ID: 1151943904

View in Genome Browser
Species Human (GRCh38)
Location 17:77308987-77309009
Sequence GTGCCCAACATGACTGCGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 58}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151943904_1151943912 16 Left 1151943904 17:77308987-77309009 CCCATCGCAGTCATGTTGGGCAC 0: 1
1: 0
2: 0
3: 1
4: 58
Right 1151943912 17:77309026-77309048 CAGCCGCTGCTGTGTTTCTGGGG 0: 1
1: 0
2: 1
3: 28
4: 268
1151943904_1151943911 15 Left 1151943904 17:77308987-77309009 CCCATCGCAGTCATGTTGGGCAC 0: 1
1: 0
2: 0
3: 1
4: 58
Right 1151943911 17:77309025-77309047 CCAGCCGCTGCTGTGTTTCTGGG 0: 1
1: 0
2: 2
3: 22
4: 216
1151943904_1151943914 29 Left 1151943904 17:77308987-77309009 CCCATCGCAGTCATGTTGGGCAC 0: 1
1: 0
2: 0
3: 1
4: 58
Right 1151943914 17:77309039-77309061 GTTTCTGGGGAGCTTTTCTCCGG 0: 1
1: 0
2: 0
3: 21
4: 198
1151943904_1151943909 14 Left 1151943904 17:77308987-77309009 CCCATCGCAGTCATGTTGGGCAC 0: 1
1: 0
2: 0
3: 1
4: 58
Right 1151943909 17:77309024-77309046 CCCAGCCGCTGCTGTGTTTCTGG 0: 1
1: 0
2: 8
3: 20
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151943904 Original CRISPR GTGCCCAACATGACTGCGAT GGG (reversed) Intronic
901083063 1:6594305-6594327 GTGCCCAGCCTGACAGTGATGGG - Intronic
901719899 1:11188574-11188596 GTGCCAAGCATGTCTGGGATTGG - Intronic
904885714 1:33736737-33736759 CTGCCCAACAAGACTGTGAGTGG - Intronic
907442436 1:54487648-54487670 GTGCCCAGCATGCCGGCGTTGGG + Intergenic
909376747 1:74950269-74950291 GTGCCCTACATCACAGCCATGGG + Intergenic
910245605 1:85135101-85135123 GAGGCCAGCATGACTGGGATGGG - Intergenic
918924031 1:190756726-190756748 GTGCCCACCCTGACTGAGAATGG - Intergenic
1070952550 10:80442872-80442894 GTGCCCTTCATGACTGTGCTAGG + Intergenic
1089370629 11:117953509-117953531 CTGCCCAGCATGACTGAGAGAGG - Intergenic
1092585699 12:9899140-9899162 GAGCCCAACATGCCTGCAAAAGG - Intronic
1103142405 12:118560202-118560224 GTGCCCACCATGACTGACTTAGG + Intergenic
1104612102 12:130237216-130237238 GTGCCCACCATGTCTGCAGTGGG - Intergenic
1108595645 13:51946348-51946370 GTGCCCACCATGACAGCCGTGGG + Exonic
1124136172 15:27038107-27038129 GTGGCCAACCGGACTGAGATGGG - Intronic
1126227978 15:46293606-46293628 GCGCCCATCATGACTGCCCTGGG - Intergenic
1126625047 15:50678345-50678367 GTGACCAACATGCCTGCCAAGGG + Intronic
1133404046 16:5509029-5509051 GTGTCCAACATGACTGAGTAAGG - Intergenic
1139116728 16:63963333-63963355 GTGCCCAACCAGACTGAGAGTGG - Intergenic
1143545462 17:7592699-7592721 GGGCCCAACATGACAGAGAATGG - Exonic
1151717521 17:75838751-75838773 CTGCCCATCATGGCTGCCATTGG - Intronic
1151943904 17:77308987-77309009 GTGCCCAACATGACTGCGATGGG - Intronic
1155017156 18:21855278-21855300 CCGCCTAACATGACTGCGATGGG - Intronic
1156822564 18:41390434-41390456 GTCCCCAAGATGACTGAGAAGGG - Intergenic
1157547295 18:48555469-48555491 CTGCCCAAAGTGACTGTGATGGG + Intronic
1162128854 19:8513301-8513323 GTGGCCAGCATGTCTGGGATGGG + Exonic
928107006 2:28477041-28477063 GTGCCCAGCATGGCTGGGACAGG + Intronic
931343700 2:61426785-61426807 GTGGCCACCATGACTGTGCTGGG - Intronic
936290847 2:111222956-111222978 ATGCCCAACATGGCTGCCAAGGG - Intergenic
937982387 2:127623226-127623248 GTGGCCAAGATGACTTGGATGGG - Exonic
942802556 2:179892413-179892435 GTGCCCATCCTTACTGAGATTGG - Intergenic
945865626 2:215171803-215171825 GTGCCCAAGATGAGTACGAGCGG + Intergenic
1168848805 20:962619-962641 CTGCCCAACATGACTCCCAAAGG + Intronic
1169680011 20:8201482-8201504 GTGCCCAAGAGAACTGCTATTGG + Intronic
1172406498 20:34693719-34693741 CTGCCCAACCTGACATCGATGGG - Intergenic
1172808049 20:37627268-37627290 GTGCCCAAAATCAGTGGGATAGG + Intergenic
1175492256 20:59387141-59387163 GTGCCCAACATGAGGACAATTGG - Intergenic
1183616696 22:38950154-38950176 GTGCCCACCATGGCTGAGGTTGG - Intergenic
966907958 3:184541430-184541452 GTGCCCATCATGCCGGCAATGGG + Intronic
978770308 4:112449759-112449781 GTTCCCAACATGATTTCAATAGG + Intergenic
981108667 4:140910765-140910787 GTGCTCAGCAGGACTGGGATAGG - Intronic
983124403 4:163932652-163932674 GTGGCCTACATGAGTGCGGTTGG + Intronic
1002635679 5:180607192-180607214 TTGCCCAACATGACAGCCAGGGG - Intronic
1005481057 6:26255948-26255970 ATGCCTAACATGAATGAGATTGG + Intergenic
1007289488 6:40774604-40774626 ATGCCCAACATCACTGCTACAGG + Intergenic
1017451641 6:154559669-154559691 GTTTTCAACATGAGTGCGATGGG - Intergenic
1019400497 7:849651-849673 GTACCCAACATGACAGCGTGTGG - Intronic
1020899561 7:13988753-13988775 GTGCCCAACATGAGTGGAAGAGG - Intronic
1032222071 7:130001913-130001935 CTTCCCAAAATGACTGGGATGGG - Intergenic
1036262696 8:7253196-7253218 GTGCCTCACACCACTGCGATGGG + Intergenic
1036303889 8:7586362-7586384 GTGCCTCACACCACTGCGATGGG - Intergenic
1036314736 8:7711735-7711757 GTGCCTCACACCACTGCGATGGG + Intergenic
1036354744 8:8034354-8034376 GTGCCTCACACCACTGCGATGGG - Intergenic
1037659367 8:20913788-20913810 GTGCCCAGAATGTCTGAGATGGG + Intergenic
1039930908 8:41987787-41987809 GTGATGAACATGACTGGGATAGG - Intronic
1040438067 8:47412507-47412529 GTGCCCAAAATGACTTTCATTGG + Intronic
1042749376 8:72141335-72141357 CTCCCCAACATGTCTGGGATAGG + Intergenic
1043989222 8:86732272-86732294 GTGCCCAGCATGTGTGTGATGGG - Intronic
1047550937 8:125871582-125871604 GTGCCCACCCAGACTGAGATTGG + Intergenic
1051311163 9:15774355-15774377 GTGCTCAACATCACTAAGATCGG + Intronic
1061933389 9:133844714-133844736 CTGCCCAGCATGACTGAGCTCGG - Intronic