ID: 1151938765

View in Genome Browser
Species Human (GRCh38)
Location 17:77280359-77280381
Sequence CTCCATTGGCAGCTGTGCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151938756_1151938765 3 Left 1151938756 17:77280333-77280355 CCCGCCTTCCTCTCGTCCTCTAC No data
Right 1151938765 17:77280359-77280381 CTCCATTGGCAGCTGTGCAAGGG No data
1151938757_1151938765 2 Left 1151938757 17:77280334-77280356 CCGCCTTCCTCTCGTCCTCTACG No data
Right 1151938765 17:77280359-77280381 CTCCATTGGCAGCTGTGCAAGGG No data
1151938759_1151938765 -1 Left 1151938759 17:77280337-77280359 CCTTCCTCTCGTCCTCTACGGCC No data
Right 1151938765 17:77280359-77280381 CTCCATTGGCAGCTGTGCAAGGG No data
1151938754_1151938765 14 Left 1151938754 17:77280322-77280344 CCAACTGGCCTCCCGCCTTCCTC No data
Right 1151938765 17:77280359-77280381 CTCCATTGGCAGCTGTGCAAGGG No data
1151938753_1151938765 15 Left 1151938753 17:77280321-77280343 CCCAACTGGCCTCCCGCCTTCCT No data
Right 1151938765 17:77280359-77280381 CTCCATTGGCAGCTGTGCAAGGG No data
1151938755_1151938765 6 Left 1151938755 17:77280330-77280352 CCTCCCGCCTTCCTCTCGTCCTC No data
Right 1151938765 17:77280359-77280381 CTCCATTGGCAGCTGTGCAAGGG No data
1151938760_1151938765 -5 Left 1151938760 17:77280341-77280363 CCTCTCGTCCTCTACGGCCTCCA No data
Right 1151938765 17:77280359-77280381 CTCCATTGGCAGCTGTGCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151938765 Original CRISPR CTCCATTGGCAGCTGTGCAA GGG Intergenic
No off target data available for this crispr