ID: 1151946778

View in Genome Browser
Species Human (GRCh38)
Location 17:77323900-77323922
Sequence CATCACCAAGTGCCACAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1375
Summary {0: 1, 1: 1, 2: 28, 3: 276, 4: 1069}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151946769_1151946778 18 Left 1151946769 17:77323859-77323881 CCGTGGGAACTCTGGTCCCTGTA 0: 1
1: 0
2: 2
3: 18
4: 164
Right 1151946778 17:77323900-77323922 CATCACCAAGTGCCACAAACTGG 0: 1
1: 1
2: 28
3: 276
4: 1069
1151946767_1151946778 20 Left 1151946767 17:77323857-77323879 CCCCGTGGGAACTCTGGTCCCTG 0: 1
1: 0
2: 0
3: 16
4: 148
Right 1151946778 17:77323900-77323922 CATCACCAAGTGCCACAAACTGG 0: 1
1: 1
2: 28
3: 276
4: 1069
1151946766_1151946778 24 Left 1151946766 17:77323853-77323875 CCAGCCCCGTGGGAACTCTGGTC 0: 1
1: 0
2: 0
3: 13
4: 128
Right 1151946778 17:77323900-77323922 CATCACCAAGTGCCACAAACTGG 0: 1
1: 1
2: 28
3: 276
4: 1069
1151946765_1151946778 25 Left 1151946765 17:77323852-77323874 CCCAGCCCCGTGGGAACTCTGGT 0: 1
1: 0
2: 0
3: 12
4: 135
Right 1151946778 17:77323900-77323922 CATCACCAAGTGCCACAAACTGG 0: 1
1: 1
2: 28
3: 276
4: 1069
1151946775_1151946778 1 Left 1151946775 17:77323876-77323898 CCTGTAGTGGTTTCCTGGGGCTG 0: 1
1: 1
2: 12
3: 80
4: 384
Right 1151946778 17:77323900-77323922 CATCACCAAGTGCCACAAACTGG 0: 1
1: 1
2: 28
3: 276
4: 1069
1151946763_1151946778 29 Left 1151946763 17:77323848-77323870 CCTGCCCAGCCCCGTGGGAACTC 0: 1
1: 1
2: 2
3: 28
4: 310
Right 1151946778 17:77323900-77323922 CATCACCAAGTGCCACAAACTGG 0: 1
1: 1
2: 28
3: 276
4: 1069
1151946768_1151946778 19 Left 1151946768 17:77323858-77323880 CCCGTGGGAACTCTGGTCCCTGT 0: 1
1: 0
2: 1
3: 19
4: 184
Right 1151946778 17:77323900-77323922 CATCACCAAGTGCCACAAACTGG 0: 1
1: 1
2: 28
3: 276
4: 1069
1151946774_1151946778 2 Left 1151946774 17:77323875-77323897 CCCTGTAGTGGTTTCCTGGGGCT 0: 1
1: 0
2: 11
3: 61
4: 295
Right 1151946778 17:77323900-77323922 CATCACCAAGTGCCACAAACTGG 0: 1
1: 1
2: 28
3: 276
4: 1069

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151946778 Original CRISPR CATCACCAAGTGCCACAAAC TGG Intronic
900099332 1:954481-954503 CACCACCAACTGCCGCAGACTGG + Intronic
900311991 1:2037984-2038006 CATGACAAATGGCCACAAACTGG - Intergenic
900711259 1:4115919-4115941 CATAATTAAGTGCCACAAACTGG + Intergenic
900738754 1:4317520-4317542 CATAACAAACTGTCACAAACCGG - Intergenic
900746790 1:4366112-4366134 CATCACCAGATGCCACACATCGG + Intergenic
900760781 1:4468776-4468798 CATCATAAAGTGCCACACGCCGG + Intergenic
900907794 1:5572968-5572990 CAACACCAACTACCACAACCTGG - Intergenic
900923843 1:5690817-5690839 CATCACAAGGTGCCACACACTGG - Intergenic
901145202 1:7060164-7060186 CATAACAAAGCACCACAAACAGG + Intronic
901457937 1:9374248-9374270 TATAACCAAGTACCACACACTGG + Intergenic
902587312 1:17448067-17448089 CATAACAAAGTACCACAGACAGG + Intergenic
902657645 1:17880392-17880414 CATAACAAAATACCACAAACTGG + Intergenic
902673983 1:17995623-17995645 CATAACAAAGTGCCACACCCTGG + Intergenic
902824911 1:18966229-18966251 AATCACCGAGTGCCATCAACAGG + Intergenic
902909889 1:19587923-19587945 CATAACAAAGGACCACAAACTGG + Intergenic
902961394 1:19965565-19965587 CATAACAAAGTCCCACAGACTGG - Intergenic
902981846 1:20129071-20129093 CATAACGAAGTCCCACAAACTGG - Intergenic
903073003 1:20737190-20737212 CATAACAAAGTACCACAGACAGG - Intergenic
904778767 1:32929012-32929034 CATAACAAAGTACCATAAACTGG + Intergenic
904869717 1:33608866-33608888 CATAAGAAAGTACCACAAACTGG - Intronic
905212897 1:36386325-36386347 CCTCACAGAGTTCCACAAACCGG - Intergenic
905523983 1:38622916-38622938 CATAACAAAGCGCCACAAACTGG - Intergenic
905586776 1:39126102-39126124 AATAACGAAGTACCACAAACTGG + Intronic
905953994 1:41976973-41976995 CAGAACAAAGTACCACAAACCGG - Intronic
906010125 1:42515371-42515393 CATAACAAAATCCCACAAACTGG - Intronic
906167294 1:43696236-43696258 GGTCACTAAGTACCACAAACTGG + Intronic
906448702 1:45924992-45925014 CATAACCAAGTATCACAAACTGG - Intronic
906732891 1:48098416-48098438 CATAACAAATTACCACAAACTGG - Intergenic
906771403 1:48488213-48488235 CATTACAAAGTACCACAAACTGG - Intergenic
906817505 1:48893895-48893917 CATAACAAAGTACCATAAACTGG - Intronic
907383203 1:54108617-54108639 CATAACAAAGTACCACAGACTGG - Intronic
907557780 1:55359615-55359637 TATCACAAAGCACCACAAACTGG - Intergenic
907567110 1:55445578-55445600 CATAACCCAGTACCACAAACTGG - Intergenic
907567710 1:55451826-55451848 CATAACAAAATACCACAAACAGG + Intergenic
907587850 1:55637387-55637409 CATAACAAAGTGCCAAAGACTGG - Intergenic
907830217 1:58057745-58057767 CATGACAAAGTACCACAAACTGG - Intronic
907900447 1:58736300-58736322 CATAACAGAGTGCCACAAACTGG - Intergenic
908029580 1:59985577-59985599 CATAACCAAGTACTGCAAACTGG - Intergenic
908259508 1:62328341-62328363 CATAATAAAGTACCACAAACTGG - Intergenic
908283890 1:62572481-62572503 CATAACAAAGTACCATAAACAGG + Intronic
908333538 1:63096609-63096631 CATAACAAAGTCCAACAAACTGG - Intergenic
908572323 1:65422494-65422516 CGTTACAAAGTACCACAAACTGG - Intronic
908771996 1:67605970-67605992 CATCACAAAGTGCTACAGACTGG + Intergenic
909027432 1:70499067-70499089 TATAACAAAATGCCACAAACTGG - Intergenic
909155290 1:72066798-72066820 CATAACAAAATGCCACAGACTGG - Intronic
909696906 1:78477753-78477775 CATAACAAAGTACCACAAATTGG + Intronic
909725219 1:78826789-78826811 CATAACAAAGTACCACAAACTGG + Intergenic
909892474 1:81025045-81025067 TGTCACCAAGTATCACAAACTGG + Intergenic
910071543 1:83220323-83220345 CATGACAAAGTACCACAGACTGG + Intergenic
910240904 1:85085276-85085298 CATAACCAAGTACTACAAATGGG - Intronic
910552368 1:88490143-88490165 CATAACAAAGTGCCACAAACTGG - Intergenic
910554260 1:88513286-88513308 CATAACACAGTGCCACAGACTGG + Intergenic
910665619 1:89723161-89723183 CATGACAAAGTACCACAAACTGG + Intronic
910691579 1:89970821-89970843 CATAACCAAGTACCACAGACTGG - Intergenic
911154555 1:94625379-94625401 TATAACAAAGTGCCACAAGCTGG + Intergenic
911535429 1:99094171-99094193 CATAACAAAGTACCACAGACTGG - Intergenic
911561883 1:99416585-99416607 CATCAACAGGTGCCACACACAGG - Intergenic
911572070 1:99529318-99529340 CATAACAAAGTACCACAGACTGG + Intergenic
911813261 1:102311035-102311057 TATCACAAAATGCCACAGACTGG - Intergenic
912583862 1:110744029-110744051 CATAAGAAAGTACCACAAACTGG - Intergenic
913339017 1:117738681-117738703 CATAACAAAATACCACAAACAGG + Intergenic
913461737 1:119093743-119093765 CATAACCAAGTACCACAAACTGG - Intronic
913939997 1:125093332-125093354 CATAACCAAGTAACACAAACTGG + Intergenic
914990405 1:152495035-152495057 CAAAACCAAGTGTCACAAAGTGG - Intergenic
915100292 1:153494543-153494565 CAAAACCAAGTGCCACTAAGGGG + Intergenic
916463042 1:165046410-165046432 CATAACCGAGTACCATAAACTGG + Intergenic
916567468 1:165993821-165993843 CATAACAAAATGCCATAAACTGG - Intergenic
916644257 1:166766833-166766855 TATAACAAAGTACCACAAACTGG + Intergenic
916655333 1:166870449-166870471 CATAACAAAGTACCACAGACTGG - Intronic
917124001 1:171670158-171670180 CATAACTAAGTACCACAAACTGG + Intergenic
917284979 1:173414123-173414145 CATCACAAAGTACCACAGACTGG + Intergenic
917426656 1:174921222-174921244 CATAACAAAGTACCACAGACTGG - Intronic
917960644 1:180141659-180141681 CTTAACAAAGTACCACAAACTGG - Intergenic
918092761 1:181311627-181311649 CATAACAAAGTGCCACAGATTGG + Intergenic
918157422 1:181862618-181862640 CATAACAAAATGCCACAGACTGG - Intergenic
918533790 1:185551878-185551900 TATCACAAAATGCCATAAACTGG - Intergenic
918547886 1:185706772-185706794 CATAACAAATTCCCACAAACTGG + Intergenic
918940704 1:190992862-190992884 CATAACAAAGTACCACAGACTGG + Intergenic
919150090 1:193685433-193685455 TATAACAAAGTACCACAAACTGG + Intergenic
919155388 1:193758555-193758577 CATAACAAAGTACCACAGACTGG + Intergenic
919308023 1:195869283-195869305 CATAACCAAATGCCATAGACTGG + Intergenic
919376940 1:196807017-196807039 CATCACCTAATGCCAAAACCTGG - Intergenic
919809796 1:201401356-201401378 CGTGATGAAGTGCCACAAACTGG + Intergenic
920011960 1:202874477-202874499 CAGCACCAAGTTCTACAATCCGG - Intergenic
920141063 1:203813597-203813619 CATAACAAAGTATCACAAACTGG + Intronic
920606843 1:207397088-207397110 CATAACAAAGTCCTACAAACTGG - Intergenic
920725130 1:208427836-208427858 CATAACGAAGTGCCAAAATCTGG - Intergenic
920746662 1:208635484-208635506 CATAACGAAGTACCACAAACTGG - Intergenic
920828322 1:209443253-209443275 CATGACAAATTGCCACAGACTGG - Intergenic
920833643 1:209487775-209487797 CATAACAAAGTACCACCAACTGG - Intergenic
920862391 1:209721215-209721237 CATAACAAATTACCACAAACTGG - Intronic
920918233 1:210276002-210276024 CATAACAGAGTACCACAAACTGG + Intergenic
921260219 1:213379597-213379619 CATAACAAAGTACCACAAACTGG - Intergenic
921914334 1:220590302-220590324 CATCACAAAATACCACAGACTGG + Intronic
922156841 1:223047242-223047264 CATAACTAGGTACCACAAACTGG - Intergenic
922613523 1:226946781-226946803 CACCTCCAAATGCCACACACAGG - Intronic
922918118 1:229275468-229275490 CATCACAAAGAACCACAAACTGG - Intronic
922951847 1:229564446-229564468 CATAACAAAGTGCCAGGAACTGG - Intergenic
923000247 1:230001265-230001287 CATAACAAAGTGCCACAGATTGG + Intergenic
923143202 1:231179063-231179085 CATCACAAATTACCACAAGCTGG + Intronic
923219607 1:231881243-231881265 CATAACCAAAGACCACAAACCGG + Intronic
923267180 1:232326224-232326246 CATAACAAAGTACCACCAACTGG + Intergenic
923512808 1:234667103-234667125 CATAACAAAATGCCACAAATTGG - Intergenic
923523508 1:234755043-234755065 AATCAGCCAGTGCCACAAAGCGG - Intergenic
923548323 1:234941115-234941137 CATAACAAAGTACCACAAACCGG + Intergenic
923552761 1:234977381-234977403 CATAACAAAGTACCACAGACTGG + Intergenic
923562941 1:235055319-235055341 CATAACAAAGTGCCACAGCCTGG + Intergenic
923681745 1:236124122-236124144 CATGACAAAGTGCCACAGACTGG - Intergenic
924041839 1:239991725-239991747 CAGAACAAAGTACCACAAACTGG + Intergenic
924119265 1:240779649-240779671 TATAACAAAATGCCACAAACTGG - Intronic
924143351 1:241048772-241048794 CATGACAATGTGCCACCAACTGG + Intronic
924326362 1:242898305-242898327 CATAACAAAGTACCACAACCTGG + Intergenic
924493316 1:244561469-244561491 CGTAACAAAGTACCACAAACTGG + Intronic
924800626 1:247327532-247327554 CATAACAAAGTACCACAGACTGG - Intronic
924840424 1:247705114-247705136 GATCACAAAGTTCCACAATCGGG + Intergenic
1062767842 10:79388-79410 CGTAACAAAGTGCCACAAAATGG - Intergenic
1062845298 10:698753-698775 CATAGCTAAGTGCCACAAACTGG + Intergenic
1062895637 10:1101197-1101219 CATAACAAAGTGCCACAGGCAGG + Intronic
1062991004 10:1817838-1817860 TATAACAAAGTGCCACAAACTGG + Intergenic
1063165069 10:3454281-3454303 CATGACCAAGCGGCAGAAACAGG + Intergenic
1063209336 10:3864607-3864629 CATAACAAAGTGCCACAGACAGG - Intergenic
1063425695 10:5948459-5948481 CATCACCCACTGACACAGACGGG - Intronic
1063648786 10:7912917-7912939 CATCACAAAATGCCACAGACTGG + Intronic
1063716070 10:8528442-8528464 CATCACAAAGTAACACAGACTGG - Intergenic
1063754515 10:8991963-8991985 CATCACAAAGTACCACAGACAGG - Intergenic
1064292116 10:14044740-14044762 CATAACAAAATGTCACAAACTGG - Intronic
1064496016 10:15911323-15911345 CATCACCGATGGCCACAGACAGG - Intergenic
1064545181 10:16443091-16443113 CATCACAAAATACCACAAACTGG + Intronic
1064555322 10:16541766-16541788 CATAACAAAGTACCACAGACTGG - Intergenic
1064574919 10:16735108-16735130 CATAACAAAGTGCCAAAGACTGG - Intronic
1065191234 10:23211046-23211068 CATAACAAAGTAGCACAAACTGG + Intronic
1065849784 10:29778174-29778196 CATCACAGAGTACTACAAACTGG - Intergenic
1065959816 10:30725458-30725480 TATGACAAAGTACCACAAACTGG - Intergenic
1065984182 10:30933069-30933091 CATAAGCAAGTACTACAAACTGG - Intronic
1066057466 10:31695436-31695458 CATAACAAAGTACCACAGACTGG + Intergenic
1066500269 10:35986726-35986748 CATCTCCAGGTGCCACAATGGGG + Intergenic
1066661096 10:37738794-37738816 CATCACAAAGCACCACAGACAGG - Intergenic
1066665972 10:37782907-37782929 CATCACAAAGTACCTAAAACTGG - Intronic
1066780152 10:38936473-38936495 CATAACCAAGTAACACAAACTGG - Intergenic
1066980019 10:42404300-42404322 AATCAGCAAGTGCAGCAAACTGG + Intergenic
1067514113 10:46922015-46922037 CATAACAAAGTGCCACAAATTGG - Intronic
1067568010 10:47351980-47352002 CTTCACCAAGTGCCCCACGCTGG + Intronic
1067648140 10:48129817-48129839 CATAACAAAGTGCCACAAATTGG + Intergenic
1067696334 10:48538033-48538055 CATAACTAACTCCCACAAACTGG + Intronic
1068067479 10:52149733-52149755 CATAACAAAATGCCACAGACTGG - Intronic
1068116492 10:52742162-52742184 CCTCACCAAGTGTCACAGAGTGG - Intergenic
1068128223 10:52867156-52867178 CATCACAAAGTTCCACAAATGGG + Intergenic
1068459036 10:57302140-57302162 CATAACAAAATACCACAAACTGG + Intergenic
1068773191 10:60845039-60845061 TATAACAAAGTGCCACAGACTGG + Intergenic
1069760364 10:70806449-70806471 TGTAACAAAGTGCCACAAACTGG + Intergenic
1069840406 10:71336041-71336063 CTTCACCAAGTACCACAAACTGG + Intronic
1070610624 10:77929851-77929873 CATAACCAATGACCACAAACTGG - Intergenic
1070643292 10:78184310-78184332 CATAACAAGATGCCACAAACTGG - Intergenic
1070701238 10:78603146-78603168 TGTAACCAAGTACCACAAACTGG + Intergenic
1070799588 10:79237393-79237415 CATAACAAAGTGCCACACAGCGG + Intronic
1071929894 10:90456937-90456959 CATAGCAAAGTGCCACAAACTGG - Intergenic
1071974784 10:90944452-90944474 CGTAACAAAGTACCACAAACAGG + Intergenic
1072104875 10:92264433-92264455 CCTCACCAACTGCCACACCCAGG + Intronic
1072539011 10:96384366-96384388 CATAACAAATTACCACAAACTGG - Intronic
1073089563 10:100923183-100923205 CATAACAAAGTGCCAAAACCAGG + Intronic
1073283941 10:102375935-102375957 CATCACTAAATCCCAGAAACTGG + Intronic
1073546888 10:104357009-104357031 CATAACAAAGCACCACAAACTGG + Intronic
1073828710 10:107357251-107357273 CATAACAAAATGCCTCAAACTGG + Intergenic
1074033464 10:109713091-109713113 CATCACAAAGTACCGCAGACTGG + Intergenic
1074181402 10:111068036-111068058 CATAACAAAGTACCACACACTGG - Intergenic
1074227811 10:111504737-111504759 CATAACAAAGTGCCACAGACTGG + Intergenic
1074269127 10:111935661-111935683 CATAACAAAGTACCACAGACTGG + Intergenic
1074281868 10:112059681-112059703 CATAACAAAATGCCACAAACTGG + Intergenic
1074358413 10:112805906-112805928 CATAACAAAGTCCCACAGACTGG - Intronic
1074559891 10:114526221-114526243 CACCACCAAATCCCCCAAACAGG + Intronic
1074717823 10:116235966-116235988 CATAACAAAGTACCATAAACTGG - Intronic
1074760407 10:116663412-116663434 CTCCACAAAGTCCCACAAACTGG - Intergenic
1074915345 10:117950119-117950141 TATAACAAAGTGCCACACACTGG - Intergenic
1074939302 10:118218996-118219018 CATAACAAAATACCACAAACTGG - Intergenic
1075127022 10:119708577-119708599 CATCACCAGGTGCCACAAACTGG - Intergenic
1075150660 10:119927313-119927335 CATAACAAAGTTCCACAACCTGG + Intronic
1075219324 10:120570878-120570900 CATCACCAAGTGTCAGAAACAGG + Intronic
1075225134 10:120621995-120622017 CATAACAAATTTCCACAAACTGG + Intergenic
1075235766 10:120727455-120727477 CATAGCAAAGTACCACAAACTGG + Intergenic
1075407883 10:122206623-122206645 CATCACCAAGGACCACAGACTGG - Intronic
1075518486 10:123129018-123129040 CTTAACTAAGTGCCACAATCTGG - Intergenic
1075602990 10:123784395-123784417 TATAACCAGGTGCCCCAAACTGG - Intronic
1075622929 10:123940846-123940868 CGTCCAAAAGTGCCACAAACAGG + Intergenic
1075827723 10:125374106-125374128 CATAACAAAGTACCACAGACTGG + Intergenic
1076157166 10:128212869-128212891 CATAACTAAGTCCCACAAACTGG - Intergenic
1076378770 10:130011043-130011065 CATGACAAAGTGCCACCAGCTGG - Intergenic
1076416927 10:130297937-130297959 CATCAACAAAAACCACAAACAGG + Intergenic
1076917012 10:133428436-133428458 CATAACAAAGTGCCACAGACAGG - Intergenic
1076937111 10:133573241-133573263 CATAACAAAGTGCCACAGACAGG - Intergenic
1077672201 11:4166929-4166951 CATCACAAATTGTCACAAAGTGG + Intergenic
1078255784 11:9657701-9657723 CATAACAAGGTACCACAAACAGG + Intergenic
1078274036 11:9825437-9825459 CGTAACAAAGTGCCACAAATTGG - Intronic
1078387819 11:10908393-10908415 CACAACCAAGCACCACAAACTGG + Intergenic
1078509496 11:11975132-11975154 CATCACAAAGTACCCCAAACAGG - Intronic
1079323052 11:19468274-19468296 TGTAACAAAGTGCCACAAACTGG + Intronic
1079345726 11:19650490-19650512 CATAACAAAGTACCACAACCAGG - Intronic
1080014680 11:27491899-27491921 CATAACAAAGTACCACAAACTGG + Intergenic
1080190087 11:29534784-29534806 CATAACAAAGTACCCCAAACTGG - Intergenic
1080571613 11:33562414-33562436 TATAAGCAAGTGCCACAGACTGG + Intronic
1080719038 11:34831397-34831419 CATAACAAAGTACCACAAACTGG + Intergenic
1080847968 11:36042941-36042963 CATAACCAAGTACCACAAATTGG - Intronic
1080922985 11:36727227-36727249 CATCACGAAGTCCCACAAACTGG + Intergenic
1081183008 11:40007086-40007108 CACAACAAAGTACCACAAACTGG + Intergenic
1081303320 11:41479991-41480013 CATCACAAATTGCCACAAACTGG - Intergenic
1081461580 11:43277178-43277200 TGTCACCAAGTGCCACAAGCTGG - Intergenic
1081486260 11:43531989-43532011 CATAACAAGGTGCCATAAACTGG - Intergenic
1081587571 11:44397946-44397968 CATTACAAAATGCCACAGACTGG + Intergenic
1081635403 11:44718245-44718267 CATGTCAAAGTGCCACAAACTGG + Intergenic
1081803962 11:45879744-45879766 CATGACAAAGTACCACAGACTGG + Intronic
1082637555 11:55614993-55615015 CATAACAAAGCACCACAAACTGG - Intergenic
1082755520 11:57072185-57072207 CATAACAAAGTACCACACACTGG + Intergenic
1083355884 11:62065786-62065808 CGTCACAAAGTGCCACAAGCTGG + Intergenic
1083473848 11:62902845-62902867 CGTAACAAAGTACCACAAACTGG - Intergenic
1084502522 11:69543315-69543337 TATGACAAAGTCCCACAAACTGG + Intergenic
1084677245 11:70642663-70642685 AAACACCAAGTGACACAAACAGG + Intronic
1084721659 11:70909883-70909905 CATCACTAAGCACCACAGACCGG + Intronic
1084747470 11:71182356-71182378 CACGACAAAGTACCACAAACTGG + Intronic
1085879471 11:80448876-80448898 CATCACCTAGATCCATAAACTGG + Intergenic
1085898326 11:80666480-80666502 CATAACAAAGTACCACAAACTGG + Intergenic
1086177829 11:83913662-83913684 CATTACCAGCTCCCACAAACAGG - Intronic
1086539133 11:87886477-87886499 AATCATCAAGTGCTGCAAACGGG + Intergenic
1086573503 11:88311926-88311948 CATAACAAAGTACCACAGACTGG - Intronic
1086665985 11:89482638-89482660 CATAACAAAGTACCACAGACTGG - Intronic
1086925439 11:92635096-92635118 CATCACCAAAGACCACAGACTGG - Intronic
1086952308 11:92903805-92903827 CATTACAAAATACCACAAACTGG - Intergenic
1087119605 11:94559862-94559884 CATTACCAAGAGTAACAAACAGG - Intronic
1087132888 11:94684123-94684145 CATAACAAAGTGCCACAAACTGG + Intergenic
1087570489 11:99921145-99921167 CATAACAACGTGCCACAGACTGG - Intronic
1088609783 11:111566068-111566090 CATAACAAAGTACCACAAACTGG - Intergenic
1088790600 11:113222916-113222938 CATCTCCAAATGAGACAAACAGG - Intronic
1088812146 11:113399205-113399227 CAGCACCATGTGCCAAAAGCAGG - Exonic
1088838023 11:113595292-113595314 TATAACAATGTGCCACAAACTGG + Intergenic
1088850238 11:113698223-113698245 CATGACTAAGTACCACAGACCGG - Intronic
1089187590 11:116630432-116630454 CATATCAAAGTACCACAAACTGG + Intergenic
1089576752 11:119449934-119449956 CATAACAAAGTACCACACACTGG - Intergenic
1090457162 11:126860193-126860215 CAGCACCAAGTACCAGCAACGGG - Intronic
1090476111 11:127021940-127021962 CATGACAAAATGCCACAAACTGG - Intergenic
1090781165 11:130007920-130007942 CATAACAAAGTATCACAAACAGG - Intergenic
1090869828 11:130734297-130734319 CATAACAAAATACCACAAACTGG + Intergenic
1090925809 11:131249605-131249627 CATAACGAAGTACCATAAACTGG + Intergenic
1091145349 11:133274598-133274620 CATAACAAAGTACCACAACCAGG - Intronic
1091634303 12:2185738-2185760 CCTGACAAAGTGCCACAGACAGG - Intronic
1091765182 12:3115488-3115510 TATCACAAAGTCCCACAGACTGG + Intronic
1091833279 12:3565834-3565856 CATCATCAAGTCTAACAAACAGG - Intronic
1091854963 12:3732011-3732033 CTTAACAAAGTGCCACCAACTGG - Intronic
1092010829 12:5111083-5111105 CATAACAAAGTACCACAGACTGG - Intergenic
1092361336 12:7839095-7839117 CATAACAAAATACCACAAACAGG - Intronic
1092375779 12:7954359-7954381 CATAACAAAATACCACAAACAGG - Intergenic
1092726417 12:11490214-11490236 CATCCATAAGAGCCACAAACTGG - Intronic
1092941042 12:13407436-13407458 CATCTCAAAGTACCACGAACTGG + Intergenic
1093475420 12:19549343-19549365 CCTAACCAACTACCACAAACTGG + Intronic
1093830038 12:23744788-23744810 CATAACAAAGTACCACAGACTGG + Intronic
1093926044 12:24909471-24909493 AGTAACAAAGTGCCACAAACTGG + Intronic
1094146349 12:27232377-27232399 CATAACAAAGTACCACAGACTGG + Intergenic
1094616827 12:32043464-32043486 CATAACAAAGCACCACAAACTGG + Intergenic
1095267187 12:40174232-40174254 CATAACAAAGTACCACAAACTGG + Intergenic
1095476777 12:42593642-42593664 CATAATAAAGTACCACAAACTGG - Intergenic
1095515613 12:43002279-43002301 TATAACAAAGTGCCACAGACTGG + Intergenic
1095527350 12:43143003-43143025 CATAACAAAGTACCATAAACTGG - Intergenic
1095658336 12:44697815-44697837 CATAATAAAGTACCACAAACTGG + Intronic
1095673860 12:44893040-44893062 CATAACAAATTTCCACAAACTGG + Intronic
1095885744 12:47186785-47186807 CATCACGAAGTATCACAAACTGG - Intronic
1095932836 12:47646425-47646447 CATAACAAAGTACCACAGACTGG + Intergenic
1096158270 12:49354603-49354625 TTTCACCAAGTGCAAGAAACTGG + Intronic
1096212812 12:49779376-49779398 CATAACAAAGTACCACAGACTGG + Intergenic
1096415347 12:51407809-51407831 TATAACAAAGTACCACAAACTGG + Intronic
1097445838 12:59669973-59669995 CATAACAAAGTACCATAAACTGG + Intronic
1097833045 12:64245686-64245708 TATCACAAAATGCCACAGACTGG - Intergenic
1098156740 12:67607312-67607334 CATAACAGAGCGCCACAAACTGG + Intergenic
1098525493 12:71482257-71482279 CATAACAAAGTACCACAGACTGG + Intronic
1098608471 12:72423997-72424019 TATAATCAAGTACCACAAACTGG + Intronic
1098626919 12:72682886-72682908 CATTAAAAAGTGCCACAAACTGG - Intergenic
1098878105 12:75888005-75888027 AATAACAAAGTACCACAAACTGG - Intergenic
1099337263 12:81378239-81378261 CATAACAAATTGCCACCAACTGG - Intronic
1099791546 12:87341396-87341418 CATCACCAAATGACACAAGTGGG - Intergenic
1099964671 12:89433024-89433046 CAGGATCAAGTGCCACACACAGG + Intronic
1100026567 12:90135966-90135988 CATAACAAAGTACCGCAAACTGG + Intergenic
1100063465 12:90610354-90610376 CATGACAAAATACCACAAACTGG - Intergenic
1100541393 12:95560833-95560855 CATAACAAAGTCCCACAGACTGG - Intergenic
1100659944 12:96686066-96686088 CATAACAAAGTACCACAGACTGG + Intronic
1101071614 12:101081650-101081672 CATAACAAAGTACCACAGACTGG + Intronic
1101138640 12:101772088-101772110 AAACATCAAGTTCCACAAACAGG + Intronic
1101191313 12:102336398-102336420 CATAACAAATTACCACAAACTGG - Intergenic
1101326381 12:103719391-103719413 TATAACAAACTGCCACAAACTGG + Intronic
1101328101 12:103734694-103734716 CATCACAAATTACCACAAGCTGG + Intronic
1101530824 12:105571805-105571827 CAAAACCAAGTGCCAAAAAAAGG - Intergenic
1101615488 12:106332566-106332588 CATAACAAAGTACCACAGACTGG + Intronic
1101729768 12:107417272-107417294 CATAACAAAATACCACAAACTGG + Intronic
1101795868 12:107973128-107973150 AGTGACAAAGTGCCACAAACTGG + Intergenic
1101833212 12:108275340-108275362 CAAATCAAAGTGCCACAAACCGG + Intergenic
1101911974 12:108866834-108866856 TGTAACAAAGTGCCACAAACTGG - Intronic
1102014158 12:109636829-109636851 CATAACAAAGTACCACAAACTGG + Intergenic
1102188664 12:110969242-110969264 CATAACGAAGTACCACACACTGG - Intergenic
1102214883 12:111153801-111153823 CATGACCAAGTGCCACACCTGGG + Intronic
1102475792 12:113187321-113187343 TATCCCCAAATGTCACAAACTGG + Intronic
1102585995 12:113923421-113923443 CATAAGAAAGTGCCACAGACTGG - Intronic
1102722817 12:115032831-115032853 CGTAACAAATTGCCACAAACTGG - Intergenic
1102779986 12:115555974-115555996 CATAACAAAGTACCACAACCTGG + Intergenic
1103171470 12:118824177-118824199 TATAACAAAGTACCACAAACTGG - Intergenic
1103173952 12:118845413-118845435 CATAACAAAGTATCACAAACTGG - Intergenic
1103566602 12:121819317-121819339 CCTCACCAATGGCCTCAAACTGG - Intronic
1103732043 12:123034162-123034184 CATCAGTAAATACCACAAACTGG - Intronic
1103844328 12:123890990-123891012 CGTCACAAAATGCCACAAACTGG + Intronic
1103900603 12:124301861-124301883 CGTGACAAAGTGCCACAGACTGG + Intronic
1103937746 12:124485549-124485571 CGTCGCAACGTGCCACAAACTGG - Intronic
1104170166 12:126272982-126273004 TACAACAAAGTGCCACAAACTGG - Intergenic
1104426545 12:128682736-128682758 CATAACACAGTGCCACACACTGG + Intronic
1104515231 12:129419103-129419125 CATAACGAAGTCCCACAAACTGG - Intronic
1104528454 12:129546975-129546997 CATAACAAATTCCCACAAACTGG + Intronic
1104588919 12:130068861-130068883 CATAACAAAGTGCCACAGACTGG + Intergenic
1105146747 13:17199868-17199890 TATCACCATGGGCCTCAAACAGG - Intergenic
1105991625 13:25627691-25627713 CATAACAAAATGCCACAGACTGG - Intronic
1105996820 13:25680496-25680518 AACAACCAAGTACCACAAACTGG - Intronic
1106102299 13:26705605-26705627 CATCACAAAATACCACAGACTGG + Intergenic
1106366072 13:29082293-29082315 CATAACAAAATGCCACAGACTGG - Intronic
1106453527 13:29906769-29906791 CATGACAATGTACCACAAACTGG + Intergenic
1106470527 13:30050215-30050237 CATGACAAAGTACCACAAATTGG + Intergenic
1106627923 13:31440312-31440334 AATCACCAAGTGCCAAGAAGGGG - Intergenic
1106650632 13:31686435-31686457 CATCACAAAGTACCACAAACTGG + Intergenic
1106773946 13:32990552-32990574 CATAACAAAGTACCACAAACTGG + Intergenic
1106794034 13:33185957-33185979 CAGCACCAAGCACCACAAAGGGG + Intronic
1107040564 13:35943397-35943419 TATAACAAAGTACCACAAACTGG - Intronic
1107043783 13:35974894-35974916 CATAACAAAGTACCACATACTGG - Intronic
1107445187 13:40464276-40464298 CATGAAAAAGTGCCACAAGCTGG - Intergenic
1107696797 13:43008205-43008227 CATAGCCAAGTACTACAAACTGG + Intergenic
1107710122 13:43143077-43143099 CATAACAAAGTACCACAAACTGG - Intergenic
1107827113 13:44338574-44338596 CATCACAAAATGCCACAGACTGG - Intergenic
1109129565 13:58564788-58564810 TATAACCAAGTCCCACAGACTGG - Intergenic
1109560913 13:64049174-64049196 CATAACCAAATACCACAGACTGG + Intergenic
1110161867 13:72388050-72388072 TGTAACAAAGTGCCACAAACTGG - Intergenic
1110343921 13:74424300-74424322 CATAACAAAGTACCACAAAATGG + Intergenic
1110383307 13:74878927-74878949 CATAACAAAGTATCACAAACTGG + Intergenic
1110494638 13:76152815-76152837 CATAACAAAGTACCAAAAACTGG + Intergenic
1110550348 13:76805048-76805070 CACAACAAAGTGCCACAAACTGG + Intergenic
1110730506 13:78874833-78874855 CATGAGAAAGTGCCACAAACTGG - Intergenic
1111107009 13:83659341-83659363 CATAACAACGTACCACAAACTGG + Intergenic
1111207974 13:85036807-85036829 CATAACAAAGTACCACAGACTGG + Intergenic
1112121701 13:96419575-96419597 CATAACAAAGTACCACAAACTGG + Intronic
1112131880 13:96533723-96533745 CATCACCAGAGGCCCCAAACTGG + Intronic
1112204393 13:97309633-97309655 CATAACCAAGTACTACAAGCTGG - Intronic
1112284696 13:98093962-98093984 CGTAACCAACTGCCCCAAACGGG + Intergenic
1112300582 13:98226085-98226107 TATAACAAAGTACCACAAACTGG + Intronic
1112315737 13:98360630-98360652 CATAACGAAGTACCACAGACTGG - Intronic
1112567386 13:100563116-100563138 TACAACCAAGTGCCACAGACCGG - Intronic
1112584547 13:100706777-100706799 CATAACCAAGTACCACAGGCTGG + Intergenic
1112588867 13:100745502-100745524 CATAACAAAGTGCCACAAGCTGG - Intergenic
1112664411 13:101553528-101553550 TATAACAGAGTGCCACAAACGGG + Intronic
1112704373 13:102049987-102050009 CATAACAAAGTGTCCCAAACTGG - Intronic
1112715668 13:102182025-102182047 CATAACAAAGTACCACAAAATGG - Intronic
1112770847 13:102793144-102793166 CGTAACAAAGTGCTACAAACTGG - Intronic
1112964318 13:105168661-105168683 TATAACCAAGTACCACTAACTGG + Intergenic
1113238718 13:108312966-108312988 CATAACAAAGTGTCACAAACTGG - Intergenic
1113240007 13:108327162-108327184 CATGACAAAATACCACAAACTGG + Intergenic
1113469811 13:110536313-110536335 AGTCACCAAGTTCCACAAAGTGG - Intronic
1113615136 13:111675235-111675257 TGTAACAAAGTGCCACAAACAGG + Intergenic
1113620603 13:111760148-111760170 TGTAACAAAGTGCCACAAACAGG + Intergenic
1113756861 13:112818398-112818420 CATCACCAAGTGCACAAATCAGG - Intronic
1114402238 14:22420640-22420662 CTTAACAAAGTACCACAAACTGG - Intergenic
1115448994 14:33524627-33524649 CATGACAAAGTATCACAAACTGG + Intronic
1115706784 14:36007457-36007479 CATAACGAAGTACCACAAATTGG + Intergenic
1116489309 14:45487468-45487490 CATAATAAAGTACCACAAACTGG - Intergenic
1116590901 14:46771056-46771078 CATAACAAAGTACCACAAACTGG - Intergenic
1116806445 14:49498712-49498734 CATCACGAAGTACCAGAGACTGG + Intergenic
1116975887 14:51115577-51115599 CATAACAAAGTACCAAAAACTGG + Intergenic
1116977286 14:51130472-51130494 CATCTCCAAGTGCCAGAAAATGG - Intergenic
1116987017 14:51231334-51231356 CATAACAAAGTACCAAAAACTGG + Intergenic
1116997592 14:51339977-51339999 CATAACCAAGTACCACAAACTGG + Intergenic
1117161865 14:52997565-52997587 CATCCCCAAGTGACTGAAACTGG + Intergenic
1117437659 14:55732377-55732399 CATAACAAAGTACCACAGACTGG + Intergenic
1117490662 14:56243439-56243461 GATCACAAAGTGCCAGGAACTGG - Intronic
1117673240 14:58129120-58129142 CATAACTAAGTACCACAAACTGG - Intronic
1118008229 14:61584459-61584481 CATGACTAAGTGCCACAGACTGG - Intronic
1118305186 14:64649649-64649671 AATAACAAAGTACCACAAACTGG - Intergenic
1118507033 14:66424802-66424824 CGTAACTAAGTACCACAAACTGG + Intergenic
1119863580 14:77954883-77954905 TATCACAAAGTACCACAGACTGG + Intergenic
1120092075 14:80343634-80343656 TGTAACAAAGTGCCACAAACTGG + Intronic
1120095846 14:80386713-80386735 CATAACAAAGTACCACAGACTGG - Intronic
1120192576 14:81452579-81452601 TATAACAAAGTACCACAAACTGG - Intergenic
1120486978 14:85126270-85126292 CATAACAATGTGCCACAAACTGG - Intergenic
1120558090 14:85955383-85955405 CATAACAAAATGCCACAGACTGG + Intergenic
1120695270 14:87637840-87637862 TATCATAAAGTTCCACAAACTGG + Intergenic
1120703248 14:87721923-87721945 CATAACAAAGTACCACAGACTGG + Intergenic
1120739753 14:88095063-88095085 CATAACAAAGTTCCACAAACTGG + Intergenic
1120865637 14:89293330-89293352 CATAACCAAGTGCCACAGACTGG + Intronic
1120877994 14:89392384-89392406 TGTAACCAAGTGCCACAAGCCGG + Intronic
1121121239 14:91377002-91377024 CCTAACCAACTGCCACAAAGTGG + Intronic
1121249269 14:92487709-92487731 CATAACAAAGTGCCACAATGGGG + Intronic
1121249627 14:92489867-92489889 CTTCACCAGGTGCAACTAACTGG + Intronic
1121255383 14:92526797-92526819 CATAACAAAGTGCCACAAACTGG + Intronic
1121321682 14:92995194-92995216 CACAACCAAGTATCACAAACAGG - Intronic
1121327696 14:93031103-93031125 TGTCACAAAGGGCCACAAACTGG - Intronic
1121454437 14:94029301-94029323 CATAACAAAGTACCACAAACTGG + Intronic
1121490258 14:94353571-94353593 CATAACTGAGTACCACAAACTGG + Intergenic
1121551674 14:94807501-94807523 CCTCAGCAAGTTACACAAACTGG - Intergenic
1121567662 14:94922907-94922929 CATAACAAAGCACCACAAACTGG + Intergenic
1121754799 14:96393377-96393399 GGTAACCAATTGCCACAAACTGG + Intronic
1122052788 14:99071399-99071421 CATGACCTAGTACCATAAACTGG - Intergenic
1122730567 14:103794165-103794187 CGTAACAAAGTGCCACAGACTGG - Intronic
1202937090 14_KI270725v1_random:99629-99651 CATAACCAACTAACACAAACTGG + Intergenic
1202937099 14_KI270725v1_random:99760-99782 CATAACCAACTAACACAAACTGG + Intergenic
1123396104 15:19938114-19938136 CATAACCAAGTAACACAAACTGG - Intergenic
1124126399 15:26941599-26941621 CGTAACCAAGTCCCACACACTGG + Intronic
1124805262 15:32875409-32875431 AATCACCAAGTGCCACCACTGGG + Intronic
1125283126 15:38064359-38064381 CATAACAAAGTACCACAGACTGG - Intergenic
1126303473 15:47226339-47226361 CATAACAAAGTACCACAAACTGG - Intronic
1126633462 15:50760083-50760105 CATAACAAAGTACCACAAACTGG + Intronic
1127068946 15:55269181-55269203 CATAACAAAGTACCATAAACTGG - Intronic
1127308543 15:57730918-57730940 CATAACAAATTACCACAAACTGG - Intronic
1127564797 15:60176710-60176732 CATGACAAAGTGCCACAAATTGG + Intergenic
1127616356 15:60690031-60690053 GGTAACAAAGTGCCACAAACTGG - Intronic
1127978379 15:64015952-64015974 CATAACAAATGGCCACAAACTGG - Intronic
1128121927 15:65155736-65155758 AAGCACCAGATGCCACAAACAGG + Exonic
1129176390 15:73842570-73842592 CATAACAAAGTACCACACACTGG - Intergenic
1129181971 15:73883313-73883335 CCTTAGCAAGTACCACAAACTGG + Intronic
1129412694 15:75358756-75358778 CATCATCAAATAGCACAAACTGG + Exonic
1129522468 15:76194518-76194540 CATAACAAAATGCCACAGACTGG + Intronic
1129555783 15:76507395-76507417 CATAAGAAAGTGCCACAGACTGG - Intronic
1129944466 15:79526986-79527008 CATAACAAAGTGCCCCAATCTGG + Intergenic
1130310515 15:82749914-82749936 CATAACCAAGTACCTCACACTGG - Intergenic
1130873815 15:87994631-87994653 TGTAACAAAGTGCCACAAACTGG - Intronic
1130904058 15:88227668-88227690 CATAACGAAGTCCCACAGACTGG - Intronic
1131036586 15:89226488-89226510 CATCACAAAGTACCATAGACCGG - Intergenic
1131080677 15:89532037-89532059 CATCACAAAATACCACAGACTGG - Intergenic
1131103552 15:89713848-89713870 CATAACAAAGTACCACAAACTGG + Intronic
1131958758 15:97765974-97765996 CGTTACAAAGTACCACAAACTGG - Intergenic
1131968918 15:97873297-97873319 CATAACAAAATACCACAAACTGG + Intergenic
1131981576 15:97999674-97999696 CATCACAAAGTACCACAGAATGG - Intergenic
1132180403 15:99748604-99748626 CATAACAAAGTACCATAAACTGG - Intergenic
1132456776 16:28481-28503 CGTAACAAAGTGCCACAAAATGG - Intergenic
1132661152 16:1062118-1062140 CATAACAAAGAGCCACGAACTGG - Intergenic
1133434797 16:5769861-5769883 CATGACAAAGTACCACAAATTGG - Intergenic
1133614441 16:7463012-7463034 CATAACTAAATGCCAAAAACTGG + Intronic
1133828878 16:9303430-9303452 CATAACAAAGTACCACAAACTGG - Intergenic
1134053026 16:11150692-11150714 CATAACAAAGTCCCACAAACTGG + Intronic
1134350086 16:13429245-13429267 CATAACAAAATACCACAAACTGG + Intergenic
1134782465 16:16910787-16910809 CATTACAAAGTCCCACAAACTGG + Intergenic
1135292574 16:21252444-21252466 CATAACAAAATGCCACAGACTGG - Exonic
1135327028 16:21533046-21533068 CTTCACCAAGTGCAGAAAACAGG + Intergenic
1135631311 16:24037818-24037840 CATAACAAAATACCACAAACTGG + Intronic
1135872299 16:26162160-26162182 CATAACAAAATGCCACAGACTGG + Intergenic
1135974075 16:27095791-27095813 CATAACCAAGTACCACAGGCCGG + Intergenic
1136054608 16:27679142-27679164 CATGACAAAGTACCACAGACTGG + Intronic
1136337345 16:29618886-29618908 CTTCACCAAGTGCAGAAAACAGG + Intergenic
1136698574 16:32110269-32110291 CATAACCAAGTAACACAAACTGG - Intergenic
1136769030 16:32817565-32817587 CATAACCAAGTAACACAAACTGG + Intergenic
1136799077 16:33053563-33053585 CATAACCAAGTAACACAAACTGG - Intergenic
1136901566 16:34044761-34044783 CATAACCAAGTAACACAAACTGG - Intergenic
1136923898 16:34353368-34353390 CATCACCCAGTTCCACAATGTGG + Intergenic
1136956766 16:34796516-34796538 CATAACCAAGTAACACAAACTGG - Intergenic
1136980676 16:35058438-35058460 CATCACCCAGTTCCACAATGTGG - Intergenic
1137364024 16:47845160-47845182 CATAACCAAATATCACAAACTGG + Intergenic
1137406606 16:48194002-48194024 GATGTACAAGTGCCACAAACAGG + Intronic
1137470279 16:48748579-48748601 AATCACCAGGTGCCAGAAAAAGG + Intergenic
1137869372 16:51934634-51934656 CATAACAAAGTACCACAGACTGG - Intergenic
1137873873 16:51976741-51976763 CATAATGAAGTACCACAAACTGG + Intergenic
1138011128 16:53381274-53381296 CATAATTAAGTACCACAAACCGG + Intergenic
1138307488 16:55990508-55990530 CATAACAAAGTACCACAAACTGG + Intergenic
1138425712 16:56931055-56931077 CATAACAAAGTGCCACAAACTGG - Intergenic
1138475445 16:57268219-57268241 CGTAACAAAGTTCCACAAACTGG - Intronic
1140144345 16:72291114-72291136 CATAACAAATTACCACAAACTGG + Intergenic
1140460891 16:75138877-75138899 CATCACAAAGGACCACATACTGG - Intergenic
1140662848 16:77204497-77204519 CATAACAAAGTACCACAAACTGG - Intronic
1140699601 16:77569096-77569118 CCTTACTAAGTTCCACAAACAGG + Intergenic
1140756870 16:78075580-78075602 CCTCACAAAGTGTCACAAATTGG - Intergenic
1140810949 16:78577282-78577304 CACCACCAAATACAACAAACTGG - Intronic
1140995670 16:80257115-80257137 CATAACAAAATGTCACAAACTGG - Intergenic
1141314605 16:82950058-82950080 TATAACAAAGTGCCACAAACTGG + Intronic
1141398837 16:83728815-83728837 CATAACCAAATACCACAGACTGG + Intronic
1141616488 16:85212666-85212688 CATAACGAAGTGCCACAGGCTGG - Intergenic
1141650688 16:85391368-85391390 CGTAACAAAGTACCACAAACTGG + Intergenic
1142040147 16:87888230-87888252 CTTCACCAAGTGCAGAAAACAGG + Exonic
1142112203 16:88338948-88338970 CAGAACAAAGTGCCATAAACTGG - Intergenic
1203071445 16_KI270728v1_random:1079672-1079694 CATAACCAAGTAACACAAACTGG + Intergenic
1144174833 17:12695131-12695153 CATAACCAAATGCCATAAACTGG + Intronic
1144199273 17:12924878-12924900 CATAACAAAGTACCACAGACTGG - Intronic
1144263128 17:13542586-13542608 CATAACAAAGTGCCACAGGCTGG - Intronic
1144281390 17:13730549-13730571 AATAACCAATTCCCACAAACTGG - Intergenic
1144282886 17:13744608-13744630 CATAACCAAGTACCACAGACTGG + Intergenic
1144441493 17:15286724-15286746 CATAACGAAGTACCACAAATTGG + Intergenic
1144649293 17:16997440-16997462 CATCACACAGTGTCACAAATGGG - Intergenic
1145692729 17:26760523-26760545 CATAACCAAGTAACACAAACTGG - Intergenic
1145709468 17:26957166-26957188 CATAACCAAGTAACACAAACTGG - Intergenic
1147553039 17:41458369-41458391 TATCACCAAGTAACACAGACAGG - Intergenic
1147651837 17:42067310-42067332 CATAACAAAGTGCCACAGGCTGG - Intergenic
1148149245 17:45386525-45386547 CATCACCTAGTGGCACCCACTGG + Intergenic
1148749418 17:49935902-49935924 GAGCACCAAGTGCCAGAAGCAGG - Intergenic
1148987476 17:51635733-51635755 TATAACAAAGTCCCACAAACTGG - Intronic
1149009878 17:51845206-51845228 CATAGCAAAGTGACACAAACTGG - Intronic
1149450544 17:56746645-56746667 CATAACAAAGTACCACAGACTGG - Intergenic
1149540045 17:57461948-57461970 CATAACAAAGTACCACAAACTGG + Intronic
1149881487 17:60296603-60296625 CATAACAAAGCACCACAAACTGG - Intronic
1150457570 17:65319812-65319834 TATGACCAAGTGCCATAGACTGG + Intergenic
1150582054 17:66483189-66483211 CATAACAAATTACCACAAACCGG + Intronic
1150710830 17:67529617-67529639 TGTAACAAAGTGCCACAAACTGG + Intronic
1150751056 17:67863058-67863080 CATAACAAAGTACCACAAATGGG + Intronic
1150897534 17:69231049-69231071 CATAACAAAGTACCACAAACTGG + Intronic
1151153435 17:72107611-72107633 TATGACCAAGTGTCAGAAACAGG + Intergenic
1151331687 17:73413550-73413572 TATAACCAAGTACCACAGACTGG - Intronic
1151382231 17:73733863-73733885 CATTGCAAAGTACCACAAACTGG + Intergenic
1151946778 17:77323900-77323922 CATCACCAAGTGCCACAAACTGG + Intronic
1152035864 17:77872400-77872422 CATCACGAAGAACCACAGACTGG + Intergenic
1152143194 17:78550706-78550728 CATCACAAACTGCCACAGTCTGG - Intronic
1152297379 17:79475957-79475979 CATCACAGAATGCCACAGACTGG - Intronic
1152934331 17:83127447-83127469 CAGGACCAAGGGCCACACACAGG - Intergenic
1152960667 18:78720-78742 CGTAACAAAGTGCCACAAAATGG - Intergenic
1153485201 18:5591255-5591277 TATGACAAAATGCCACAAACTGG + Intronic
1153501488 18:5754631-5754653 CATAACAAAGTACCCCAAACTGG + Intergenic
1154518794 18:15203591-15203613 CATAACAAAGTAACACAAACTGG + Intergenic
1155094188 18:22540334-22540356 CATAACAAAGTACCACAGACTGG + Intergenic
1155267209 18:24105775-24105797 CATAACAAAGTATCACAAACTGG + Intronic
1155623895 18:27812764-27812786 CATAACAAAATGCCACAGACTGG - Intergenic
1155630008 18:27882227-27882249 CATAACAAAATACCACAAACTGG + Intergenic
1155842040 18:30658448-30658470 CAGCAACAAGTGCAACAGACTGG + Intergenic
1156221305 18:35055142-35055164 CATAACAAATTACCACAAACCGG + Intronic
1156455800 18:37293177-37293199 CATACCAAAATGCCACAAACTGG + Intronic
1156542276 18:37925977-37925999 CATGACAAATTGCCACAAACTGG - Intergenic
1157174876 18:45442264-45442286 CATCACAAAGTGCCGCAAACTGG + Intronic
1157549080 18:48568477-48568499 CATGACAAAATCCCACAAACTGG + Intronic
1157622619 18:49025115-49025137 CACGACAAAGTGCCACAAACAGG - Intergenic
1157905097 18:51562729-51562751 CATAATAAAGTGCTACAAACTGG - Intergenic
1158033806 18:53000161-53000183 CATTGCAAAGTACCACAAACTGG - Intronic
1158077976 18:53553325-53553347 CATAACAAAGTACCACAATCTGG - Intergenic
1158125812 18:54098840-54098862 CATAACAAAGTGCTACAAACTGG - Intergenic
1158382069 18:56942353-56942375 GATCCCCAACTGGCACAAACTGG - Intronic
1158629041 18:59096134-59096156 TGTAACCAAGTGCCACAAACTGG - Intergenic
1158681868 18:59575235-59575257 CATTAAAAAGTGCCACCAACTGG - Intronic
1158737075 18:60094648-60094670 CATAACCAAATACCACAATCTGG + Intergenic
1158827114 18:61235142-61235164 CGTAACAAAGTACCACAAACTGG + Intergenic
1158839376 18:61367709-61367731 CCTAACAAAGTACCACAAACTGG + Intronic
1159118049 18:64137366-64137388 CCTAACAAAGTGCCACAAACTGG - Intergenic
1159202973 18:65211544-65211566 TATAACAAAGTGCCATAAACTGG - Intergenic
1159325434 18:66909933-66909955 CATAACAAAATGCCACAAGCTGG + Intergenic
1159456805 18:68669541-68669563 CATAACAAAGTGCCACAAACTGG + Intergenic
1159776349 18:72607272-72607294 CTTAACAAAGTACCACAAACTGG - Intronic
1160100264 18:75914355-75914377 CATAACAAAGTACCACAAACCGG + Intergenic
1160328038 18:77968454-77968476 CATAACAAGGTGCCACAATCTGG - Intergenic
1160366106 18:78327325-78327347 CATCACAAAGTGCCTCAATTAGG - Intergenic
1161228596 19:3160647-3160669 CGTAACAAAGTACCACAAACTGG + Intronic
1161763430 19:6191387-6191409 CATTACAAAGTACCACAGACTGG + Intronic
1162538646 19:11279709-11279731 CATGACCAAGCACCACAGACAGG - Intergenic
1163287929 19:16360424-16360446 GGTCACCAAGAGCCAGAAACAGG + Intronic
1163372747 19:16911028-16911050 CATAACAAATTGCCACAAACTGG - Intronic
1163374925 19:16924205-16924227 CACAACAAAATGCCACAAACCGG - Intronic
1164608713 19:29617998-29618020 CATAACAAAATGCCACACACTGG + Intergenic
1165704659 19:37966981-37967003 CATCACAAAGTACCACACCCCGG + Intronic
1166036407 19:40171271-40171293 CATAGCAAAGTGCCACAGACTGG + Intergenic
1166476738 19:43133163-43133185 CATAACAAAGTGCCACAGACCGG + Intronic
1166883368 19:45942483-45942505 CATAACAAAGTGCCAGAGACTGG - Intronic
1168233825 19:55049463-55049485 CGTAACAAAGTGCCACAGACAGG + Intronic
925119267 2:1404721-1404743 CATAACAAAGTACCACAGACTGG - Intronic
925644725 2:6024067-6024089 CATAACAAAATACCACAAACTGG - Intergenic
925870891 2:8269472-8269494 CATAACCAAGTACCATAAACTGG - Intergenic
925901508 2:8512491-8512513 CATCACAAAATACCACAGACTGG + Intergenic
926410715 2:12599373-12599395 CATAACCAAATACCACAGACTGG - Intergenic
926613015 2:14966233-14966255 CGTTACAAAGTACCACAAACTGG - Intergenic
926628327 2:15114188-15114210 CATCACCAAGTACCACAGGCTGG + Intergenic
926778260 2:16443580-16443602 CATAACAAAGTACCACAGACTGG + Intergenic
926857072 2:17268641-17268663 CATAACAAAGTACCACAAAATGG + Intergenic
926931828 2:18048718-18048740 CATAACCAAGAACCACAGACTGG + Intronic
927090398 2:19706378-19706400 CATAACAAAGTACCACAGACTGG - Intergenic
927512290 2:23651670-23651692 CATCACAAAATGCCACAAATTGG + Intronic
927654355 2:24932898-24932920 CATAACAAATTACCACAAACTGG + Intergenic
928183650 2:29090109-29090131 CATAACAAAGTACTACAAACTGG + Intergenic
928220261 2:29397483-29397505 CATAACAAAGTACCAGAAACTGG - Intronic
928650673 2:33400508-33400530 CATAACAAAGTACCAAAAACTGG - Intergenic
929213626 2:39386341-39386363 CATAACAAAATGCCACAGACTGG - Intronic
929397039 2:41534845-41534867 CATAACAAAGTACCAGAAACTGG - Intergenic
929796827 2:45066023-45066045 CATAACAAATTACCACAAACCGG - Intergenic
929833833 2:45375699-45375721 CATAATGAAGTTCCACAAACTGG + Intergenic
929862548 2:45692198-45692220 CATAACAAAGCACCACAAACTGG + Intronic
929912847 2:46106464-46106486 CATAACAAAATACCACAAACTGG + Intronic
930037421 2:47095554-47095576 CATAACAAAGTACCACAGACTGG - Intronic
930149444 2:48043701-48043723 CACAACAAAGTACCACAAACTGG + Intergenic
930161076 2:48156406-48156428 GGTCCCCAAGTGGCACAAACAGG - Intergenic
930551098 2:52835853-52835875 CATAACAAATTACCACAAACTGG + Intergenic
930598518 2:53416525-53416547 CATAACAAAATACCACAAACTGG - Intergenic
930985277 2:57578608-57578630 CATAACAAAGTACCACAGACTGG - Intergenic
931046656 2:58361791-58361813 TATAACAAAGTGCCATAAACAGG + Intergenic
931261155 2:60620473-60620495 CTTAACAAAGTACCACAAACTGG - Intergenic
931447099 2:62335901-62335923 CATCACAAAATACCACAGACTGG - Intergenic
931485336 2:62684857-62684879 CATAACAAAGTACCAAAAACTGG + Intronic
931747934 2:65307120-65307142 CATAACAAAATACCACAAACTGG - Intergenic
932047405 2:68363691-68363713 CATAACAAAGTACCACAAACTGG + Intergenic
932134504 2:69216609-69216631 CATCACCATGTCCCAGAGACTGG + Intronic
932628246 2:73316169-73316191 CATAACAAACTGTCACAAACTGG + Intergenic
932963990 2:76448983-76449005 CATAACAAAATGCCACCAACTGG + Intergenic
933261198 2:80133365-80133387 CGTAACAAAGTGCCACAAACTGG - Intronic
933481759 2:82867060-82867082 TATAACAAAGTGCCACAAACTGG + Intergenic
933568799 2:83982553-83982575 CATAACAAAGTACCACAGACTGG - Intergenic
933871218 2:86567333-86567355 CATAACAAAATGCCACAAACTGG + Intronic
934303828 2:91803691-91803713 CATAACCAAGTAACACAAACTGG - Intergenic
934329426 2:92049060-92049082 CATAACCAAGTAACACAAACTGG + Intergenic
934467648 2:94278977-94278999 CATAACCAAGTAACACAAACTGG + Intergenic
934489904 2:94755394-94755416 CATCACCAACTGCCGCTCACAGG + Intergenic
934578552 2:95419189-95419211 CATAACTAAGTCCCACAAATTGG - Intergenic
935040091 2:99417719-99417741 CATAACAAAGTACCACAGACTGG - Intronic
935325468 2:101931971-101931993 CCACAACAAGTACCACAAACTGG - Intergenic
935405402 2:102703943-102703965 CACCACCAAGTGGCTCAAAGTGG + Intronic
935489515 2:103698959-103698981 CAGCTCCCAGTGACACAAACGGG - Intergenic
935655573 2:105420086-105420108 CATCACAAAGTACCACACACTGG + Intronic
936410075 2:112249765-112249787 CATAACAAAGTACCACAGACTGG - Intronic
936534267 2:113299671-113299693 CATAACAAAGTCCCACAAATTGG + Intergenic
936980836 2:118263775-118263797 TGTAACAAAGTGCCACAAACTGG - Intergenic
937015018 2:118597156-118597178 CATAAAAAAGTGCCACAAACTGG + Intergenic
937079976 2:119133889-119133911 CATAACAAAATGCCACAGACTGG + Intergenic
937413273 2:121694969-121694991 GATCACCAAGGGCCAGAAAAAGG + Intergenic
937457748 2:122057709-122057731 CATAACAAAGTACCACAGACTGG + Intergenic
937555369 2:123147997-123148019 CATAACAAAATGTCACAAACTGG - Intergenic
937645038 2:124257210-124257232 CATAACAAATTACCACAAACTGG - Intronic
937683714 2:124672018-124672040 CATCACAGGGTTCCACAAACTGG + Intronic
937823000 2:126333380-126333402 CATGACGAAGTACCACAAACTGG + Intergenic
938054912 2:128207786-128207808 CATAACAAAATGCCACAGACTGG + Intergenic
938518795 2:132044092-132044114 CATAACCAAGTAACACAAACTGG + Intergenic
939104083 2:137928812-137928834 CATAACAAAGTACCACAAACTGG - Intergenic
939194528 2:138955741-138955763 CATAACAAAATGCCACAAACTGG + Intergenic
939332486 2:140782569-140782591 CATAACAAAGTCCCACAGACTGG - Intronic
939394814 2:141614838-141614860 CATTACAAAGTACCACAAACTGG - Intronic
940275237 2:151933089-151933111 CATAACAAAGTACCACCAACTGG - Intronic
940988438 2:160073376-160073398 CATAACAAAGTACCACAAACTGG + Intergenic
941043069 2:160644986-160645008 CATTACAAAGTACCACAAACTGG - Intergenic
941165651 2:162080206-162080228 TATAACAAAGTACCACAAACTGG - Intergenic
941489161 2:166122108-166122130 CATGACAAAGTACCACAGACAGG - Intronic
942008717 2:171736976-171736998 CATAACAAATTACCACAAACTGG + Intronic
942119726 2:172764939-172764961 CAAAACAAAGTACCACAAACTGG + Intronic
942188277 2:173445482-173445504 CATAACAAAGTGCCACAAACTGG + Intergenic
942189267 2:173454917-173454939 CATAACAAAGTACCACAAACTGG + Intergenic
942233602 2:173882864-173882886 CATCACCATGCCCCACAAAGCGG + Intergenic
942270456 2:174269056-174269078 AATAACAAAGTGCCACAGACTGG - Intergenic
942877302 2:180816101-180816123 CATAACTAAGTACCACAAACTGG + Intergenic
942893451 2:181020116-181020138 CATAACCAAGTACCACAAATTGG + Intronic
942925097 2:181422104-181422126 CCTAACAAAATGCCACAAACTGG - Intergenic
943102456 2:183505031-183505053 CACCATCAAGTGCCAAAAAGGGG - Intergenic
943162223 2:184269154-184269176 CATAACAAAATACCACAAACTGG + Intergenic
943533971 2:189123560-189123582 GATAACAAAGTACCACAAACTGG - Intronic
944036729 2:195303325-195303347 CATAACAAAGTATCACAAACCGG + Intergenic
944935491 2:204562986-204563008 CATGACAATGTACCACAAACTGG + Intronic
945027954 2:205637227-205637249 TATCACAAAATGCCACAGACTGG - Intergenic
945510671 2:210698497-210698519 TATAACAAAATGCCACAAACTGG - Intergenic
945607765 2:211957456-211957478 CATAACAAAGTACCACAGACTGG - Intronic
945775212 2:214098633-214098655 CATAACAAAGTGGCACAGACTGG - Intronic
945907324 2:215609790-215609812 CATAACAAAGTACCACAAACTGG + Intergenic
946701482 2:222418711-222418733 TATGACAAAGTACCACAAACTGG + Intergenic
946770674 2:223085497-223085519 CATAACAAAATACCACAAACAGG + Intronic
946932264 2:224681990-224682012 TATAACAAAGTGCCATAAACTGG - Intergenic
946986495 2:225279744-225279766 AATCAGCAAGCACCACAAACTGG - Intergenic
947109746 2:226706215-226706237 CAGGGCAAAGTGCCACAAACTGG - Intergenic
947455249 2:230248329-230248351 CATCACCCAGTGACACATCCAGG - Intronic
947455785 2:230252778-230252800 CATCACCCAGTGACACATCCAGG - Intronic
947677648 2:231998138-231998160 TATAACAGAGTGCCACAAACTGG + Intronic
947955328 2:234184928-234184950 CATAACTAAGCACCACAAACTGG - Intergenic
948259310 2:236591096-236591118 CGTGACCAATTGCCACAAACTGG + Intergenic
948286536 2:236790245-236790267 CATAACAAAGTACCACAAACTGG - Intergenic
948382078 2:237557804-237557826 CATAACAAAGCCCCACAAACTGG + Intergenic
948398045 2:237661976-237661998 CATAACAAAGTGCCACAAACTGG + Intronic
948513037 2:238484785-238484807 CATGACCAAGTGCCCCAGCCTGG - Intergenic
948711064 2:239825857-239825879 CATAACCAAGTCCCACCCACTGG - Intergenic
948714901 2:239854673-239854695 CATAACAAAGTTCCATAAACTGG + Intergenic
1168940521 20:1707470-1707492 CATAACAAAGTACCACAGACTGG - Intergenic
1169330072 20:4709381-4709403 CATAACCAAGTACCACAGATTGG + Intergenic
1169395504 20:5225350-5225372 CATAACAAAGTACCACAAATTGG - Intergenic
1169425360 20:5492703-5492725 CATCCACAAGTGTCACAAACCGG + Intergenic
1169681637 20:8220761-8220783 CATAACAAACTGTCACAAACTGG - Intronic
1169810292 20:9603083-9603105 CATCACAAAGTGCAGCAAGCTGG + Intronic
1169818688 20:9685652-9685674 TATAACAAAGTACCACAAACTGG - Intronic
1170073404 20:12392980-12393002 CATAACCAAGTACCACAAACAGG - Intergenic
1170388947 20:15851316-15851338 CATCATAAAGTACCACAGACTGG + Intronic
1170462157 20:16587629-16587651 CATAACAAAGTACCACAGACTGG - Intergenic
1170861108 20:20104693-20104715 CATAACAAAGTGCCACAGACTGG + Intronic
1170974928 20:21153613-21153635 CATAACAAAATACCACAAACTGG + Intronic
1171014580 20:21528703-21528725 CAGTAACAAGTACCACAAACTGG + Intergenic
1171183803 20:23110650-23110672 CAAAACAAAGTACCACAAACTGG + Intergenic
1172306817 20:33886483-33886505 CATAACAAAGTACCACAGACTGG - Intergenic
1173076977 20:39828578-39828600 CATAGCTAAGTGTCACAAACTGG - Intergenic
1173292148 20:41724506-41724528 CATAACAAAGTACCACATACTGG + Intergenic
1173422310 20:42913196-42913218 TATAACAAAGTGCCACAGACTGG + Intronic
1173467508 20:43295116-43295138 CATAACGAAGTACCACAAACTGG - Intergenic
1173572238 20:44084966-44084988 CATAACAAGGTACCACAAACTGG - Intergenic
1173680942 20:44881336-44881358 CATAACAAAGGGCCACAAACTGG + Intergenic
1173972273 20:47161911-47161933 CATTACAAAGTCCCACAGACTGG + Intronic
1174164231 20:48573464-48573486 CATCACCAACTGCCTCATCCTGG + Intergenic
1174164236 20:48573503-48573525 CATCACCAACTGCCTCATCCTGG + Intergenic
1174821970 20:53734141-53734163 CATAGCCAAGTACAACAAACTGG - Intergenic
1175324975 20:58118010-58118032 CATGACAAAATACCACAAACTGG + Intergenic
1175363511 20:58433733-58433755 TATCTCCATGTGCCAGAAACTGG - Intronic
1175456163 20:59116067-59116089 CATAACAAAGTTCCACAAACTGG - Intergenic
1175560636 20:59926248-59926270 CTTAACAAAGTGCCACAAACTGG + Intronic
1175630783 20:60534730-60534752 CATAACAAACCGCCACAAACTGG - Intergenic
1175780350 20:61678575-61678597 CAGTAACAAGTGCCACCAACTGG + Intronic
1175851210 20:62094183-62094205 CATAACAAAGTGCCATAGACTGG - Intergenic
1175870013 20:62204711-62204733 TATGACAAAGTGCCACAAACCGG + Intergenic
1176361161 21:5997825-5997847 CATAACAAAATACCACAAACTGG - Intergenic
1176586222 21:8589347-8589369 CATAACCAACTAACACAAACTGG - Intergenic
1176742925 21:10622067-10622089 CATAACCAACTAACACAAACTGG - Intergenic
1176840949 21:13843197-13843219 CAGCACCAACTGCCACTCACAGG + Intergenic
1177107458 21:16977972-16977994 CATAACAAAGTACCACAAGCAGG + Intergenic
1177221613 21:18201053-18201075 CATAACATATTGCCACAAACTGG - Intronic
1177924432 21:27196473-27196495 CATAACAAAGAACCACAAACAGG + Intergenic
1178238757 21:30874942-30874964 CATAACAAAGTGCTACAAACTGG - Intergenic
1178256370 21:31056128-31056150 CATTACAAAATGCCACAGACTGG + Intergenic
1178308638 21:31511195-31511217 CCTAACAAAGTGCCACCAACAGG - Intronic
1178343590 21:31806376-31806398 CAACAACAAGTACCACAGACTGG + Intergenic
1178354485 21:31899197-31899219 CATAACAAAGTACCATAAACTGG + Intronic
1178506502 21:33167227-33167249 CATAACAAAGTACCCCAAACTGG - Intronic
1178712022 21:34925687-34925709 CATAACAAAGTACCACAAACTGG - Intronic
1178731771 21:35110292-35110314 CATAACAAAGTACCACAAACTGG + Intronic
1178734657 21:35137970-35137992 CATAACAAAGTACCACAAATTGG + Intronic
1178898323 21:36578951-36578973 CATAACAAAGTACCACCAACTGG + Intergenic
1178981919 21:37271585-37271607 CACAACGAAGTACCACAAACTGG + Intergenic
1179026633 21:37684090-37684112 CATAACGAAGTATCACAAACAGG + Intronic
1179119259 21:38527915-38527937 CATAACAAAGTGCCACACCCTGG + Intronic
1179173007 21:38987536-38987558 CATAACAAAGCACCACAAACGGG + Intergenic
1179442518 21:41405324-41405346 TATCACAAAGTCCCACAGACTGG + Intronic
1179762357 21:43540725-43540747 CATAACAAAATACCACAAACTGG + Intronic
1180114793 21:45695205-45695227 CAGCACCAATTTCAACAAACGGG - Intronic
1180269028 22:10566251-10566273 CATAACCAACTAACACAAACTGG - Intergenic
1180280854 22:10693478-10693500 CATAACCAAGTAACATAAACTGG - Intergenic
1180748361 22:18107895-18107917 CATCACTAAATACCACAGACTGG + Intronic
1180920169 22:19517546-19517568 CATAACAAAGTGCCACAGACAGG + Intronic
1180935194 22:19620803-19620825 CATCACAAAGTGCCACTGGCTGG - Intergenic
1181146562 22:20852483-20852505 CATAACAAAGTACCACAGACTGG - Intronic
1181168456 22:20995410-20995432 CATCACCAAGAGCCAGCAACCGG - Intronic
1181822843 22:25488996-25489018 CAGCACCAAATGCCAGACACTGG + Intergenic
1182425517 22:30269669-30269691 CATAACAAAGTACCACAGACTGG + Intergenic
1182619013 22:31608153-31608175 CATGACAAAGTACCACAGACTGG + Intronic
1182822869 22:33233728-33233750 CATAACAAAGTACCACAGACTGG + Intronic
1182914571 22:34017418-34017440 CATTACCCAGTGTCAGAAACAGG + Intergenic
1183017969 22:35005600-35005622 CATGACAAAGTACCACAGACTGG - Intergenic
1184738370 22:46412296-46412318 CATCACAAAGTACCACGGACAGG - Intronic
1184872757 22:47251457-47251479 CATAACAAAATGTCACAAACTGG + Intergenic
1185125607 22:49009090-49009112 CACGACCAAGTACAACAAACTGG + Intergenic
1203237952 22_KI270732v1_random:24979-25001 CATAACCAAGTAACACAAACTGG - Intergenic
1203289705 22_KI270735v1_random:23384-23406 CATAACCAAGTAACACAAACTGG + Intergenic
949091574 3:35245-35267 CATAACAAAATGCCACAGACTGG - Intergenic
949388687 3:3535460-3535482 CATTAGAAAGTACCACAAACTGG + Intergenic
949398206 3:3637593-3637615 CACTACCAAGTACCACAGACTGG + Intergenic
949426571 3:3923536-3923558 CAAAACAAAGTACCACAAACTGG - Intronic
950141146 3:10616467-10616489 CATAACAAAGTGCCACAGACTGG - Intronic
950844436 3:16000809-16000831 CATAACAAAGTACCACAAACTGG + Intergenic
950861989 3:16156344-16156366 TATCACTGAATGCCACAAACTGG + Intergenic
951066702 3:18275323-18275345 CATAACAAAGTACCACAAATTGG - Intronic
951536998 3:23749550-23749572 CATAACAAAGTACCACAGACTGG + Intergenic
951661335 3:25069929-25069951 CATGACGAAGTGCCACAAGCTGG + Intergenic
951911867 3:27758852-27758874 TATAACAAAGTACCACAAACTGG - Intergenic
951941599 3:28085448-28085470 CATTACCAATTTCCACAAAATGG - Intergenic
952059023 3:29484260-29484282 CATAACAAAGTACCACAGACTGG + Intronic
952136041 3:30421172-30421194 TATAAATAAGTGCCACAAACTGG - Intergenic
952182420 3:30932193-30932215 CATAACAAAGTACCACAGACTGG + Intergenic
953123094 3:40065008-40065030 CATAATAAAGTACCACAAACTGG + Intronic
954927455 3:54248740-54248762 CATAACAAAGTACCACAGACTGG - Intronic
955085322 3:55697163-55697185 CTTCCCCAAGTGCCACATAGTGG + Intronic
955214900 3:56977211-56977233 AATCCACAAGAGCCACAAACTGG + Intronic
955497121 3:59545304-59545326 GGTAACAAAGTGCCACAAACTGG - Intergenic
955547061 3:60042366-60042388 AAATACCAAGTACCACAAACTGG + Intronic
955692397 3:61603575-61603597 CATTACAAAATGCTACAAACTGG + Intronic
955694781 3:61624852-61624874 CATAACAAAGGACCACAAACTGG + Intronic
955973437 3:64458604-64458626 CATAACCAAGTACCACAGACTGG - Intergenic
956125906 3:66010708-66010730 CTTCTCCAAATACCACAAACTGG - Intronic
956338652 3:68194680-68194702 CATAACAAAGTACCACAAACTGG - Intronic
956382546 3:68680592-68680614 CATAACAAACTGCCACAGACTGG + Intergenic
956534373 3:70259692-70259714 TGTAACAAAGTGCCACAAACTGG + Intergenic
956707090 3:72008405-72008427 CATAACAAAGTACCACATACTGG - Intergenic
956723018 3:72134853-72134875 CCTAACAAAGTACCACAAACTGG - Intergenic
956752387 3:72353648-72353670 CGTAACAAAGTACCACAAACTGG - Intergenic
956849347 3:73214001-73214023 CATAACAAAGTACCACAAACTGG - Intergenic
957031888 3:75251468-75251490 CATAACAAAATGCCACAGACTGG - Intergenic
957060989 3:75481208-75481230 CACAACCAAGTACCACAAGCTGG - Intergenic
957564782 3:81870418-81870440 CATAACAAAATACCACAAACTGG + Intergenic
957612269 3:82483545-82483567 CATAACCAAATACCACAGACTGG - Intergenic
957671188 3:83304560-83304582 CATAACAAAGAACCACAAACTGG - Intergenic
957811757 3:85230890-85230912 CATAAGAAAATGCCACAAACTGG + Intronic
958036486 3:88175682-88175704 CATAATAAAGTACCACAAACTGG + Intergenic
958075023 3:88665540-88665562 CATCACTATCAGCCACAAACTGG - Intergenic
959019859 3:101177286-101177308 CATAACCAAGTACCACAAAGTGG + Intergenic
959179041 3:102955273-102955295 CATAACAAAGTACCACAGACAGG + Intergenic
959223285 3:103549598-103549620 CATGACAAAGTGCAACACACTGG - Intergenic
959247273 3:103888157-103888179 CATAACAAAGTGACACAAACTGG - Intergenic
959498331 3:107076691-107076713 CATAACAAAGTGCCACAGACTGG + Intergenic
959597696 3:108146001-108146023 CATAGCAAAATGCCACAAACTGG - Intergenic
959621005 3:108398437-108398459 CATAACAAAGTACCACAAACAGG - Intronic
959850856 3:111084862-111084884 CATAACAAAATGCCACAAACTGG + Intronic
959886304 3:111505153-111505175 CATAATGAAGTACCACAAACTGG - Intronic
959911727 3:111771164-111771186 CATTACAAAGTACCACAAATGGG + Intronic
960137486 3:114120688-114120710 CATAACAAAATGCCACAAACTGG - Intergenic
960239707 3:115326025-115326047 CATAACAAACTTCCACAAACTGG + Intergenic
960244480 3:115384920-115384942 TATCACCAAGTTTGACAAACTGG + Intergenic
960579186 3:119259753-119259775 CATAACAAAATGCCACAGACTGG - Intergenic
961292393 3:125858212-125858234 CACAACCAAGTACCACAAGCTGG + Intergenic
961320168 3:126067621-126067643 CATAACAAAGTCCCACACACTGG - Intronic
962091853 3:132252500-132252522 CATAACAAAGTACCACAGACTGG - Intronic
962150142 3:132883792-132883814 CATGACAAAATGCCATAAACAGG + Intergenic
962254065 3:133858394-133858416 CATAACAAAGTACCACAGACTGG + Intronic
962402828 3:135075896-135075918 CATCCCCAACTGCCTCAAATAGG - Intronic
962608002 3:137048749-137048771 CATAACAAAATACCACAAACTGG - Intergenic
962608991 3:137057178-137057200 CATAACAAAGTACCAAAAACTGG - Intergenic
962643330 3:137411341-137411363 CACAACAAAGTACCACAAACTGG + Intergenic
962864559 3:139436917-139436939 CATAACAAAGTACCACAAAGTGG - Intergenic
962940160 3:140118272-140118294 CACAACCAAGTACCACAGACTGG - Intronic
963157658 3:142116616-142116638 CATAACAAAATGCCACAAACTGG - Intronic
963275014 3:143321147-143321169 TATAACAAAGTACCACAAACTGG - Intronic
963392254 3:144680565-144680587 CATAACAAAATGCCATAAACTGG + Intergenic
963795677 3:149628403-149628425 GCTCACAAAGTGCCCCAAACTGG - Intronic
964293552 3:155208720-155208742 AATAACAAAGTGCCACAGACTGG - Intergenic
964307827 3:155359836-155359858 CATAACAAAATGCCATAAACTGG + Intergenic
964309839 3:155380766-155380788 CATCACCAAGTACCACAGACTGG - Intronic
964623563 3:158738415-158738437 CATAACAAAATACCACAAACTGG + Intronic
965113168 3:164452345-164452367 CATCACCAAGTAGCACAAGATGG - Intergenic
965192851 3:165553630-165553652 CATAACAAAGTACCACAAACTGG - Intergenic
965338944 3:167462278-167462300 CATAACAAAGTACTACAAACTGG + Intronic
965458692 3:168933765-168933787 CATAGCAAAGTACCACAAACTGG + Intergenic
965636796 3:170790026-170790048 CATAACTAATTTCCACAAACTGG - Intronic
965751402 3:171978387-171978409 CATAACAAAGTACCACAAACTGG + Intergenic
965917977 3:173874138-173874160 CATAACAAAATGCCACAAACTGG - Intronic
966397055 3:179514830-179514852 CATAACAAAATGCCACAGACTGG - Intergenic
966552726 3:181223037-181223059 CATAACAAAATACCACAAACTGG - Intergenic
966733102 3:183167059-183167081 CATAACAAAGTGCCACAGACTGG + Intergenic
967229670 3:187325517-187325539 CATAACAAAGTACCACAAACTGG + Intergenic
967521211 3:190435141-190435163 CATAACAAAGTACCACAGACTGG + Intronic
967656338 3:192054565-192054587 CATCCCTAAGTGCTTCAAACAGG - Intergenic
967660908 3:192108770-192108792 CATAACAAAGTACCATAAACAGG + Intergenic
967968206 3:194979272-194979294 CATAACCAAGTACCACAGAGTGG + Intergenic
968280116 3:197470805-197470827 CAAAACAAAGTGCCACAAATTGG + Intergenic
968849869 4:3071941-3071963 CATAACAAAGTACCACAGACCGG - Intergenic
969056317 4:4405020-4405042 TATAACAAAGTACCACAAACTGG + Intronic
969087160 4:4665075-4665097 CTGTACAAAGTGCCACAAACTGG + Intergenic
969191906 4:5528154-5528176 CAGCAACAACTGCCACAAAATGG - Intergenic
969202869 4:5619603-5619625 CATAACAAAGTACCACAAACTGG - Intronic
969220990 4:5758313-5758335 CATGACAAAGCGCCGCAAACTGG - Intronic
969681072 4:8643900-8643922 CATCACAAAATGCCACAGACTGG - Intergenic
969809006 4:9633438-9633460 CACAACCAAGTACCACAAGCTGG + Intergenic
969931619 4:10636523-10636545 CATAACAAATAGCCACAAACTGG - Intronic
969973003 4:11067224-11067246 CATGACAAAGTACCACAAACTGG + Intergenic
969986041 4:11211952-11211974 CATAACAACGTGCCACAGACTGG - Intergenic
970135779 4:12921887-12921909 CATAACAAAGTGTCACAGACTGG - Intergenic
970211371 4:13713560-13713582 CATAACAAATTTCCACAAACTGG - Intergenic
970229863 4:13898555-13898577 CATAACAAAGTGCCATAAACTGG - Intergenic
970261385 4:14228546-14228568 CATAACAAAGTCCCACAAACTGG - Intergenic
970407090 4:15774279-15774301 CATAACAAAGTGCCACAATGGGG - Intergenic
970443335 4:16103857-16103879 CATAACAAAGTACCACAGACTGG + Intergenic
970478772 4:16451856-16451878 CATGACAAAGTGCCTTAAACAGG + Intergenic
970568176 4:17352783-17352805 CATAACAAAATGCCACAGACTGG - Intergenic
970892500 4:21063261-21063283 CATAACAAAGTTGCACAAACTGG - Intronic
971022450 4:22550881-22550903 CATAACAAAATGCCACAAACTGG + Intergenic
971201510 4:24513407-24513429 AAGCACTAAGTGCCACAAAATGG - Intergenic
971221309 4:24709335-24709357 CACAACAAAGTGCCAGAAACTGG - Intergenic
971225847 4:24750914-24750936 CCTAACAAAGTGCCACAAACTGG - Intergenic
971338366 4:25744961-25744983 CATAACCAAGTACCAAATACTGG - Intergenic
971394005 4:26212096-26212118 TAACAAAAAGTGCCACAAACTGG - Intronic
971508225 4:27389938-27389960 CATAACAAATTGCCAGAAACTGG - Intergenic
971630749 4:28990153-28990175 CATTACGAAATTCCACAAACTGG + Intergenic
971750785 4:30645165-30645187 CATAACAAAGTACCAAAAACTGG - Intergenic
972286660 4:37655631-37655653 CCTCACAAAGTACCACAGACAGG - Intronic
972297153 4:37750804-37750826 CATAACAAAATGCCACAGACTGG - Intergenic
972749174 4:41971784-41971806 CATAACAAAATGCCACAGACTGG + Intergenic
972862059 4:43181370-43181392 CATAACAAAATGCCACAAGCTGG + Intergenic
972974259 4:44614080-44614102 CATAACAAAGTACCACAGACTGG - Intergenic
973014989 4:45126855-45126877 CATAACAAAATACCACAAACTGG - Intergenic
973056019 4:45658792-45658814 CATCACAAAATACCATAAACTGG - Intergenic
973601598 4:52548050-52548072 CATAACAAAGTACCACAGACTGG + Intergenic
973957394 4:56076309-56076331 CATAACAAAGTGCCACAGAATGG - Intergenic
973960061 4:56100836-56100858 CATAACCAACTACCACAAACTGG - Intergenic
974068763 4:57105077-57105099 CTTCCCCAACTGCCACAAAAGGG - Intronic
975099314 4:70494285-70494307 CAAAACAAAGTACCACAAACTGG + Intergenic
975318199 4:72979307-72979329 TATAACAAAGTACCACAAACTGG - Intergenic
975798393 4:78033136-78033158 CATAACAAAATGCCACAAACAGG + Intergenic
976304030 4:83541703-83541725 CATAACAAAGTACCACAGACTGG + Intronic
976478432 4:85511382-85511404 TATAACGAAGTACCACAAACTGG + Intronic
976828005 4:89281740-89281762 CATAACAAAATACCACAAACTGG - Intronic
976956580 4:90908916-90908938 CGTAACAAAGTACCACAAACTGG + Intronic
976986720 4:91309853-91309875 CATAACAGAGGGCCACAAACTGG + Intronic
976999614 4:91481207-91481229 CATAACAAAGTACCACAAATTGG + Intronic
977165456 4:93689239-93689261 CATAACAAAGTACCACAGACTGG - Intronic
977366654 4:96077777-96077799 CATAACAAAGTACCACAAGCTGG + Intergenic
977432139 4:96943579-96943601 CATAACAAAGTACCACAAACTGG - Intergenic
977469258 4:97421586-97421608 CATAACAAAGTACCACAAATTGG + Intronic
977576612 4:98681601-98681623 CACAACAAAGTACCACAAACTGG - Intergenic
977895379 4:102358628-102358650 TGTAACAAAGTGCCACAAACTGG - Intronic
978912762 4:114083742-114083764 CATAACAAAGTACCATAAACTGG - Intergenic
979092618 4:116504757-116504779 CCTAACAAAGTACCACAAACTGG + Intergenic
979790856 4:124779647-124779669 CATAACCAATTACCACAAATTGG - Intergenic
979932437 4:126647784-126647806 AGTAACAAAGTGCCACAAACTGG - Intergenic
979940319 4:126753939-126753961 CATAACAAAGTACCACAGACTGG - Intergenic
979954591 4:126936185-126936207 CATGACCAAGTACCACAAACTGG - Intergenic
980740065 4:136938968-136938990 CATAACAAAGTTCCACAGACTGG - Intergenic
981444423 4:144819175-144819197 CATAACAAAGTACCACAGACTGG + Intergenic
981819422 4:148868636-148868658 CATAACAAAGCACCACAAACTGG + Intergenic
981956852 4:150485758-150485780 CATAACAAAGTACCACAAATTGG - Intronic
982124419 4:152172124-152172146 CATAATAAAGTGCCACAAGCTGG - Intergenic
982446989 4:155503484-155503506 CATAACAAAGTACCACAAACTGG - Intergenic
982729420 4:158940038-158940060 CATAACCAAGTATCACAGACAGG + Intronic
982841537 4:160193974-160193996 CACCACCAAGTGGCAGAACCAGG - Intergenic
983202314 4:164874210-164874232 TATAACAAAGTGCCACAGACTGG + Intergenic
983625817 4:169800998-169801020 CATAACAAAGTACCACAGACTGG + Intergenic
984425996 4:179586351-179586373 CATAACAAAGTACCACAGACTGG - Intergenic
984539898 4:181024441-181024463 CATAACAAAGGACCACAAACTGG + Intergenic
984600347 4:181719375-181719397 TATAACAAAGTACCACAAACTGG + Intergenic
984623130 4:181975836-181975858 CATAACAAAGTACCACAAACTGG + Intergenic
984702383 4:182826528-182826550 CTTAACAAAGTGACACAAACTGG + Intergenic
984914007 4:184704048-184704070 AATTACTAAGTGCCCCAAACAGG + Intronic
984958952 4:185075446-185075468 CATCATGAAGCACCACAAACTGG - Intergenic
985026894 4:185747294-185747316 CATAACAAAGTACCACAGACTGG - Intronic
985590196 5:760544-760566 CATCACAAAGCACCAAAAACCGG - Intronic
985867156 5:2523097-2523119 CTTCAACAAGTGCAGCAAACCGG + Intergenic
986221710 5:5774578-5774600 CATCACAAAGCACCACAGACTGG + Intergenic
986252118 5:6069668-6069690 CATAACAAAATGCCACAAACTGG - Intergenic
986363164 5:7001871-7001893 CATGACAAAGTGCCACAAGCTGG + Intergenic
986550544 5:8949517-8949539 CATAACAAAGTGCCACAAATGGG - Intergenic
986712526 5:10498401-10498423 TGTAACCAAGTGCCACAAACTGG + Intergenic
986741937 5:10712295-10712317 CTTAACAAAGTGCCACAGACTGG - Intronic
986790467 5:11154665-11154687 CAGAACCGAGTACCACAAACTGG + Intronic
987213691 5:15710745-15710767 CATAACAAAGTACCACAAACTGG + Intronic
987549560 5:19361067-19361089 CATAACAAAGTACCACAAATTGG + Intergenic
987565241 5:19575698-19575720 CATAACAAATTGCCACAAACAGG + Intronic
988173174 5:27685338-27685360 CATAACAAAGTATCACAAACTGG + Intergenic
988189527 5:27910487-27910509 CATAACAAAGTACCACAAACTGG + Intergenic
988355813 5:30172763-30172785 TATAACAAAGTACCACAAACTGG + Intergenic
988399375 5:30742063-30742085 CATAACAAAGTACCACAAACTGG + Intergenic
988707621 5:33741210-33741232 CATGACAAAGTGCCACAGACTGG + Intronic
988785649 5:34563688-34563710 CATCACCAATGACCACAAATGGG - Intergenic
989073691 5:37539568-37539590 CACAACAAAGTGCCACAGACTGG - Intronic
989254876 5:39355684-39355706 CATAACAAAGTACCACAGACTGG + Intronic
989332989 5:40281548-40281570 CATAAGAAAATGCCACAAACTGG + Intergenic
989447526 5:41548056-41548078 CATAACAAAGTACCACAAACTGG + Intergenic
989502771 5:42188501-42188523 CATAACAAACTACCACAAACTGG - Intergenic
989703387 5:44297927-44297949 CATAACAAAGTGTCACAGACTGG + Intergenic
989713843 5:44435381-44435403 CATGACAAAGTACTACAAACTGG + Intergenic
989785810 5:45327939-45327961 CATGACAAAATACCACAAACTGG - Intronic
990081529 5:51921733-51921755 GATCACTGAGTGCCATAAACAGG - Intergenic
990333497 5:54750017-54750039 CATAACAAAATACCACAAACTGG - Intergenic
990585868 5:57210666-57210688 CATAACCAAATACCACAGACTGG + Intronic
990604343 5:57394024-57394046 CATAACAAATTACCACAAACTGG - Intergenic
990909606 5:60840564-60840586 CATAACAAAGTACCACCAACTGG - Intronic
991084980 5:62640480-62640502 CATAACAAAGCACCACAAACTGG + Intergenic
991152169 5:63383142-63383164 CATAACAAAGCACCACAAACTGG - Intergenic
991218496 5:64184244-64184266 CATAACAAAGTACCACAGACTGG - Intronic
991292907 5:65050133-65050155 CAAAATAAAGTGCCACAAACTGG + Intergenic
991321447 5:65377759-65377781 CATAACAAAGTACCACAAATTGG + Intronic
991412378 5:66357885-66357907 CATAACAAAGTACCCCAAACTGG + Intergenic
991703445 5:69336148-69336170 CACCCACAAGTGCCACCAACAGG - Intergenic
991939983 5:71841376-71841398 CATAACAAAGTAGCACAAACTGG - Intergenic
992255555 5:74917498-74917520 CATAACAAAGTACCACAGACTGG + Intergenic
992311181 5:75500275-75500297 CATAAGAAAGTACCACAAACTGG - Intronic
992372556 5:76159452-76159474 CATAACAAAGTACCAAAAACTGG + Intronic
992382122 5:76248216-76248238 CATAACAAAGTGCCACAGACTGG + Intronic
992588481 5:78267836-78267858 CATAACAAAATGCCACAGACTGG - Intronic
992972569 5:82077751-82077773 CAGAACGAAGTGCCACAGACAGG - Intronic
992991740 5:82290767-82290789 CATAACCATGTGGCACAAAGTGG + Intronic
993294006 5:86110570-86110592 CATTACCAAGTACCCAAAACTGG - Intergenic
993441430 5:87961691-87961713 CATAACAAAGTACCACAAACTGG + Intergenic
993484642 5:88467960-88467982 TGTAACAAAGTGCCACAAACTGG + Intergenic
993575413 5:89593252-89593274 CATAGGAAAGTGCCACAAACTGG - Intergenic
994156879 5:96513773-96513795 CATAACAAAGTACCACAAACTGG + Intergenic
995400807 5:111739058-111739080 CATAACAAAGTGCCACAGACTGG - Intronic
995736015 5:115299826-115299848 CATAACAAAGTGCCATAAACTGG + Intergenic
995904505 5:117107246-117107268 CATAACTAAGTACCACAGACTGG + Intergenic
995921525 5:117319815-117319837 CATAACAAAGTACCACAAACTGG + Intergenic
996399030 5:123039843-123039865 TGTAACAAAGTGCCACAAACTGG - Intergenic
996596521 5:125209389-125209411 CATAACAAAGTACCACAAACTGG - Intergenic
997429275 5:133826350-133826372 CATAACAAAGGACCACAAACTGG + Intergenic
997648975 5:135501112-135501134 CATAACAAATTACCACAAACTGG + Intergenic
998223483 5:140307123-140307145 CACAACAAAGTACCACAAACTGG - Intergenic
998534768 5:142919448-142919470 CGTAACAAAGTGCCACAAACTGG - Intronic
998573040 5:143282444-143282466 TATCACCAACATCCACAAACTGG + Intronic
999152802 5:149437630-149437652 CATAACAAACTGTCACAAACTGG + Intergenic
999487713 5:152015751-152015773 CATAACAAAGTACCACAAATTGG - Intergenic
999595024 5:153193662-153193684 CATAACAAAGTACCACAAACTGG - Intergenic
1000212583 5:159121009-159121031 CATAACAGAGTACCACAAACTGG + Intergenic
1000282548 5:159794548-159794570 CATAACGAAGTACCACATACTGG - Intergenic
1000803200 5:165754529-165754551 CATAACAAAGTACCAAAAACTGG + Intergenic
1000865131 5:166504350-166504372 CGTAACAAAGTACCACAAACTGG + Intergenic
1001079341 5:168655595-168655617 CATAACAAAGTACCACAAACTGG - Intergenic
1001165463 5:169361582-169361604 CAAAACAAAGTACCACAAACTGG - Intergenic
1001183017 5:169538575-169538597 CATCACAAAGTAGCACAGACTGG - Intergenic
1001657324 5:173361687-173361709 CATAACAAAGTGCCACAGACTGG + Intergenic
1001685130 5:173588536-173588558 CATAATGAAGTACCACAAACTGG - Intergenic
1001750419 5:174125965-174125987 CTTAACAAAGTGCCACATACTGG - Intronic
1001765265 5:174240923-174240945 TATAATGAAGTGCCACAAACTGG + Intronic
1001852592 5:174982544-174982566 CATAACAAAGTGCCACAACCTGG + Intergenic
1002339385 5:178504997-178505019 CATAACGAAGTTCCACAGACCGG + Intronic
1002837016 6:873520-873542 CATGACAAAGTACCACAGACTGG - Intergenic
1002981464 6:2142674-2142696 CATAACAAAGTACCACAGACTGG - Intronic
1003249835 6:4416808-4416830 CATAACAAAGTACCACAGACTGG + Intergenic
1003265631 6:4562908-4562930 CATAACAAAGTACCACAGACTGG - Intergenic
1003429036 6:6022243-6022265 TATAATAAAGTGCCACAAACTGG - Intergenic
1003614078 6:7639626-7639648 TATAACAAAGTGCCACAGACTGG + Intergenic
1003741703 6:8948013-8948035 CATAACAAAGTACCACAGACCGG + Intergenic
1003897582 6:10622277-10622299 CATAACAAAGTGGCACAGACTGG + Intronic
1004083288 6:12417472-12417494 TGTAACAAAGTGCCACAAACTGG - Intergenic
1004105436 6:12663638-12663660 CATAACAAATTGCCATAAACTGG + Intergenic
1004157868 6:13186305-13186327 TATCACCAAGTGCAAAAAGCAGG - Intronic
1004298944 6:14439713-14439735 CATAACAAAATGCCACAGACGGG + Intergenic
1004315234 6:14581086-14581108 CATAACAAAGTACCACAAATTGG - Intergenic
1004471189 6:15930914-15930936 CATAATGAAGTACCACAAACTGG + Intergenic
1004476879 6:15981559-15981581 CATAGCAAAGTACCACAAACTGG + Intergenic
1004523193 6:16381504-16381526 CATTACAAAGTGCCAGAAACTGG - Intronic
1004563176 6:16770777-16770799 TATAACAAAGTACCACAAACTGG - Intergenic
1004880688 6:20004297-20004319 CATAACAAAGTGCCACAGATTGG - Intergenic
1004914991 6:20323155-20323177 TGTGACCAAGTGCCACAGACCGG - Intergenic
1005226949 6:23654163-23654185 CATGACAAAGTGCCACACAGTGG - Intergenic
1005599885 6:27415838-27415860 CATAACAAAGTACCACAAACTGG + Intergenic
1005709085 6:28486294-28486316 CATAACAAATTACCACAAACTGG + Intergenic
1006039325 6:31240928-31240950 CATAACAAAGTACCACACACTGG + Intergenic
1006323424 6:33334770-33334792 CATAACAAAGTATCACAAACTGG - Intergenic
1006695240 6:35925494-35925516 CATAACAAAGTACCACAAACTGG + Intergenic
1007071638 6:39042402-39042424 CATAACAAAGTTCCACAAACTGG - Intergenic
1007101176 6:39248064-39248086 CCTAACAAAGTTCCACAAACTGG + Intergenic
1007101306 6:39249083-39249105 CCTAACAAAGTTCCACAAACTGG + Intergenic
1007222258 6:40288058-40288080 CATAACAAAGTGCCAGAGACTGG - Intergenic
1007268792 6:40619743-40619765 CATAACAAAGTACCACAGACTGG - Intergenic
1007309188 6:40931918-40931940 TATAACAAAGTGCCACAGACTGG - Intergenic
1007355958 6:41317798-41317820 CATCGCCATATGCCACACACTGG - Intergenic
1007509424 6:42363920-42363942 TATAACCAAGTACCACACACTGG - Intronic
1007526774 6:42502887-42502909 CATCACAAAGTACCACAAACTGG - Intergenic
1007839968 6:44708061-44708083 CATAACAAAATGCCACACACTGG + Intergenic
1008383498 6:50859970-50859992 AATCACCAAGTTCTACAATCTGG + Intergenic
1009039832 6:58162811-58162833 CATAACAAAATACCACAAACTGG + Intergenic
1009215726 6:60917658-60917680 CATAACAAAATACCACAAACCGG + Intergenic
1009281015 6:61751742-61751764 CATCAGAAAATACCACAAACTGG + Intronic
1009285900 6:61816611-61816633 GATAACGAAGTACCACAAACTGG - Intronic
1009467126 6:63985426-63985448 CATAGCAAAGTACCACAAACTGG - Intronic
1010275334 6:73962402-73962424 CATAACAAATTACCACAAACTGG - Intergenic
1010860623 6:80905715-80905737 CATAACAAAGTACCACAAACTGG - Intergenic
1010913248 6:81585162-81585184 CATAACAAAGTACCACAAATTGG - Intronic
1010935193 6:81851981-81852003 CATAACAAAGTACCACAAAGTGG - Intergenic
1011019768 6:82799286-82799308 CATAACAAAGTACCACAGACTGG - Intergenic
1011128216 6:84029409-84029431 CATAACCATGTACCACAGACTGG + Intergenic
1011255830 6:85419925-85419947 CATAACCAAATACCACAGACTGG + Intergenic
1011323546 6:86123743-86123765 CATAACAAAGTGTCACAGACTGG + Intergenic
1011470740 6:87705013-87705035 CATAACAAAGTACCACAAACTGG - Intergenic
1011507429 6:88061735-88061757 CATAACAAAGTACCACAAACTGG - Intronic
1011529015 6:88299617-88299639 CATCACAAAGTACCACAAACTGG + Intergenic
1011652417 6:89518816-89518838 CATTACAAAATGCCACAGACTGG + Intronic
1011709522 6:90038094-90038116 CATAACAAAGTACCACAAACTGG - Intronic
1012181262 6:96155896-96155918 CATAACAAAATACCACAAACTGG - Intronic
1012244447 6:96911088-96911110 CGTAACAAAGTACCACAAACTGG + Intergenic
1012249021 6:96959341-96959363 CATAACAAAGTACCACAGACTGG + Intronic
1012310469 6:97718260-97718282 CATCCCCAAGTTCCACCAGCAGG - Intergenic
1012496757 6:99842164-99842186 CATAACAAATGGCCACAAACTGG + Intergenic
1012731811 6:102892803-102892825 CATAACAAAGTGCCACAGAATGG + Intergenic
1012807538 6:103913516-103913538 TATAACCAAATACCACAAACTGG - Intergenic
1013387064 6:109642238-109642260 CATAACAAAGTGCCACAAACTGG - Intronic
1013580252 6:111527007-111527029 CGTAACAAAGTACCACAAACTGG + Intergenic
1013593464 6:111640571-111640593 CATAACAAAGTACCACAGACTGG - Intergenic
1013714723 6:112945125-112945147 CATAACAAATTACCACAAACTGG - Intergenic
1013739945 6:113270892-113270914 CATCACCAAGTACCCCAAAATGG - Intergenic
1013756164 6:113464341-113464363 CATAACCAAGTATCACAGACTGG + Intergenic
1013840771 6:114390547-114390569 TGTAACCAAGTGGCACAAACTGG - Intergenic
1014239982 6:119006302-119006324 CATAACAAAGTACTACAAACTGG - Intronic
1014698561 6:124654942-124654964 CATAACAAAGTACCACAAATAGG - Intronic
1014736545 6:125100987-125101009 CTTCACCAAGATCCACATACAGG - Intergenic
1014823770 6:126024232-126024254 CATAACCAAATACCACAGACTGG + Intronic
1015050975 6:128839511-128839533 CATCTCCAAGTGACACAGATTGG - Intergenic
1015138437 6:129901364-129901386 CATAACAAATGGCCACAAACTGG + Intergenic
1015300727 6:131650574-131650596 CATGACAAAGTACCACAGACTGG + Intronic
1015403312 6:132811254-132811276 CATAGCAAAGTACCACAAACTGG - Intergenic
1015442636 6:133266480-133266502 TATAACAAAGTACCACAAACTGG - Intronic
1015798505 6:137036758-137036780 CATGGCAAAGTGCCACAAACTGG - Intronic
1015804024 6:137090454-137090476 CATAACAAAGTACTACAAACTGG - Intergenic
1016231459 6:141810299-141810321 CATAACTAAGTGCCACACACTGG - Intergenic
1016433692 6:144013495-144013517 CATAACAAATTACCACAAACTGG + Intronic
1016601614 6:145867980-145868002 CATAACAAAGTACCACAAACTGG + Intronic
1017448070 6:154527229-154527251 CATGACAAAGTACCACAAGCTGG - Intergenic
1017572410 6:155760565-155760587 CATAACAAAGTACTACAAACTGG - Intergenic
1017780071 6:157709021-157709043 CATAACAAAATGCCACAAGCTGG + Intronic
1017958669 6:159202882-159202904 CATAACAAAATGCCACAGACTGG + Intronic
1018126725 6:160689920-160689942 CATCACAAAATACCACACACGGG + Intergenic
1018212644 6:161497000-161497022 CATTATAAAGTGCCACAAGCCGG - Intronic
1018497742 6:164367082-164367104 CATAACAAAATACCACAAACTGG - Intergenic
1019460008 7:1152855-1152877 CGTCACCAAGTACTAAAAACTGG - Intronic
1019648372 7:2142948-2142970 CATCACCACTGGCCACACACAGG + Intronic
1019801669 7:3092355-3092377 CACGACAAAGTACCACAAACAGG - Intergenic
1019958222 7:4434268-4434290 CCTCGCCAAGTGTCAGAAACAGG - Intergenic
1019968591 7:4521991-4522013 CATAACAAAGTACCGCAAACTGG - Intergenic
1020477020 7:8608144-8608166 TATAACAAAGTACCACAAACTGG - Intronic
1020565141 7:9786363-9786385 CATGCCCAAGTGGCACAAGCTGG + Intergenic
1021498875 7:21307436-21307458 AAGCACCCAGTTCCACAAACTGG + Intergenic
1021617974 7:22522001-22522023 CACCACCAAGTACCACAGACAGG - Intronic
1021814522 7:24434225-24434247 CATAGCAAAGTGCCACAAACTGG - Intergenic
1021899968 7:25275469-25275491 CATAACCAAGTACCACAACCTGG + Intergenic
1021972629 7:25980746-25980768 CAAAACAAAGTGCCACAGACTGG - Intergenic
1021979648 7:26041633-26041655 TGTAACCAAGTACCACAAACTGG - Intergenic
1022141195 7:27494387-27494409 TATAACTAAGTGCCACAGACTGG + Intergenic
1022147413 7:27558931-27558953 CATAACAAAGTACCACAAACTGG + Intronic
1022311691 7:29202455-29202477 CATCCTCAAGTGCAACAAAATGG + Intronic
1022387927 7:29918764-29918786 CGTCACAAAGTACCACAAACTGG - Intergenic
1022851101 7:34263019-34263041 CATAACAAATTACCACAAACTGG - Intergenic
1022878627 7:34563109-34563131 CATAACAAATTACCACAAACTGG - Intergenic
1022908880 7:34881195-34881217 CATAACAAATTGCCACAAACTGG + Intergenic
1022927562 7:35071481-35071503 CATCATCAAGTACCACAGACAGG - Intergenic
1022998895 7:35787146-35787168 CATAACAAAATACCACAAACTGG - Intergenic
1023186526 7:37538844-37538866 CATAACGAAGTATCACAAACTGG - Intergenic
1023380370 7:39600957-39600979 CATAACAAAGTATCACAAACTGG - Intronic
1023597341 7:41845050-41845072 CATAACAAAGTACCACAGACTGG + Intergenic
1024010964 7:45266430-45266452 TGTAACCAAGTGCCACAAACTGG + Intergenic
1024082211 7:45864997-45865019 CACCACCAAGAACCACAAAAGGG + Intergenic
1024090036 7:45929252-45929274 CATAACAAATTACCACAAACTGG - Intergenic
1024117741 7:46209380-46209402 CACCACAAAGTGCCACACAGTGG + Intergenic
1024152485 7:46586892-46586914 CATAACAAAGTTCCACGAACCGG + Intergenic
1024352844 7:48384714-48384736 CATAACAAAGTACCACAAACTGG + Intronic
1024414005 7:49081334-49081356 CATAACAAAGTTCCACAGACTGG + Intergenic
1024414191 7:49083124-49083146 CATAACAAAGTACCACATACTGG + Intergenic
1024457335 7:49624299-49624321 CATGACAAACTGCCACAGACTGG - Intergenic
1024572301 7:50733345-50733367 CATAACAAAGTGCCACAGACTGG - Intronic
1024747786 7:52428159-52428181 CATAGCAAAGTGCCACATACTGG + Intergenic
1025307407 7:57874707-57874729 CATAACCAAGTAACACAAACTGG + Intergenic
1025481272 7:60986454-60986476 CATAACCAAGTAACACAAACTGG - Intergenic
1025620569 7:63166468-63166490 CATCACAAAATACCAGAAACTGG + Intergenic
1025838301 7:65117736-65117758 CATAACCAAGTAACACAAACTGG - Intergenic
1025878975 7:65515346-65515368 CATAACCAAGTAACACAAACTGG + Intergenic
1025884772 7:65578241-65578263 CATAACCAAGTAACACAAACTGG + Intergenic
1026644436 7:72155550-72155572 CATAACCAAGTGTCACAGAATGG - Intronic
1027289255 7:76685273-76685295 CATGACAAAGTGCCACAGACTGG + Intergenic
1027518389 7:79171093-79171115 CATTACAAAGTACCATAAACTGG + Intronic
1027669388 7:81077186-81077208 CATAACAAATTACCACAAACTGG + Intergenic
1027778573 7:82496407-82496429 AATAACAAAGTGCCACAGACTGG + Intergenic
1027863096 7:83610888-83610910 CATAACCAAGTACCACAGAGGGG - Intronic
1028000608 7:85493319-85493341 CATAACAAAGTACCACAGACTGG + Intergenic
1028211974 7:88084789-88084811 CATAACAAAGTACCACAGACTGG + Intronic
1028239719 7:88404846-88404868 CATAACAAATTACCACAAACTGG - Intergenic
1028374710 7:90134107-90134129 CATCACCAAGTACCACAGACAGG + Intergenic
1028512080 7:91636321-91636343 CATAACAAAGTACCACAGACTGG - Intergenic
1028603078 7:92623908-92623930 CCTCAACAAATGCCATAAACAGG + Intronic
1028954080 7:96669138-96669160 CATAACAAAGTACCACAGACTGG - Intronic
1029101139 7:98130853-98130875 CATAATCAAGTATCACAAACTGG - Intronic
1029297816 7:99555436-99555458 TATAACAAAGTACCACAAACTGG - Intronic
1029892889 7:103949981-103950003 CATAATAAAATGCCACAAACAGG + Intronic
1029907566 7:104106918-104106940 CATAACAATGTGCCACAAACTGG + Intergenic
1030076574 7:105742036-105742058 CATAACAAAGTGCCACAATCTGG - Intronic
1030174213 7:106633626-106633648 CATAACAAAGTACCACACACTGG - Intergenic
1030201478 7:106909842-106909864 CATAACAAAGTGCCACAAACTGG - Intergenic
1030249435 7:107426167-107426189 TATAACAAAGTACCACAAACTGG - Intronic
1030284378 7:107810697-107810719 CATAACAAAGTATCACAAACTGG + Intergenic
1030614923 7:111729097-111729119 CCTCACAAAATACCACAAACTGG - Intronic
1030952013 7:115802491-115802513 CATAACAAAGTACCACAGACTGG - Intergenic
1031029073 7:116715192-116715214 CATAACAAATTACCACAAACTGG + Intronic
1031076261 7:117215758-117215780 CACCACCAAGTGCCAGAAGCAGG - Intronic
1031455386 7:121972886-121972908 CAACCCAAAGTGCCACAAAATGG + Intronic
1031656037 7:124356782-124356804 CATGACAAAGCGCCACAGACTGG - Intergenic
1031679413 7:124652824-124652846 CATAACAAAGTACCACAAACTGG + Intergenic
1031766348 7:125782130-125782152 CATAACAAAGTGCTACAAACTGG - Intergenic
1031824168 7:126542184-126542206 CATAACAAAGTACCACAGACTGG - Intronic
1032541710 7:132708338-132708360 CATCATAAAGTGCCACAAACTGG - Intronic
1033062249 7:138120365-138120387 TATAACTAAGTACCACAAACTGG - Intergenic
1033583476 7:142757069-142757091 CATCACCCAGGGCCACAATGGGG + Intronic
1033923087 7:146419442-146419464 CATAAAGAAGTACCACAAACTGG - Intronic
1033956180 7:146851448-146851470 CATCATAAAGTACCATAAACTGG + Intronic
1034032477 7:147783499-147783521 TGCCACAAAGTGCCACAAACTGG + Intronic
1034045602 7:147923932-147923954 CATGACAAAATGCCACAAACTGG - Intronic
1034090661 7:148361369-148361391 CATAACAAAGTACCACAAACTGG + Intronic
1034151725 7:148922131-148922153 CATAACAAAGTACCACAAACTGG - Intergenic
1034217698 7:149421020-149421042 TGTAACAAAGTGCCACAAACTGG - Intergenic
1034509763 7:151524145-151524167 CATAACAAAGTGCCGCAAACTGG - Intergenic
1034527422 7:151674371-151674393 CATGACATAGTGCCACACACTGG - Intronic
1034572020 7:151963976-151963998 CATAACCAAGTCCAACAGACTGG + Intronic
1034932056 7:155170427-155170449 CTTCACCAAGTGTCCCAAAGAGG + Intergenic
1034964778 7:155384285-155384307 CTTAGCGAAGTGCCACAAACCGG + Intronic
1035234797 7:157489276-157489298 CATAACAAATTGCCACAAACTGG - Intergenic
1035849297 8:2899274-2899296 AATAACAAAGTACCACAAACTGG - Intergenic
1035968263 8:4219139-4219161 CAACACCAGGTGCTACAAAAAGG - Intronic
1035993293 8:4516359-4516381 CATGATAAAGTACCACAAACTGG - Intronic
1036204240 8:6793753-6793775 TGTCACAAAGTGCCACAGACTGG + Intergenic
1036614010 8:10374347-10374369 CAGCACCAAGGTCCACAAAGGGG - Intronic
1036789873 8:11710221-11710243 GAACACCAAGAGCCACAGACCGG - Intronic
1037131719 8:15414508-15414530 TATAACAAAGTACCACAAACTGG + Intergenic
1037150864 8:15633847-15633869 CATAACAAAGTATCACAAACTGG - Intronic
1037156567 8:15707757-15707779 CACAACAAAATGCCACAAACCGG + Intronic
1037169196 8:15869891-15869913 CATTACAAAGTACCATAAACTGG - Intergenic
1037414923 8:18639748-18639770 CATAACAAAATGCCACAAATGGG - Intronic
1037535626 8:19821184-19821206 CATAACAAAGTACTACAAACTGG + Intronic
1037727853 8:21498019-21498041 TGTAACCAAGTACCACAAACTGG - Intergenic
1037844539 8:22271473-22271495 CATAACAAATTGCCACAGACTGG + Intergenic
1038004681 8:23419531-23419553 CATGACAAAGCACCACAAACTGG + Intronic
1038120593 8:24609916-24609938 CATAACAAAGTGTCACCAACTGG - Intergenic
1038409534 8:27347419-27347441 CATCAGAAAGTACCACAGACTGG + Intronic
1038486328 8:27937621-27937643 CATCACAAAATACCACAGACTGG + Intronic
1038521976 8:28241756-28241778 CATCACAAAGTACCACATACTGG - Intergenic
1038524513 8:28261558-28261580 CATCACAAAGTACCACAGACTGG - Intergenic
1038665685 8:29535449-29535471 TATAACAAAGTACCACAAACTGG + Intergenic
1038732028 8:30136469-30136491 CATCACACAGTGCCACAGACTGG - Intronic
1038841457 8:31188247-31188269 CATAACAAAATGCCACAGACTGG - Intergenic
1039083540 8:33757556-33757578 CATAACAAAGTACCACAAACTGG + Intergenic
1039449212 8:37658173-37658195 CATAACAAAGTTCCACAAACTGG + Intergenic
1039717607 8:40127221-40127243 TATAACAAAGTGCCACCAACTGG + Intergenic
1039917650 8:41871731-41871753 CATAACAAAGTCCCACAGACTGG - Intronic
1040866918 8:52056731-52056753 CATAACAATGTACCACAAACTGG - Intergenic
1040981428 8:53250386-53250408 CATAACAAAGTGCTCCAAACTGG + Intronic
1040982863 8:53263459-53263481 CATAACAAAGTACCACAGACTGG + Intergenic
1041334459 8:56764576-56764598 CATAACAAAATGCCACAAACAGG - Intergenic
1041408581 8:57528489-57528511 CATAACAAAATACCACAAACTGG - Intergenic
1041439947 8:57883645-57883667 CATAACAAAGTGCCACAGATTGG - Intergenic
1041597100 8:59667659-59667681 TATAACAAAGTACCACAAACTGG + Intergenic
1041625064 8:60016027-60016049 CTTCAACATGTGCCACAAAGGGG + Intergenic
1041644224 8:60235115-60235137 CATCACAAAGTGGCACTGACTGG + Intronic
1041793849 8:61725670-61725692 TATAACAAAATGCCACAAACTGG + Intergenic
1042168471 8:65970104-65970126 CATAACCAGGTACCACAGACTGG - Intergenic
1042181753 8:66096051-66096073 CATAACAAAGTACTACAAACTGG + Intronic
1042447771 8:68908097-68908119 CATAACTAAGTACCACAGACTGG - Intergenic
1042710226 8:71708797-71708819 CATAACAAAGTACCACAGACTGG + Intergenic
1042838729 8:73102269-73102291 CATAGCGAAGTACCACAAACAGG + Intronic
1043151397 8:76721028-76721050 CATCCCCTTCTGCCACAAACAGG - Intronic
1043402285 8:79895634-79895656 CATAACAAAGTACCACAGACTGG - Intergenic
1043693581 8:83188743-83188765 CATCATAAAGTGCCACAAACTGG - Intergenic
1043878178 8:85510089-85510111 CATCATCAAATGCTACAAAGTGG - Intergenic
1043984452 8:86677233-86677255 CATAACAAATTACCACAAACTGG - Intronic
1044208327 8:89518958-89518980 TATAACAAAGTACCACAAACTGG + Intergenic
1044278363 8:90328205-90328227 CATAACAAAGTACCACAGACTGG - Intergenic
1044827117 8:96209211-96209233 CATAACAAAGTACCACAGACTGG + Intergenic
1044973274 8:97640406-97640428 CATCACAAAATACCACATACTGG - Intergenic
1045155628 8:99466966-99466988 CATAACAAAGTACCATAAACTGG + Intronic
1045245404 8:100437857-100437879 CATAACTAACTACCACAAACTGG - Intergenic
1045270017 8:100653697-100653719 CATAACAAAGTGCCTCAAACTGG - Intronic
1045499361 8:102733056-102733078 CATAAGGAAGTGCCACAGACTGG - Intergenic
1045816226 8:106280274-106280296 CATAACAAACTACCACAAACTGG + Intronic
1045986696 8:108257365-108257387 CATAACCAACTACCACAGACTGG - Intronic
1046213925 8:111117148-111117170 CATAACAAATTACCACAAACTGG - Intergenic
1046661834 8:116955924-116955946 CATAACAAATTGCCACAAACTGG - Intronic
1046822896 8:118653511-118653533 CATAACAAAGTTCCACAAGCTGG + Intergenic
1047002295 8:120585073-120585095 CATAACAAAGTACCATAAACTGG - Intronic
1047009260 8:120653544-120653566 CATAACAAAGTACCACAAACTGG - Intronic
1047049007 8:121088644-121088666 CATGACCAAGTGCTACAAAATGG - Intergenic
1047224533 8:122945135-122945157 CATGACAAAATGCCACAGACTGG - Intronic
1047316937 8:123743155-123743177 CATAACAAAGTGTCACAAACTGG - Intergenic
1047723553 8:127665180-127665202 CATACCAAAGTACCACAAACTGG - Intergenic
1047749630 8:127870449-127870471 CATAACAAATTGCTACAAACTGG - Intergenic
1048117787 8:131544767-131544789 TATAACAAAATGCCACAAACAGG - Intergenic
1048230387 8:132634741-132634763 TATAACAAAGTGCCACAAACTGG - Intronic
1048267553 8:133000854-133000876 CATAACAAAGTACCACGAACTGG + Intronic
1048527285 8:135214639-135214661 CACAACAAAATGCCACAAACTGG - Intergenic
1048700616 8:137084628-137084650 CATCATCTAATGACACAAACCGG + Intergenic
1048905225 8:139081443-139081465 CTTAACAAAGTTCCACAAACTGG - Intergenic
1048945989 8:139447797-139447819 CATAACCAAATACCACAGACTGG + Intergenic
1049157885 8:141078055-141078077 CATGACCAAGCACCACAAGCTGG + Intergenic
1049285308 8:141771761-141771783 CATGGCAAAGTGCCACAGACTGG + Intergenic
1049924551 9:395976-395998 AGTCACCAATTGACACAAACTGG - Intronic
1050068700 9:1788000-1788022 CATAACAAAGTATCACAAACTGG + Intergenic
1050128288 9:2382463-2382485 CATAACACAGTACCACAAACTGG + Intergenic
1050139240 9:2500258-2500280 CATAACAAAGTATCACAAACTGG - Intergenic
1050197093 9:3096857-3096879 CTTCACCAAGTACCATATACTGG + Intergenic
1050206567 9:3202661-3202683 CATGATAAATTGCCACAAACTGG + Intergenic
1050272453 9:3960359-3960381 CATAACAAAGTACCACAAACTGG - Intronic
1050417114 9:5429392-5429414 CATAACAAAGGACCACAAACTGG + Intronic
1050683872 9:8145484-8145506 CATCACAAAGTACCACAAACTGG - Intergenic
1050921254 9:11203550-11203572 CATAAGAAAGTACCACAAACTGG - Intergenic
1051063403 9:13072437-13072459 CATAACCAAGTACCACAGATTGG + Intergenic
1051347439 9:16164892-16164914 TATGACAAAGTTCCACAAACTGG - Intergenic
1051600629 9:18869298-18869320 CATAATAAAGTACCACAAACTGG - Intronic
1052296002 9:26896419-26896441 CATAACAAAGTGCCACAAACTGG - Intergenic
1052409626 9:28106246-28106268 CATAACAAAATGCCACAGACTGG - Intronic
1052785041 9:32820531-32820553 CATCATCAAGTGCCCCACGCTGG + Intergenic
1053006130 9:34605868-34605890 CGTAACAAAGTGCCACAAACTGG - Intergenic
1053538251 9:38947241-38947263 CAACTGCAGGTGCCACAAACAGG - Intergenic
1053596352 9:39565873-39565895 CATAACAAAGTGCCACACACTGG + Intergenic
1053698063 9:40657049-40657071 CATAACCAAGTAACACAAACTGG + Intergenic
1053854319 9:42322513-42322535 CATAACAAAGTGCCACACACTGG + Intergenic
1053944072 9:43287257-43287279 CATAACCAAGTAACACAAACTGG + Intergenic
1054309354 9:63456457-63456479 CATAACCAAGTAACACAAACTGG + Intergenic
1054408150 9:64780579-64780601 CATAACCAAGTAACACAAACTGG + Intergenic
1054441296 9:65264405-65264427 CATAACCAAGTAACACAAACTGG + Intergenic
1054488981 9:65757084-65757106 CATAACCAAGTAACACAAACTGG - Intergenic
1054569904 9:66799145-66799167 CATAACAAAGAGCCACACACTGG - Intergenic
1054627883 9:67416678-67416700 CAACTGCAGGTGCCACAAACAGG + Intergenic
1054711185 9:68512392-68512414 TATAACAAAGTACCACAAACTGG + Intronic
1054732751 9:68717440-68717462 CATAACAAAGTGTCAAAAACTGG + Intronic
1055086485 9:72319493-72319515 CATAACAAAGTACCACAAACTGG + Intergenic
1055297508 9:74849610-74849632 CATAACAAAATACCACAAACTGG - Intronic
1055706398 9:79009863-79009885 CATAACAAAATACCACAAACTGG - Intergenic
1055887481 9:81081084-81081106 CATAGCAAAGTACCACAAACTGG + Intergenic
1055996561 9:82166647-82166669 CATAACAAAGTATCACAAACTGG - Intergenic
1056143461 9:83707279-83707301 CATCAGCCCGTCCCACAAACAGG + Intronic
1056501098 9:87210130-87210152 CATTTCCTAGTACCACAAACTGG - Intergenic
1057282613 9:93723617-93723639 CATGACAAAGTACCACAAACTGG + Intergenic
1057393177 9:94656011-94656033 CATAACCAAGCACCACAAATCGG - Intergenic
1057430088 9:94986046-94986068 CATAACTAAGTACCACAGACTGG + Intronic
1057528818 9:95826140-95826162 CATAACAAAATACCACAAACTGG - Intergenic
1057558552 9:96109072-96109094 CATAACAAAGTGTCACAAGCTGG - Intronic
1057796350 9:98160735-98160757 CATCACCAGCTGCCACAGACAGG - Intronic
1057835626 9:98442639-98442661 CATCACAAAGTACCACACACTGG + Intronic
1057855008 9:98595058-98595080 TATCACAAAATACCACAAACTGG + Intronic
1057857207 9:98610814-98610836 CAGAACAAATTGCCACAAACAGG - Intronic
1057895070 9:98902720-98902742 TATCACAGAGTGCCATAAACTGG - Intergenic
1058045935 9:100356600-100356622 CATAACAAAGTACCACAAACTGG + Intergenic
1058082751 9:100716811-100716833 CATAACAAAGTACAACAAACTGG + Intergenic
1058087854 9:100769673-100769695 CATAACAAAGTGCCACAGGCTGG + Intergenic
1058094002 9:100838141-100838163 CATAATAAAGTACCACAAACTGG - Intergenic
1058121548 9:101144664-101144686 CATCACAAAATGTCACAGACTGG - Intronic
1058369104 9:104244151-104244173 TATGACAAAGTACCACAAACTGG - Intergenic
1058390768 9:104492653-104492675 CATAACAAAGTACCACAAACTGG - Intergenic
1058766011 9:108183362-108183384 CAGGACAAAGTGCCACAAACTGG + Intergenic
1058981702 9:110176385-110176407 CTTCACCAAGGCCCACAAAATGG - Intergenic
1058986034 9:110208838-110208860 CATAACGAAATCCCACAAACTGG + Intergenic
1059162002 9:112043328-112043350 CATCACCCAGATCCATAAACTGG + Intronic
1059179435 9:112197990-112198012 CATAACAAAGTACCACAGACTGG - Intergenic
1059498814 9:114732843-114732865 CGTAACAAAGTGCCACAGACTGG - Intergenic
1060115924 9:120940682-120940704 GGTAACAAAGTGCCACAAACTGG + Intergenic
1060394997 9:123309893-123309915 CATAACAAAGTAGCACAAACTGG - Intergenic
1061322695 9:129841119-129841141 CATAACAAAGTACCACAGACTGG + Intronic
1061357564 9:130118217-130118239 CATCACCATGTGCCAGAAGCTGG - Intronic
1061674321 9:132207257-132207279 CATAACTAAGTACCACTAACTGG + Intronic
1062315407 9:135964737-135964759 TATAACAAATTGCCACAAACTGG + Intergenic
1062483086 9:136761584-136761606 CATCACAGAGTACCACAAATGGG - Intronic
1062737430 9:138145027-138145049 CGTAACAAAGTGCCACAAAATGG + Intergenic
1202780427 9_KI270717v1_random:30239-30261 CATAACCAAGTAACACAAACTGG + Intergenic
1203582097 Un_KI270746v1:17767-17789 CATAACCAAGTAACACAAACTGG - Intergenic
1203587207 Un_KI270747v1:15835-15857 CATAACCAAGTAACACAAACTGG + Intergenic
1203616130 Un_KI270749v1:66862-66884 CATAACCAACTAACACAAACTGG - Intergenic
1185779635 X:2833060-2833082 CATAACAAAGTCCCACAGACTGG + Intronic
1185827063 X:3261604-3261626 TATAACCAAATGCCATAAACTGG + Intergenic
1185845132 X:3430766-3430788 CATGACAAAGAGCCACAGACTGG - Intergenic
1185854692 X:3523360-3523382 CATCACAAATTACCACAGACTGG + Intergenic
1185880346 X:3734670-3734692 CTTCACCAAGTACCACAGGCTGG - Intergenic
1185922056 X:4104244-4104266 CATGGCAAAGTGCCACAAACTGG - Intergenic
1186057925 X:5671234-5671256 CATGACAAAGTACCACACACTGG - Intergenic
1186063606 X:5738131-5738153 CATAACAAAATGCCACAAACTGG + Intergenic
1186513691 X:10150166-10150188 CGTAACCAAGTCCCACAGACTGG + Intergenic
1186552620 X:10522457-10522479 CATAACAAATTACCACAAACTGG - Intronic
1186850549 X:13575594-13575616 CATAACAAAGTACCACAGACTGG - Intronic
1186907813 X:14130790-14130812 CTGTAACAAGTGCCACAAACAGG + Intergenic
1187294392 X:17984869-17984891 GATCACCATGTGCCACACACTGG + Intergenic
1187301754 X:18057731-18057753 TATAACAAAGTGCCACAGACTGG - Intergenic
1187329176 X:18320168-18320190 CATAACAAAGTACCACAGACTGG - Intronic
1187544241 X:20231927-20231949 CATAACAAATTACCACAAACTGG - Intronic
1187548238 X:20274542-20274564 CATAACAAAGTACCATAAACTGG - Intergenic
1187564355 X:20433777-20433799 CATCGCAAAGTATCACAAACTGG + Intergenic
1187928899 X:24276006-24276028 CATAACAAAATTCCACAAACTGG - Intergenic
1188027866 X:25229897-25229919 CATAACAAATTACCACAAACTGG - Intergenic
1188266373 X:28080854-28080876 CATAACAAAATGCCACTAACTGG - Intergenic
1188290640 X:28383596-28383618 CATAACAAAGTACCATAAACTGG + Intergenic
1188323867 X:28775176-28775198 CATAACAAATTACCACAAACAGG + Intronic
1188641156 X:32506718-32506740 AATCACAAAATACCACAAACTGG - Intronic
1189211794 X:39290084-39290106 CATAACAAAGTGCCACAGGCTGG + Intergenic
1189478357 X:41374625-41374647 CATAACCAAATGCCACAGACTGG - Intergenic
1189539593 X:41972048-41972070 CATAACAAAGTACCACAAACTGG + Intergenic
1189563299 X:42213374-42213396 CATAACAAAGTACCACAAACTGG + Intergenic
1189629854 X:42941516-42941538 CATAATAAAGTACCACAAACTGG + Intergenic
1189773565 X:44449886-44449908 TATAACAAAATGCCACAAACTGG - Intergenic
1190252013 X:48733999-48734021 CATGACAAAGTACCACAATCTGG - Intergenic
1191077647 X:56472495-56472517 CATAACAAACTACCACAAACTGG + Intergenic
1191734981 X:64379412-64379434 CATAACAAAGTACCAGAAACTGG + Intronic
1192757631 X:74063288-74063310 CATAACAAAGTACCACAGACTGG + Intergenic
1193473036 X:81929720-81929742 CATATCAAAGTGCAACAAACTGG + Intergenic
1193611621 X:83638818-83638840 CATAATGAAGTGCCACAAACTGG + Intergenic
1193645539 X:84064896-84064918 CATCAGCAAGTGGCACACAATGG + Intronic
1193773042 X:85610234-85610256 TATAACAAAGTACCACAAACTGG - Intergenic
1195540532 X:106057682-106057704 CATAACAAAGTTTCACAAACTGG + Intergenic
1196198446 X:112859269-112859291 CATAACTAAGTGAGACAAACTGG + Intergenic
1196640994 X:118060810-118060832 CATAATAAAGTACCACAAACTGG + Intronic
1196931403 X:120685160-120685182 CATCACCAAGGTCAAAAAACAGG - Intergenic
1197818987 X:130527625-130527647 CATGACAAAGTACCGCAAACTGG + Intergenic
1197830755 X:130639915-130639937 TATAACCAAATACCACAAACTGG + Intronic
1197832001 X:130652985-130653007 CATAACAAAGTACCACAAAGTGG - Intronic
1198173798 X:134134619-134134641 CATAACTAAGTACCACAAATTGG - Intergenic
1198176771 X:134164169-134164191 CATAACAAAGTACCAGAAACTGG - Intergenic
1198250526 X:134875299-134875321 CATAACACAGTGCCACAAACTGG + Intergenic
1198263050 X:134983586-134983608 CATAACAAAGTACCACAGACAGG + Intergenic
1198409578 X:136352817-136352839 CATAACAAAATGCCACAGACTGG + Intronic
1198438288 X:136638045-136638067 CATAACAAATTACCACAAACTGG + Intergenic
1198488126 X:137108720-137108742 CATAACTAAATGCCACAAACTGG - Intergenic
1198710043 X:139491545-139491567 CATAACAAAGTACCAAAAACTGG + Intergenic
1198803783 X:140473985-140474007 CATAACAAAGTACCACAAACTGG + Intergenic
1198852967 X:140985492-140985514 CATAACAAAGTACCACAAATTGG + Intergenic
1198928861 X:141830368-141830390 CATAACAAAGTACCATAAACTGG - Intergenic
1198952984 X:142093977-142093999 CCTAACAAAGTACCACAAACTGG - Intergenic
1199118446 X:144020969-144020991 CATAACAAATTACCACAAACTGG + Intergenic
1199460199 X:148075627-148075649 CATTAAAAAGTACCACAAACTGG - Intergenic
1199720405 X:150539432-150539454 CCTCACAAAGTACCACAAAGAGG - Intergenic
1199936165 X:152575696-152575718 CATAACGAAGTACCACAGACTGG + Intergenic
1200061063 X:153483966-153483988 CATCACTGAGTGCCACAAGCTGG + Intronic
1200139745 X:153893839-153893861 CATCACAAAATACCACAGACTGG - Intronic
1200284811 X:154810472-154810494 CATAACAAAATACCACAAACTGG + Intronic
1200358268 X:155575007-155575029 CATAAAAAAGTGCCACGAACTGG + Intronic
1200399586 X:156011242-156011264 CGTAACAAAGTGCCACAAAATGG + Intergenic
1200808823 Y:7461146-7461168 CATCACAAATTACCACAGACTGG - Intergenic
1200895375 Y:8370258-8370280 CATAGCCAAGTCCCCCAAACCGG + Intergenic
1201223800 Y:11796859-11796881 CATAACAAAGTACCACAACCTGG + Intergenic
1201242690 Y:11973893-11973915 CATGACAAAGTACCACTAACTGG + Intergenic
1201290405 Y:12416933-12416955 CATAACAAAGTCCCACAGACTGG - Intergenic