ID: 1151943460

View in Genome Browser
Species Human (GRCh38)
Location 17:77306684-77306706
Sequence AATCAGGGTTTCCCTACACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 130}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151943460_1151943467 0 Left 1151943460 17:77306684-77306706 CCTGGTGTAGGGAAACCCTGATT 0: 1
1: 0
2: 1
3: 13
4: 130
Right 1151943467 17:77306707-77306729 CATAAGACGGGTGGACATGGAGG 0: 1
1: 0
2: 1
3: 10
4: 188
1151943460_1151943469 7 Left 1151943460 17:77306684-77306706 CCTGGTGTAGGGAAACCCTGATT 0: 1
1: 0
2: 1
3: 13
4: 130
Right 1151943469 17:77306714-77306736 CGGGTGGACATGGAGGAAGGAGG 0: 1
1: 0
2: 3
3: 27
4: 454
1151943460_1151943466 -3 Left 1151943460 17:77306684-77306706 CCTGGTGTAGGGAAACCCTGATT 0: 1
1: 0
2: 1
3: 13
4: 130
Right 1151943466 17:77306704-77306726 ATTCATAAGACGGGTGGACATGG 0: 1
1: 0
2: 0
3: 4
4: 56
1151943460_1151943468 4 Left 1151943460 17:77306684-77306706 CCTGGTGTAGGGAAACCCTGATT 0: 1
1: 0
2: 1
3: 13
4: 130
Right 1151943468 17:77306711-77306733 AGACGGGTGGACATGGAGGAAGG 0: 1
1: 0
2: 0
3: 23
4: 327
1151943460_1151943463 -9 Left 1151943460 17:77306684-77306706 CCTGGTGTAGGGAAACCCTGATT 0: 1
1: 0
2: 1
3: 13
4: 130
Right 1151943463 17:77306698-77306720 ACCCTGATTCATAAGACGGGTGG 0: 1
1: 0
2: 0
3: 2
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151943460 Original CRISPR AATCAGGGTTTCCCTACACC AGG (reversed) Intronic
901521051 1:9785474-9785496 GATCAGGGTTTCTCAACAGCTGG + Intronic
903654915 1:24943158-24943180 CCTCAGGGTGTCCCCACACCTGG - Intronic
909937509 1:81570156-81570178 AATCAGGGTGACACTACACAAGG + Intronic
913382223 1:118224817-118224839 AATTAGGGATTCCAAACACCAGG - Intergenic
915822291 1:159037796-159037818 AATCAGGAGCTCCCTACAACTGG + Intronic
915962030 1:160275011-160275033 AATGAGGGGTCCCCAACACCTGG + Intergenic
916312831 1:163416066-163416088 AATTAGGGTGTCCTTAAACCAGG - Intergenic
916629360 1:166594896-166594918 AATCAGGGATCCCCAACCCCAGG - Intergenic
919501433 1:198342123-198342145 AATCAGGGGTCCCCAACCCCTGG - Intergenic
921442726 1:215207136-215207158 AATCAGGGGTCCCCAACCCCTGG + Intronic
1063672185 10:8108058-8108080 AATCAGGGTTTTCCTGTACAGGG - Intergenic
1064121219 10:12621936-12621958 AACCTGGGTTTCACTCCACCTGG - Intronic
1067317929 10:45186676-45186698 AATCTGGGTGCCCCTACCCCAGG - Intergenic
1074124508 10:110517413-110517435 GACCAGGGTTTCCCAACCCCTGG + Intergenic
1074730719 10:116371938-116371960 TCTCAGTGTTTCCCTACACGGGG + Intronic
1075236467 10:120735440-120735462 GATCAGGGGTCCCCAACACCAGG + Intergenic
1076077990 10:127552456-127552478 AATCAGATTTTCCAGACACCTGG - Exonic
1081254772 11:40878664-40878686 AGTCAGGGATTCCCAACCCCTGG - Intronic
1081751553 11:45514703-45514725 AGTCAGGGAATCCCTACTCCTGG - Intergenic
1088470550 11:110184399-110184421 GACCTGGATTTCCCTACACCAGG - Intronic
1090456642 11:126855851-126855873 CATCAGGGTTTCTCTGGACCTGG + Intronic
1091723625 12:2830812-2830834 AATTCGGGTTTCCCTCCACCAGG + Exonic
1092111116 12:5965460-5965482 ACTCAGGGTTGCCCTCCTCCGGG + Intronic
1096426928 12:51511811-51511833 AATCAGGGTTTTACGACACCAGG + Exonic
1096880274 12:54662004-54662026 AAAAAGGATTTCCCTACACAGGG - Intergenic
1099871602 12:88356441-88356463 TATCAGGGGTTCCCAACCCCTGG + Intergenic
1100043721 12:90352888-90352910 AATGGGAGTTTCCCTACACAAGG + Intergenic
1100107350 12:91191950-91191972 AAGCAGGATTTCCCCACAACTGG + Intergenic
1102561402 12:113764824-113764846 ATCCAGGGCTTCCCTGCACCAGG - Intergenic
1104722239 12:131050997-131051019 ACACAGGGGTTCCCAACACCCGG - Intronic
1106957231 13:34953758-34953780 AACCAGGGGTTCCCAACCCCTGG + Intronic
1107824935 13:44320208-44320230 ACTCAGGCTTTCTCTACCCCCGG - Intergenic
1111542717 13:89689650-89689672 AATCAGGGACCCCCTAGACCTGG - Intergenic
1112115332 13:96346166-96346188 AAGCAGGGGTCCCCAACACCTGG - Intronic
1113698329 13:112364603-112364625 GAACAGGGGTTCCCCACACCTGG + Intergenic
1114890481 14:26915337-26915359 CATCAGGGTTCCCCAACCCCCGG - Intergenic
1115708242 14:36020421-36020443 AATCATGGTTTCCCTGAACTGGG - Intergenic
1116443860 14:44985745-44985767 AAGCAGAGTTTCCCAACTCCTGG - Intronic
1120699263 14:87680411-87680433 AATCAGGGATTCTCCACACCTGG - Intergenic
1122759233 14:104009241-104009263 AAACAGGGTTTCCCAACACCTGG + Intronic
1122838049 14:104440975-104440997 AAACAAGGTGTGCCTACACCTGG + Intergenic
1127296607 15:57614345-57614367 AAGCAGGGCTTCCCCACACAAGG + Intronic
1130220315 15:82013958-82013980 AATCAGTGTTTCCCTGTAGCTGG - Intergenic
1132700890 16:1221597-1221619 AATCAGGCCTCCCCTACATCTGG + Exonic
1133207981 16:4245478-4245500 AATCTGGGTTTTCCTACGTCTGG + Intergenic
1133593805 16:7271672-7271694 AATCACTGTTTCCCGACATCTGG - Intronic
1135163274 16:20116183-20116205 AAGGAGTGTTTCCCTCCACCAGG - Intergenic
1135167894 16:20156740-20156762 AGTGAGGGTTTGCCTTCACCTGG - Intergenic
1136929903 16:34409608-34409630 AAGCGGGGTTCCCCAACACCCGG - Intergenic
1136974671 16:35002197-35002219 AAGCGGGGTTCCCCAACACCCGG + Intergenic
1137559180 16:49492270-49492292 AAACAGGGCCACCCTACACCTGG - Intronic
1139275318 16:65722560-65722582 GATCAGGGGTTCCCAACTCCTGG + Intergenic
1150738590 17:67761167-67761189 AATCAGTGTTTCACTACAAAAGG + Intergenic
1150818748 17:68417563-68417585 GTTCAGGGCTTCCCTACTCCTGG + Intronic
1151943460 17:77306684-77306706 AATCAGGGTTTCCCTACACCAGG - Intronic
1153701488 18:7698940-7698962 AATCAGGGGTCCCCAACCCCTGG + Intronic
1155261032 18:24042558-24042580 AAGCAGGGGTTCCCAACCCCTGG - Intronic
1155299620 18:24417516-24417538 AACCAGGGGTTCCCAACTCCCGG - Intergenic
1156631154 18:38970811-38970833 AATAAGGGTTTCCCTACCTGAGG + Intergenic
1168561173 19:57384639-57384661 AATCAGGGGTCCCCAACCCCTGG + Intronic
929346178 2:40887488-40887510 GATCAGGGGTTCCCAACCCCTGG + Intergenic
930977945 2:57487545-57487567 AATCAGGGATTCCCTGCATGAGG + Intergenic
940233444 2:151483675-151483697 AATCAGGGTTCCCCAACCCACGG + Intronic
940596702 2:155803226-155803248 AATCATGGTTTTCTTACATCAGG - Intergenic
942477611 2:176344616-176344638 ATTCAGGGGTTCCCAACTCCTGG + Intergenic
945568593 2:211435472-211435494 AATCAGGGATCCCCAACCCCTGG + Intronic
946655895 2:221946627-221946649 GATCAGGGGTCCCCAACACCTGG - Intergenic
948019422 2:234718149-234718171 AATTAGGGTATCCGTACGCCTGG - Intergenic
948690269 2:239697747-239697769 AATCAGGGTTCCCCAACCCCTGG - Intergenic
1169534191 20:6519596-6519618 AAACATGGTTTACCCACACCTGG - Intergenic
1174937483 20:54886950-54886972 AGGCAGGGTTTCCCTACAAAGGG + Intergenic
1176295577 21:5070387-5070409 CATCAGGGGTTCCCAACCCCCGG - Intergenic
1178518710 21:33269222-33269244 TGTCAGTGTTTCCCTACGCCTGG + Intronic
1179861472 21:44191737-44191759 CATCAGGGGTTCCCAACCCCCGG + Intergenic
1182605141 22:31496988-31497010 AATCAGGGGTTTCCTCCTCCCGG + Intronic
1183570943 22:38652947-38652969 AATCAGGGGTCCCCAACCCCAGG + Intronic
1183648476 22:39140403-39140425 AATCAGGGTGTCCCCATCCCAGG - Intronic
950133424 3:10563525-10563547 AATCAGGGCTTCCTTGCACCTGG + Intronic
951480700 3:23159370-23159392 AATCAGGGGTCCCCAACCCCCGG - Intergenic
952365568 3:32671826-32671848 TATCAGGGTTCCCCAACACCTGG - Intergenic
952667311 3:35922426-35922448 AAGCAGAGTCTCCCTGCACCTGG + Intergenic
952749322 3:36812547-36812569 ACTCAGGGCTACCATACACCTGG - Intergenic
957493195 3:80956364-80956386 AACCAGGGTTTTCATTCACCAGG - Intergenic
957992467 3:87644768-87644790 GAGCAGGGGTTCCCAACACCTGG + Intergenic
958892381 3:99795489-99795511 ACTCCGGGTTTCCCTATACCAGG - Exonic
962648701 3:137466335-137466357 AATCAGGGTTTCTTAACACAGGG - Intergenic
965152132 3:164991036-164991058 AGACAGGGTTTTCCTAAACCTGG + Intronic
969297156 4:6276951-6276973 AGCCAGGGCTTCCCTACTCCAGG + Intronic
970181073 4:13394533-13394555 GATCAGGGGTTCCCAACCCCTGG - Intronic
975005280 4:69275532-69275554 AAGGAGAGTTTCCCTACACAAGG + Intergenic
976869097 4:89768829-89768851 AATCAGGGGTCCCCAACCCCAGG - Intronic
978914591 4:114109018-114109040 GTTCAGGGTTTACCTACTCCTGG + Intergenic
981819646 4:148871121-148871143 ATACAGGCTTTCCCTACACCAGG - Intergenic
982266093 4:153539587-153539609 TATCAGTGTTTCACTCCACCAGG - Intronic
983439789 4:167766603-167766625 AATCAGGGGTCCTCAACACCTGG - Intergenic
986065473 5:4230100-4230122 ATTCAGGGCTTCACTCCACCCGG - Intergenic
986790422 5:11154305-11154327 AATGAGGGTCTCCCCACACACGG - Intronic
989108497 5:37885716-37885738 ATTCAGGGTTCACCTACACAGGG + Intergenic
990757416 5:59089114-59089136 ACTCAGGTTTTCCATACAGCAGG - Intronic
996658554 5:125970912-125970934 AATCAGGGTTTCCATAAAGGAGG + Intergenic
996770069 5:127076404-127076426 CAGCAGGCTTTCTCTACACCAGG - Intergenic
997964071 5:138344211-138344233 AGTCAGGGTTTCCCAAGCCCAGG + Intronic
999310368 5:150547977-150547999 AATCAGGGTTTCCTGATGCCAGG - Intronic
999388622 5:151173937-151173959 AATCGGGCCTTCCCTACACCTGG - Intergenic
1001164006 5:169346974-169346996 ACTCAGGGTTTCCATAAAGCAGG + Intergenic
1001728355 5:173927587-173927609 AGTCAGGGTTTCACCATACCCGG - Intronic
1002270690 5:178070013-178070035 AACCAGAGTGTCCCTCCACCAGG - Intergenic
1002650634 5:180690598-180690620 AATCAGGGGTCCCCAACCCCTGG + Intergenic
1002974836 6:2064518-2064540 AAACAGGTTTTCCCTTCACATGG - Intronic
1003352829 6:5334937-5334959 AAACAGGGCTTGCCTACACATGG - Intronic
1004173123 6:13314345-13314367 AATCCATGTTTCCCTAGACCTGG - Intronic
1004611915 6:17250069-17250091 AATCATAGTGTCCCTACATCAGG + Intergenic
1005660513 6:27994222-27994244 AATCAGGGGTCCCCAACCCCTGG + Intergenic
1007132099 6:39484884-39484906 AATCTGGGTTTGCCTCCCCCAGG + Intronic
1012080868 6:94756928-94756950 AATCCTGTTTTCCCTAGACCTGG - Intergenic
1015423290 6:133036096-133036118 AATCAGGTCATCCTTACACCAGG - Intergenic
1018661491 6:166091203-166091225 ATTCTGGGTTTCCTTTCACCTGG + Intergenic
1023305681 7:38823964-38823986 ATTCAGGGTTTCACTTTACCTGG + Intronic
1025007722 7:55366991-55367013 AAACATGGCCTCCCTACACCAGG - Intronic
1035816025 8:2541722-2541744 AATTAGTGCTTCCTTACACCAGG - Intergenic
1036487674 8:9194320-9194342 CATCAGGGATTCCCAACACCTGG - Intergenic
1038085597 8:24193096-24193118 ACTCAGGGTTTCCCAACCCCTGG + Intergenic
1038485331 8:27931170-27931192 AATTAGGGTTTCCCTGACCCTGG + Intronic
1040017775 8:42713855-42713877 AATCTGGGTTTCCTAACCCCTGG + Intronic
1041500455 8:58533865-58533887 AATGAGTGTTGCCATACACCAGG + Intergenic
1045574926 8:103410257-103410279 AATCAGGGGTCCCCAACTCCGGG + Intronic
1048346595 8:133580508-133580530 AGTCAGAGTTTCCTCACACCAGG - Intergenic
1053406092 9:37877319-37877341 AATCAGGGTTCCCCAACGCCTGG - Intronic
1054743069 9:68828087-68828109 GGTCAGTGTTTCCCAACACCAGG + Intronic
1056416964 9:86386215-86386237 AACCAGGGTTTCTCTACCTCAGG + Intergenic
1057153255 9:92814283-92814305 AATTAGTATTTTCCTACACCTGG - Intergenic
1058709873 9:107669919-107669941 AATTAGGGCTTCCCAAAACCAGG - Intergenic
1186627983 X:11315493-11315515 AAACAGGGGTTCCCGACCCCCGG - Intronic
1186981001 X:14957377-14957399 AATCAGGGATTCCTAACCCCTGG + Intergenic
1188741610 X:33790493-33790515 GATCAGGGGTTCCCAACCCCCGG + Intergenic
1190859930 X:54335072-54335094 AGTCAGGGTTTCACTAAACCAGG - Intronic
1191103859 X:56760163-56760185 AGGCAGGGTTTCCCCCCACCGGG - Intergenic
1191854339 X:65611046-65611068 AATTATGGTTTCCCTAGGCCTGG - Intronic
1194114678 X:89881092-89881114 AATGAGGGTTTCTGTACACGAGG + Intergenic
1194167889 X:90543456-90543478 AATCAGGATATTCCTACACAAGG + Intergenic
1196518436 X:116641759-116641781 AATCTGGGTTTTCTTACTCCTGG + Intergenic
1197958573 X:131979219-131979241 AATCTGGGTACACCTACACCTGG + Intergenic
1198375421 X:136034102-136034124 AATCAGGGATCCCCAACTCCCGG + Intronic
1200270690 X:154679805-154679827 AAACAGGATGTTCCTACACCTGG + Intronic
1200514146 Y:4121247-4121269 AATCAGGATATTCCTACACAAGG + Intergenic