:54013351-54013373 GATGCTAAGAATGGAGGGTGAGG + Intronic
1107446592 13:40474914-40474936 CCTGCCAACATTTGGGGGTCAGG - Intergenic
1107787737 13:43971501-43971523 CCTCCCAGGAGTGGAGGGGCTGG + Intergenic
1110872064 13:80463843-80463865 CCTGCCAAGAAGGGAGTGGGAGG + Intergenic
1111802159 13:92994416-92994438 CCTGACTAGAATGGTGGGGCAGG - Intergenic
1118123107 14:62868129-62868151 CCTTCCAGGCATAGAGGGTCAGG - Intronic
1119765853 14:77187335-77187357 CCTGCCCAGAGTGGAGGGGAAGG - Intronic
1120172633 14:81260957-81260979 CATTACAAGAATGGAGGGTGAGG + Exonic
1121796488 14:96740426-96740448 CCTCCCTAGACTGGAGGGCCCGG + Intergenic
1122718662 14:103709913-103709935 ACAGCCAAGGATGGAGGGTCAGG + Intronic
1123040039 14:105486718-105486740 CCTCCCCAGGACGGAGGGTCGGG - Intergenic
1127488969 15:59444073-59444095 CCGTGCAAGAATGGAGGGGCTGG - Intronic
1129567410 15:76637467-76637489 GCAGCCAAGAAGGGAGGATCAGG + Intronic
1130250477 15:82297279-82297301 CCTCCCAAGTAGGGAGGGACTGG - Intergenic
1130779235 15:87017202-87017224 CCTGCCAACTCTGGAGAGTCTGG + Intronic
1130793681 15:87185449-87185471 TATGCCAAGAATGCAAGGTCTGG + Intergenic
1131455528 15:92579924-92579946 CCTTTTAAGAATGGAGGTTCAGG - Intergenic
1132115645 15:99134055-99134077 CATCCCATGAATGGAGGGTTGGG - Exonic
1132778035 16:1607172-1607194 ACTGCCAAGAATGGATGGACAGG + Exonic
1133393285 16:5426460-5426482 TCTGTCAATAACGGAGGGTCTGG + Intergenic
1134011902 16:10860000-10860022 CCTCCCAGGAACGCAGGGTCTGG + Intergenic
1134015212 16:10883361-10883383 CCTGTCCAGAATGCAGGGTTGGG - Intronic
1134127986 16:11629539-11629561 GCTGCCAAGAAGGGTGGGTGAGG + Intronic
1134165483 16:11926130-11926152 CCTGGCAAGAGAGGAGGGCCAGG + Intergenic
1134489825 16:14688317-14688339 CCTGGCAAGAGAGGAGGGCCAGG - Intronic
1134495205 16:14727434-14727456 CCTGGCAAGAGAGGAGGGCCAGG - Intronic
1134500591 16:14766554-14766576 CCTGGCAAGAGAGGAGGGCCAGG - Intronic
1134545272 16:15103181-15103203 CCTGGCAAGAGAGGAGGGCCAGG + Intronic
1134579992 16:15362496-15362518 CCTGGCAAGAGAGGAGGGCCAGG + Intergenic
1134714716 16:16351700-16351722 CCTGGCAAGAGAGGAGGGCCAGG - Intergenic
1134722593 16:16395064-16395086 CCTGGCAAGAGAGGAGGGCCAGG - Intergenic
1134952099 16:18356958-18356980 CCTGGCAAGAGAGGAGGGCCAGG + Intergenic
1135062865 16:19285884-19285906 CCTGTGCAGAGTGGAGGGTCAGG - Exonic
1135310443 16:21401020-21401042 CCTGGCAAGAGAGGAGGGCCAGG + Intergenic
1135363388 16:21833448-21833470 CCTGGCAAGAGAGGAGGGCCAGG + Intergenic
1135448404 16:22537630-22537652 CCTGGCAAGAGAGGAGGGCCAGG - Intergenic
1136150023 16:28341369-28341391 CCTGGCAAGAGAGGAGGGCCAGG + Intergenic
1136166258 16:28455184-28455206 CCTGGCAAGAGAGGAGGGCCAGG + Intergenic
1136196714 16:28659848-28659870 CCTGGCAAGAGAGGAGGGCCAGG - Intergenic
1136213054 16:28773973-28773995 CCTGGCAAGAGAGGAGGGCCAGG - Intergenic
1136257781 16:29053886-29053908 CCTGGCAAGAGAGGAGGGCCAGG - Intergenic
1136272125 16:29154482-29154504 CCTGCCAGCAATGGAGGTCCAGG - Intergenic
1136307187 16:29380174-29380196 CCTGGCAAGAGAGGAGGGCCAGG + Intergenic
1136320712 16:29482417-29482439 CCTGGCAAGAGAGGAGGGCCAGG + Intergenic
1136435285 16:30221757-30221779 CCTGGCAAGAGAGGAGGGCCAGG + Intergenic
1139057794 16:63207382-63207404 CCTCCCAAGAACGGAGAGACAGG + Intergenic
1139759131 16:69170237-69170259 CCTTTCCAGAATGGAGGGTGGGG - Intronic
1140394005 16:74611693-74611715 CGTGCCCAGAATGTCGGGTCAGG + Intergenic
1141601641 16:85130329-85130351 GCTGCCAAGAAAGGAGGGTTCGG + Intergenic
1142075702 16:88116386-88116408 CCTGCCAGCAATGGAGGTCCAGG - Intronic
1146130322 17:30267935-30267957 ACTGCCAAGAGTGGAGTGTTTGG - Intronic
1146311845 17:31775314-31775336 CCTGCCAAGAATGCATGGCCTGG - Intergenic
1148582339 17:48752687-48752709 GCTGCCAAAGATTGAGGGTCGGG - Intergenic
1149515539 17:57278300-57278322 CCTGCCCACAATGCATGGTCTGG + Intronic
1151937854 17:77274276-77274298 CCTGCCAAGAATGGAGGGTCTGG - Intergenic
1152583637 17:81179751-81179773 GCTTCCGAGAATGGAAGGTCGGG + Intergenic
1153314958 18:3712355-3712377 CGTGCCCAGTAGGGAGGGTCAGG - Intronic
1153979137 18:10294461-10294483 CCTGTCAAGATTGCAGTGTCAGG + Intergenic
1154116740 18:11618139-11618161 CCTGGCAAGAGAGGAGGGCCAGG + Intergenic
1157054735 18:44213164-44213186 CCTTTCAAGAATGGAGGTTTGGG + Intergenic
1157880162 18:51313806-51313828 CCTGATAAGGATGGAGGGCCTGG - Intergenic
1160748552 19:722918-722940 CCTGCCAGGAAGGGAGGAGCCGG + Intronic
1162772912 19:12960761-12960783 CCTGTCAAGAAAGGAGGGGAGGG - Intergenic
1166086942 19:40482519-40482541 CCTGGCAGGAATGGAGGTCCAGG + Intronic
1166782601 19:45350319-45350341 CCTGCGGAGAAGGGAGTGTCTGG - Exonic
1166964561 19:46520863-46520885 CCTGCCCAGAATGGAGGGGAGGG + Intronic
1167621787 19:50564822-50564844 CCTGGCAAGAAAGCAGGGCCAGG + Intronic
1168708440 19:58482850-58482872 CCAGCCCAGAAGGGAGAGTCAGG + Intronic
928404284 2:31002733-31002755 CCTGCAGAGAATGGATGGTCTGG + Intronic
928900987 2:36317265-36317287 CTGACCTAGAATGGAGGGTCAGG + Intergenic
929644466 2:43612988-43613010 CCTTCTAAGTATGGAGGGTCCGG + Intergenic
930090500 2:47528168-47528190 TCTGCCCAGAATGAAGGGACAGG + Intronic
930329212 2:49961426-49961448 GCTTCTTAGAATGGAGGGTCAGG - Intronic
931933710 2:67171051-67171073 CCTGCCAAGAGTTGAGTGTTTGG - Intergenic
945198449 2:207258642-207258664 ACTGCCAAGAAGGGAAGGTGTGG + Intergenic
947925161 2:233914836-233914858 CCTGCCAAGAAGGTAAGATCAGG + Intergenic
947938477 2:234027420-234027442 CCTGACAAGAATGGAGGGGATGG - Intergenic
1170843223 20:19940666-19940688 CCTGCAAAGACTGGAGAGTATGG + Intronic
1171462091 20:25303680-25303702 CCTGCCATGGACAGAGGGTCTGG - Intronic
1174237034 20:49102571-49102593 CCTTCCTAGAATGGAGGGGCTGG - Intergenic
1175086043 20:56459748-56459770 CATGCCAGGAATGGTGGCTCAGG - Intronic
1175891818 20:62319093-62319115 CCTGCCAAGGATGGCAGGGCTGG - Intronic
1179681303 21:43023078-43023100 GCTGCCAAGAAACGAGGGTGAGG - Intronic
1180836161 22:18930546-18930568 CCTGCCCAGGAGGGCGGGTCAGG - Intronic
1181060646 22:20280598-20280620 CCAGCCAGGCACGGAGGGTCAGG - Intronic
1182555507 22:31126537-31126559 CCTGCCATGGGTGGAGGGCCCGG - Intronic
1182810954 22:33116245-33116267 CCTGTTAAGGATGGAGGGTTAGG - Intergenic
1183085869 22:35486618-35486640 CCTGCCAAGTTTAGAGGCTCTGG - Intergenic
1183699854 22:39445119-39445141 CCTGACAAGGCTAGAGGGTCTGG - Intergenic
1203286253 22_KI270734v1_random:155845-155867 CCTGCCCAGGAGGGCGGGTCAGG - Intergenic
950828605 3:15852045-15852067 GCTGGCAAGAATGGAGGTTCGGG + Intronic
952141160 3:30480480-30480502 CCTGACAAGAATTGAGGTTTGGG + Intergenic
954506413 3:51079632-51079654 CCTGCTAAGTATGGTGGTTCAGG - Intronic
955832731 3:63021614-63021636 CCTGGCAAGAGTGGAGGGCCTGG + Intergenic
962386312 3:134935301-134935323 CAGGCGAAGAAGGGAGGGTCAGG + Intronic
963266655 3:143246383-143246405 CCTAGCAAGAATGGGGGGGCGGG + Intergenic
968809735 4:2794443-2794465 CCTGCCAGGAGTGGAGTGCCTGG - Intronic
968873118 4:3251422-3251444 CCAGCCCAGACTGCAGGGTCTGG - Intronic
968973634 4:3809990-3810012 CCAGCCAAGAGTGGAGGGGCTGG + Intergenic
972596138 4:40531421-40531443 CCTGCCAAGCAGAGAGGGTTGGG + Intronic
976379041 4:84378783-84378805 CCTGTCAACAAGGGAGGGCCGGG - Intergenic
981248358 4:142567340-142567362 CCTGACAGGAAAGGAGGGGCAGG + Intronic
982461256 4:155671555-155671577 TCTGCTAAGAATGAAGAGTCTGG - Intronic
984683894 4:182644219-182644241 CCTGCCAAAAATGGATGGGAAGG - Intronic
989351789 5:40495054-40495076 CCTGGCAGGGATGGAGGGGCAGG - Intergenic
991656905 5:68913466-68913488 CCTGGCCAGAATGAAGGCTCAGG - Intergenic
992402776 5:76426829-76426851 ACAGCCAAGGATGGAGGGGCAGG - Intronic
992736425 5:79726562-79726584 CATGCCATGAGTGAAGGGTCGGG - Intronic
994236478 5:97369135-97369157 CATGCCAAGAATACAGGGTTTGG - Intergenic
997623577 5:135316673-135316695 GCTCCAAAGAATGGTGGGTCTGG + Intronic
999218746 5:149957914-149957936 CCTGGGAAGAATGGGTGGTCAGG + Intergenic
1000264304 5:159619926-159619948 CCTGCTAAGAAGGGAGGATGGGG + Intergenic
1000507958 5:162145383-162145405 CATGCCAAGACTGGAGGAACTGG + Intronic
1002788304 6:420443-420465 CCTGGAAAGCAGGGAGGGTCAGG - Intergenic
1004295548 6:14406724-14406746 GCAGCAAAGAATGGAGGGCCAGG + Intergenic
1006100997 6:31686373-31686395 CCTGCCAGGGACGGAGGGCCAGG - Intergenic
1006396300 6:33789520-33789542 ACTGCCACGAATGGAGAGACAGG + Intergenic
1007577523 6:42935552-42935574 CCTGCCAAGACAGGAGGATGAGG - Exonic
1013366380 6:109441012-109441034 CCTGCGAAGAAGGAACGGTCTGG + Exonic
1014265277 6:119269702-119269724 GCTGCCAAAGATGGAGGGGCAGG - Intronic
1016417779 6:143851120-143851142 CCTGCCCAGAAGGAAGGGTATGG + Intronic
1018117569 6:160602146-160602168 GCTTCCTGGAATGGAGGGTCTGG - Intronic
1018118122 6:160607735-160607757 GCTTCCTGGAATGGAGGGTCTGG - Intronic
1018118745 6:160614192-160614214 GCTTCCTGGAATGGAGGGTCTGG - Intronic
1018119346 6:160619744-160619766 GCTTCCTGGAATGGAGGGTCTGG - Intronic
1018119949 6:160625290-160625312 GCTTCCTGGAATGGAGGGTCTGG - Intronic
1018120550 6:160630834-160630856 GCTTCCTGGAATGGAGGGTCTGG - Intronic
1018121146 6:160636383-160636405 GCTTCCTGGAATGGAGGGTCTGG - Intronic
1018121748 6:160641926-160641948 GCTTCCTGGAATGGAGGGTCTGG - Intronic
1018122341 6:160647480-160647502 GCTTCCTGGAATGGAGGGTCTGG - Intronic
1019143229 6:169961317-169961339 CGTTCCAAGGATGGAGGGTTTGG - Intergenic
1019483312 7:1276144-1276166 CCGGCCAGGAATGGAGGGAGAGG - Intergenic
1022388317 7:29922478-29922500 CCTGCCAAGAATGATGAGGCAGG + Intronic
1023189613 7:37565755-37565777 CCTGCTAAAAATGGCGGGGCAGG + Intergenic
1023775697 7:43604484-43604506 TGTGCCAAGAATGTAGGGTGAGG - Intronic
1026735815 7:72947979-72948001 CCTGTTAGGATTGGAGGGTCTGG + Intronic
1026786158 7:73302910-73302932 CCTGTTAGGATTGGAGGGTCTGG + Intronic
1027107919 7:75417084-75417106 CCTGTTAGGATTGGAGGGTCTGG - Exonic
1029593032 7:101519919-101519941 CCTGCCTGGACTGGAGGGCCTGG - Intronic
1033194473 7:139315774-139315796 CCGGCCAGGCATGGAGGCTCAGG + Intergenic
1033307928 7:140238712-140238734 CCTGCCCCGAGTGGAGTGTCAGG - Intergenic
1034853532 7:154518749-154518771 CCTGCTAAGTATGAAGCGTCAGG - Intronic
1034900390 7:154904833-154904855 CCTGTCCAGGATGGAGGGTGTGG - Intergenic
1035195776 7:157219176-157219198 CCTCCCAGGAGAGGAGGGTCTGG + Intronic
1037774479 8:21823907-21823929 TCTGCCTAGAATGGAGGATCAGG + Intergenic
1042704941 8:71656199-71656221 CTTGGCAGGAATGGAGGCTCTGG + Intergenic
1044451016 8:92335862-92335884 CCTGCCAAGTGAGGAGGATCTGG + Intergenic
1048059065 8:130898866-130898888 CCTGTGAAGAATGGACTGTCGGG - Intronic
1048255008 8:132898900-132898922 CCTGCCTAGAAGTAAGGGTCTGG + Exonic
1048871164 8:138800340-138800362 TCTGCCAAGAATTTAGGCTCTGG + Intronic
1048875321 8:138832676-138832698 CCTGCCATGAATGCAGTGTCAGG + Intronic
1049306041 8:141904828-141904850 CCTGCCAGGCAGGGAGGGGCAGG + Intergenic
1049956432 9:697244-697266 CCTGCCAAGAAGGCATGGCCTGG - Intronic
1050173195 9:2843876-2843898 CCTGGCAAGAAGGGCGGGACTGG - Intronic
1050755243 9:8994590-8994612 TTTGCCAAGAATGGAAGATCAGG + Intronic
1051156647 9:14155268-14155290 CCTGCTAAGAATGGTGTCTCAGG + Intronic
1055720619 9:79169395-79169417 CTTTCCAAGAATGAAGGCTCTGG - Intergenic
1059241510 9:112810261-112810283 CCTGGCAATGTTGGAGGGTCTGG + Intronic
1060969772 9:127731415-127731437 CCCAGCAAGAAGGGAGGGTCTGG - Exonic
1061047923 9:128177408-128177430 CCTGCCAAGAAGGCAGGTTTTGG - Intronic
1061294966 9:129672036-129672058 CCAGGCAAGAATGTGGGGTCAGG + Intronic
1062131666 9:134898000-134898022 CCTGCCAAGAATGGAGTTTCAGG + Intergenic
1062382144 9:136291645-136291667 CCTGCAAAGACAGGAGTGTCAGG + Exonic
1062647455 9:137556116-137556138 CGTCCCAAGCATGCAGGGTCCGG + Intronic
1186402074 X:9269404-9269426 CCTGACCAGCATGGAGGGACTGG + Intergenic
1195361191 X:104085139-104085161 CCTGCCTAGTAAGGAGGGTATGG + Intergenic
1195660259 X:107371069-107371091 CCTGCCAAGAAACTATGGTCAGG + Intergenic
1196020280 X:110984102-110984124 CCTGCCATGTATGGATGTTCAGG + Intronic
1196794707 X:119492820-119492842 CCTGACAAGAATGCAGGGGCAGG - Intergenic
1196871490 X:120116565-120116587 GCTGCCAAATATGGAGGGTCAGG - Intergenic
1199414034 X:147559188-147559210 CCTGCCATAAAAGGAGGGTTGGG - Intergenic
1200042426 X:153379789-153379811 CCAGGCAAGAATGCAGGGCCGGG + Intergenic
1200096590 X:153667460-153667482 CCAGACCAGAATTGAGGGTCAGG - Intergenic
1200154747 X:153969495-153969517 CTTGCCCAGAAGGCAGGGTCAGG - Intronic