ID: 1151948079

View in Genome Browser
Species Human (GRCh38)
Location 17:77330224-77330246
Sequence GAGCAGCAGGTGCTCCAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 0, 2: 5, 3: 23, 4: 270}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151948079_1151948088 -4 Left 1151948079 17:77330224-77330246 CCCTCTTGGAGCACCTGCTGCTC 0: 1
1: 0
2: 5
3: 23
4: 270
Right 1151948088 17:77330243-77330265 GCTCCGGGTGCCTCTGGGGGCGG 0: 1
1: 0
2: 1
3: 26
4: 305
1151948079_1151948092 16 Left 1151948079 17:77330224-77330246 CCCTCTTGGAGCACCTGCTGCTC 0: 1
1: 0
2: 5
3: 23
4: 270
Right 1151948092 17:77330263-77330285 CGGGCCCCCACCTCACATTGTGG 0: 1
1: 0
2: 1
3: 7
4: 87
1151948079_1151948099 28 Left 1151948079 17:77330224-77330246 CCCTCTTGGAGCACCTGCTGCTC 0: 1
1: 0
2: 5
3: 23
4: 270
Right 1151948099 17:77330275-77330297 TCACATTGTGGAGCTGGTGTAGG 0: 1
1: 0
2: 1
3: 20
4: 207
1151948079_1151948087 -7 Left 1151948079 17:77330224-77330246 CCCTCTTGGAGCACCTGCTGCTC 0: 1
1: 0
2: 5
3: 23
4: 270
Right 1151948087 17:77330240-77330262 GCTGCTCCGGGTGCCTCTGGGGG 0: 1
1: 0
2: 1
3: 18
4: 270
1151948079_1151948085 -9 Left 1151948079 17:77330224-77330246 CCCTCTTGGAGCACCTGCTGCTC 0: 1
1: 0
2: 5
3: 23
4: 270
Right 1151948085 17:77330238-77330260 CTGCTGCTCCGGGTGCCTCTGGG 0: 1
1: 0
2: 1
3: 33
4: 395
1151948079_1151948089 -3 Left 1151948079 17:77330224-77330246 CCCTCTTGGAGCACCTGCTGCTC 0: 1
1: 0
2: 5
3: 23
4: 270
Right 1151948089 17:77330244-77330266 CTCCGGGTGCCTCTGGGGGCGGG 0: 1
1: 0
2: 0
3: 31
4: 276
1151948079_1151948096 22 Left 1151948079 17:77330224-77330246 CCCTCTTGGAGCACCTGCTGCTC 0: 1
1: 0
2: 5
3: 23
4: 270
Right 1151948096 17:77330269-77330291 CCCACCTCACATTGTGGAGCTGG 0: 1
1: 0
2: 1
3: 16
4: 172
1151948079_1151948084 -10 Left 1151948079 17:77330224-77330246 CCCTCTTGGAGCACCTGCTGCTC 0: 1
1: 0
2: 5
3: 23
4: 270
Right 1151948084 17:77330237-77330259 CCTGCTGCTCCGGGTGCCTCTGG 0: 1
1: 0
2: 3
3: 45
4: 353
1151948079_1151948086 -8 Left 1151948079 17:77330224-77330246 CCCTCTTGGAGCACCTGCTGCTC 0: 1
1: 0
2: 5
3: 23
4: 270
Right 1151948086 17:77330239-77330261 TGCTGCTCCGGGTGCCTCTGGGG 0: 1
1: 0
2: 2
3: 30
4: 358

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151948079 Original CRISPR GAGCAGCAGGTGCTCCAAGA GGG (reversed) Intronic
900390344 1:2431188-2431210 GAGCAGCAGGGGCCCCCAGGGGG - Intronic
901263746 1:7893371-7893393 GAGCAGCCGGGGCTCCAAGCAGG - Intergenic
901954947 1:12777319-12777341 GCGCAGCAGGTTCTCCAGGGCGG - Exonic
901984303 1:13061996-13062018 GACCAGCAGCTCCTCGAAGAAGG + Exonic
901997507 1:13164774-13164796 GACCAGCAGCTCCTCGAAGAAGG - Exonic
902327008 1:15707679-15707701 AAGCTGCAGCTGCTCCAGGAGGG - Intronic
902449641 1:16488728-16488750 GAGCAGCAGGCGCTCCAAGCAGG - Intergenic
902504841 1:16932614-16932636 GAGCAGCAGGCGCTCCAAGCAGG + Intronic
903858993 1:26354073-26354095 CAGCAGCAGGAGCTCCAGGCTGG - Exonic
904261232 1:29288931-29288953 GTGCCCCAGGTGCTCCCAGAGGG + Intronic
905974395 1:42164496-42164518 GAGCAGGAGCTCCTCGAAGAAGG + Intronic
906258018 1:44365522-44365544 GAGCAGCAGCAGTGCCAAGAAGG - Intergenic
907044173 1:51289610-51289632 GGACAGCAGGTGCCCCAAGAAGG - Intronic
907426758 1:54384612-54384634 TGGCAGCAAGTGCTCCAAGCTGG + Intronic
907847325 1:58220780-58220802 GTGCAGCAAGTGCTCGCAGAAGG + Intronic
908489354 1:64627526-64627548 GAGCATCATGAACTCCAAGAAGG - Intronic
908587922 1:65594217-65594239 GAGCAAAAGGTGCTCCAAGCAGG + Intronic
909519595 1:76551987-76552009 GAGCAGCAGCTGCTGCAGGTGGG + Intronic
910126289 1:83846272-83846294 GAGCAGCATGTGCTCTAATCTGG + Intergenic
910186036 1:84541487-84541509 AATTAGCAGGTGTTCCAAGATGG - Intergenic
911831896 1:102560789-102560811 GAGCAGCTTGTGTTCCAAGTAGG - Intergenic
913598045 1:120396379-120396401 GGGCAGCAGCAACTCCAAGAGGG + Intergenic
914089284 1:144482941-144482963 GGGCAGCAGCAACTCCAAGAGGG - Intergenic
914309327 1:146451274-146451296 GGGCAGCAGCAACTCCAAGAGGG + Intergenic
914592784 1:149121863-149121885 GGGCAGCAGCAACTCCAAGAGGG - Intergenic
914950303 1:152108181-152108203 GAGGAACAGCTGCTCCAGGAAGG - Exonic
915105612 1:153533556-153533578 GAGAAGGAGGGCCTCCAAGAAGG + Intergenic
915360809 1:155285383-155285405 GGTCAGCAGGTGCTCCTATAGGG + Intronic
918000164 1:180486268-180486290 GACCAGCAGGTGGTCCTAGCTGG - Intronic
918146085 1:181757152-181757174 GAGCAGCAGAGGCTCCAGAAAGG + Intronic
922164931 1:223107636-223107658 GAGCAGCAGGTGGGACAGGAGGG + Intergenic
922353984 1:224758985-224759007 TAGCTACAGATGCTCCAAGATGG - Intergenic
923258644 1:232245089-232245111 CAGTAGCAGGTGTTCCAGGAGGG + Intergenic
923517519 1:234709964-234709986 GAGCAACAGTTGCTCAGAGAAGG - Intergenic
924926079 1:248682225-248682247 GAGCTGCAGGTGCTGCACGCCGG - Exonic
1063050046 10:2437129-2437151 GAGCAACAGGTGCACCAGCATGG - Intergenic
1063981338 10:11454405-11454427 GAGGAGCAGGGGCTCCAGGAAGG - Intronic
1064010187 10:11729612-11729634 TAGCAGCAGCTGCTCCAGGTGGG - Intergenic
1064256142 10:13744137-13744159 GGCCAGCAGCTGCTCCAAGACGG - Intronic
1065565037 10:26999612-26999634 GAGCAGCAGTGGCTCCAATGAGG - Intronic
1065586790 10:27226580-27226602 GGGCAGCATGTGGCCCAAGACGG + Intronic
1067078224 10:43199992-43200014 AGGCAGCACCTGCTCCAAGATGG - Intronic
1067362622 10:45596273-45596295 TGGCAGCAGGTGTTCCATGAAGG + Intergenic
1069044059 10:63723946-63723968 CAGCTGCAGCTGCTCCAAGGAGG + Intergenic
1069375481 10:67788620-67788642 CAGCAGGGGGCGCTCCAAGATGG + Intergenic
1069916735 10:71791186-71791208 CAGCAGCAGCAGCTCCAGGATGG - Intronic
1070679093 10:78436258-78436280 GAGCAGGGGGTGCCCCGAGAAGG - Intergenic
1070801463 10:79246726-79246748 GAGCAGCAGCTGCCTCACGAGGG + Intronic
1071548399 10:86546395-86546417 GAGCTGAAGTTACTCCAAGATGG - Intergenic
1074668651 10:115761404-115761426 GATCAGCAGGTGGTCCAATGAGG - Intronic
1075046567 10:119150957-119150979 GAGCAACATGTGGTACAAGACGG + Intronic
1076279057 10:129229959-129229981 GAGCAGCAGGAGAGGCAAGAGGG - Intergenic
1076340174 10:129740185-129740207 ATGCATCAGGTGCTCCAAGTGGG + Intronic
1076355305 10:129848304-129848326 GGGCAGCAGGTGCTCTGGGAAGG - Intronic
1076686110 10:132199162-132199184 GAGCAGCTGCTGCTCCAGCAAGG - Intronic
1077170173 11:1162574-1162596 GAGCAGCAGCTACACCAAGGTGG + Exonic
1077451123 11:2646234-2646256 TATCAGCAGGGGCTTCAAGATGG - Intronic
1077465214 11:2730727-2730749 CTGCTGCAGGTGGTCCAAGAGGG + Intronic
1083667411 11:64283466-64283488 GAGAAGCACAGGCTCCAAGATGG - Intronic
1085280031 11:75324258-75324280 CAGCATCAGTTGCTCCATGAGGG + Intronic
1085394470 11:76200339-76200361 CAGCAACAGGTTCCCCAAGAAGG - Intronic
1088334680 11:108690577-108690599 GGGTATCAGGTGCTCCAAGGAGG - Intronic
1089090456 11:115870075-115870097 CAGCAGCAGCTGCTGCAAGTGGG + Intergenic
1089747008 11:120624489-120624511 TAGCTGTAGGTGCTCCTAGAGGG + Intronic
1090402429 11:126457840-126457862 GAGGAGCAGACGCTGCAAGATGG + Intronic
1091042621 11:132296214-132296236 GCTCAGCAGGTCCTCCAGGACGG + Intronic
1091057255 11:132430536-132430558 GAGTCACAGCTGCTCCAAGAGGG + Intronic
1095357065 12:41287604-41287626 GAGCAGAAGGTCCTAAAAGAAGG - Intronic
1095885892 12:47188060-47188082 GAACAGAAGGGACTCCAAGAAGG - Intronic
1096466180 12:51848661-51848683 CAGCAGCAGCGGCTCCAGGATGG - Intergenic
1097035582 12:56121561-56121583 GAGCAGCTGGAGCTCCAGCAGGG - Exonic
1097925664 12:65122922-65122944 GAGTAGCAGATGCCTCAAGAGGG + Intergenic
1098493098 12:71105085-71105107 GAGAAGCAAGTATTCCAAGAGGG - Intronic
1098963400 12:76762532-76762554 GAGCAGCAGTTACTCAAAGAGGG - Intergenic
1099143803 12:79013411-79013433 GGGCACCAGGAACTCCAAGAGGG + Intronic
1100576564 12:95897014-95897036 AAGCTGAAGCTGCTCCAAGATGG - Intronic
1101509130 12:105376981-105377003 CAGCAGAAGATGTTCCAAGAAGG + Intronic
1102463038 12:113112072-113112094 GAGCACCAGGTGCGCCAGGATGG - Exonic
1106292407 13:28376699-28376721 GCTGAGCAGGTGCTGCAAGAGGG - Intronic
1109591381 13:64488099-64488121 GTGGAGCAGGTTCTCCTAGAAGG + Intergenic
1110452242 13:75649608-75649630 GAGGGGCAGGTACTCCATGAAGG + Intronic
1112665129 13:101561313-101561335 GAGGAGCAGCTCCTCCAGGATGG + Intronic
1114582513 14:23775445-23775467 AAGCAGCAGGGCCTCCAAGCTGG + Intergenic
1119113484 14:71996837-71996859 GAGGAGCATGTGCTCCTTGAGGG + Intronic
1121239473 14:92418349-92418371 GAGCCACAGCTGCCCCAAGATGG - Intronic
1121421429 14:93818510-93818532 GAGGAGAAGGTACTTCAAGAAGG - Intergenic
1121940403 14:98064768-98064790 GAGCAGAGGCTGCCCCAAGAGGG - Intergenic
1122630517 14:103105610-103105632 GAGAAGGAGGTGTCCCAAGATGG - Intronic
1122931702 14:104936087-104936109 GAGCAGCAGGGGCCCCCACAGGG - Exonic
1124089047 15:26580344-26580366 GACCAGACGGTGCTCCACGATGG + Exonic
1125734068 15:41911543-41911565 GAGCAGCTGGTTCTCCCTGATGG - Intronic
1127568245 15:60214529-60214551 GAGCAGCAGATGCTCTAAGAGGG + Intergenic
1128706213 15:69839078-69839100 AAGCAGGAGGTGCTGCAAGCTGG + Intergenic
1128741375 15:70086107-70086129 AAGCAGCAGGTGATGCCAGATGG - Intronic
1128760532 15:70213547-70213569 GAGCAACAGGGGAACCAAGATGG - Intergenic
1128990765 15:72258050-72258072 GAGCAGCATGTCTTCCAAAATGG - Exonic
1129149616 15:73679883-73679905 GAGGAGCAGGTCCTCCAGGGAGG - Intergenic
1129652946 15:77504521-77504543 GAGAAGCAGGTGCTCCCCGCTGG + Intergenic
1129661517 15:77555506-77555528 GTGCTGCAGGTGCTCCAGGCAGG - Intergenic
1129844420 15:78761693-78761715 GAGCAGCTGGGGCTGCAGGAAGG + Intronic
1130417990 15:83712450-83712472 TAGCAGTAGGGACTCCAAGAAGG - Intronic
1132601058 16:773168-773190 GGGCAGCAGGTGCTGCAACAGGG + Exonic
1135976205 16:27110275-27110297 GAGAAGGAGCTGCTCCGAGAGGG + Intergenic
1135997260 16:27259986-27260008 GACCAGCAGGTGCTCCCTAAAGG + Intronic
1136235483 16:28911118-28911140 GAGCGGGACGAGCTCCAAGAGGG - Exonic
1136374309 16:29856286-29856308 GAGCACCAAGTGCTCCAGGGAGG - Intergenic
1136682805 16:31977829-31977851 GAGCAACAGGAGCCCCAGGAGGG - Intergenic
1136721087 16:32320155-32320177 AAGCAGCAGCTCCTCCAGGAAGG - Intergenic
1136783443 16:32921395-32921417 GAGCAACAGGAGCCCCAGGAGGG - Intergenic
1136839471 16:33526441-33526463 AAGCAGCAGCTCCTCCAGGAAGG - Intergenic
1136886344 16:33932454-33932476 GAGCAACAGGAGCCCCAGGAGGG + Intergenic
1137924769 16:52530125-52530147 GGGCAGCAGGGACTTCAAGAAGG + Intronic
1141095181 16:81158180-81158202 GAGCACCAGGTGCACCACGGGGG - Intergenic
1141986739 16:87585211-87585233 GAGCAGGAGGGGGTGCAAGAGGG + Intergenic
1142103357 16:88287490-88287512 GGGTAGCAGGTGCTACAAGGTGG - Intergenic
1203005345 16_KI270728v1_random:197615-197637 AAGCAGCAGCTCCTCCAGGAAGG + Intergenic
1203086094 16_KI270728v1_random:1185379-1185401 GAGCAACAGGAGCCCCAGGAGGG - Intergenic
1203136895 16_KI270728v1_random:1733736-1733758 AAGCAGCAGCTCCTCCAGGAAGG + Intergenic
1203149635 16_KI270728v1_random:1826726-1826748 AAGCAGCAGCTCCTCCAGGAAGG - Intergenic
1142994157 17:3751126-3751148 GGGAAGCAGGTGCTCTCAGATGG + Intronic
1144280912 17:13725691-13725713 GGACAGCAGGGGCTCCAGGAAGG + Intergenic
1146824932 17:36013751-36013773 GAACAGCGAGTGCTCCAAGCCGG - Exonic
1146903666 17:36604055-36604077 GAGCTGGAGGTGCCCCAAGCAGG + Intronic
1147331836 17:39703928-39703950 GAGCAGCTGGGGCTGCAAGCTGG + Intronic
1148052786 17:44777330-44777352 GGGCAGCAGGTTCTCCCAGGAGG + Intronic
1149172706 17:53831123-53831145 AATCAGCAAATGCTCCAAGAGGG + Intergenic
1150456605 17:65311425-65311447 GTGGAGCAGCTGCTTCAAGAGGG - Intergenic
1151273309 17:73013610-73013632 GGGCAGCAGGTGGCCCAGGACGG + Intronic
1151583396 17:74992958-74992980 AAGCTGCAGGGGCTCCATGAAGG + Intronic
1151948079 17:77330224-77330246 GAGCAGCAGGTGCTCCAAGAGGG - Intronic
1152216298 17:79034551-79034573 AAGGTGCAGTTGCTCCAAGATGG + Intronic
1154173768 18:12068403-12068425 GAGCAGCACGTACGCCAAGAGGG - Intergenic
1154389721 18:13925961-13925983 GAGCAGCATGTGCTCAGAGAGGG - Intergenic
1157581424 18:48776269-48776291 AAGCAGCTGGTGCACAAAGAGGG - Intronic
1160344817 18:78124054-78124076 GAGCCGCAGGGCCTCCAGGAAGG + Intergenic
1161975576 19:7606356-7606378 AAGCAGCTTGTGCTCCAAGCTGG - Exonic
1162367774 19:10259677-10259699 GAGCAGCTTGTCCTCCAGGAAGG - Exonic
1163631404 19:18419642-18419664 GAGCAGCATGTACGCCAAGGGGG + Exonic
1165026842 19:32968587-32968609 GTCCAGCAGGTCCTCCAAAAAGG + Intronic
1165831095 19:38730824-38730846 GAGCAGCAGGTGCGCCCATCCGG + Exonic
1165898112 19:39155466-39155488 GAGGAGCAGGTGCCTCAAGTGGG + Intronic
1166764453 19:45244637-45244659 GAGGAGGAGGGGCTCAAAGAGGG - Intronic
1168270117 19:55245313-55245335 GCGCAGCAGGAGGTCCATGATGG + Exonic
929128174 2:38539460-38539482 CAGCAGCAGGTGAGCCAAGGAGG + Intergenic
929130267 2:38561021-38561043 GGGCAGCAGGTCCTCCTAGAGGG - Intergenic
929792129 2:45031132-45031154 GAGCAGCTGGGGCACCAAGAAGG - Intergenic
932174420 2:69586415-69586437 GAGCTTCAGGAGCTCAAAGAGGG + Intronic
933372510 2:81433627-81433649 GAGCTGCATGTGACCCAAGATGG + Intergenic
937354440 2:121189220-121189242 GTGCAGCAGGTGCTGAGAGACGG + Intergenic
937976055 2:127582676-127582698 GGACAGCAGGTGGCCCAAGAAGG - Intronic
940454976 2:153885737-153885759 GAGCAGCTGCTGATCTAAGATGG - Intronic
940481872 2:154242800-154242822 GAGGAGCAGCTGCTTCAAAAGGG + Exonic
941159781 2:162023289-162023311 GAGCAGCAGGATCTCCAACAAGG - Intronic
942748269 2:179260939-179260961 CAACAGCAGTTTCTCCAAGATGG + Intronic
943595593 2:189851375-189851397 GCCCAGCAGGTGCTTTAAGAAGG + Intronic
944350927 2:198725561-198725583 TAGCTGCAAGTGCACCAAGAAGG - Intergenic
946766998 2:223050178-223050200 GGGCAGCAGGGACTCCAAGCAGG + Intergenic
947025636 2:225734881-225734903 GGGCAGCAGGTACTCCCTGAGGG + Intergenic
948151872 2:235751088-235751110 GAGCATGAGGTTCTGCAAGAGGG + Intronic
948164578 2:235851253-235851275 GAGCAGCAGGAGCGCCAGGTGGG - Intronic
948658542 2:239492031-239492053 GAGCAGCAGGTGCTCCAGGCTGG - Intergenic
1168818909 20:760540-760562 GATCAGCAGGTGGCCCAGGAGGG + Exonic
1168819911 20:765748-765770 GACCAGCAGGTGCATCAGGAAGG + Exonic
1170733444 20:18993437-18993459 GAGTGGCAGGTGCTTCCAGAAGG - Intergenic
1172136591 20:32690510-32690532 GGGCTGCAGGTGCTGCAACATGG + Intergenic
1172285426 20:33737069-33737091 GAGTGGCAGGTGCTGCCAGATGG + Intronic
1173219733 20:41122168-41122190 TAGCAGCAGGAGCTCAAGGAGGG - Intronic
1173288475 20:41693596-41693618 GAGCAGCAGCCGCTCCTCGAGGG - Intergenic
1174173129 20:48629252-48629274 CAGCAGCAGGTGGTCCTAGCAGG - Intronic
1174552191 20:51370018-51370040 GTGCAGTAGGTGCTCCCAGGAGG - Intergenic
1175037619 20:56015158-56015180 CAGCACCAGGTTCACCAAGACGG - Intergenic
1175098026 20:56557624-56557646 GAGTAGCTGGGACTCCAAGAGGG - Intergenic
1175167645 20:57056403-57056425 GAGCAGTAAGTGCCCCCAGAAGG - Intergenic
1175299082 20:57930170-57930192 GAGAAGCGGGTGCTTCAAGGTGG + Intergenic
1175521927 20:59607365-59607387 GAGCAGCAGGTGGACAAATAAGG - Intronic
1175689864 20:61057449-61057471 GAGCAACAGGGGTTCCTAGAGGG + Intergenic
1175789417 20:61732060-61732082 CTGCAGCAGGAGCTCCCAGAGGG - Intronic
1176242589 20:64081937-64081959 CAGCAGCAAGTGCTCCAAAGGGG - Intronic
1178878090 21:36427985-36428007 ATGCAGCAGGTGGTCCCAGAAGG + Intergenic
1179719597 21:43307645-43307667 GAGCAGCGTGTGCTCCAGGTGGG - Intergenic
1179990601 21:44946584-44946606 CAGGAGAAGGTGCTCCAAAATGG + Intronic
1180041461 21:45282366-45282388 CAGCAGCAGGGGCGCCACGATGG + Exonic
1182716926 22:32364407-32364429 GGGCAGCAGGTGCACCAGCAGGG + Intronic
1183443674 22:37838577-37838599 GTGCAGCAGCTGCTGGAAGATGG - Exonic
1185249832 22:49795327-49795349 GAGCAGCAGGTGCACCCTCAAGG + Intronic
949141478 3:638657-638679 GTTCTGCAGGTGCTCCAAAAAGG + Intergenic
949159167 3:859665-859687 GTGCAGCTGGAGATCCAAGAAGG - Intergenic
949867576 3:8559051-8559073 GAGGAGCAGGCCCTCCAAGCAGG + Intronic
950433206 3:12963360-12963382 GAGCAGCTGGGACCCCAAGAAGG + Intronic
951362161 3:21738175-21738197 GAGCAGCAGTTGTTTGAAGAAGG - Intronic
953026521 3:39148294-39148316 GACCAGCAGGTTCTCCCAGGAGG + Intronic
953347049 3:42184979-42185001 CAGCAGCAGGAGCTGCAGGAAGG - Intronic
953920841 3:46950139-46950161 GAGCATCAGGTTCCCTAAGAGGG - Intronic
958078215 3:88711779-88711801 GAGGAGCAGGTGGAGCAAGATGG + Intergenic
960959400 3:123058721-123058743 GAGCAGCCCGTCCTCCAGGAGGG - Intergenic
961667717 3:128504106-128504128 CATCAGGAGGTGGTCCAAGAAGG - Intergenic
962414250 3:135168060-135168082 CAGCAGCAGCTGCACCATGAAGG + Intronic
963905377 3:150769583-150769605 GAGGATCTAGTGCTCCAAGAGGG + Intergenic
965760246 3:172068088-172068110 GAGCAGCAGGGGCTACAGAATGG - Intronic
968556113 4:1247339-1247361 TGGAAGCAGGTGCTCAAAGATGG + Intronic
968646558 4:1744060-1744082 GAGCGGAAGGTGCCCCCAGAGGG + Intronic
968807644 4:2786242-2786264 GCACAGCAGGTACTCCAGGAGGG + Intergenic
968835232 4:2958923-2958945 GAGCAGAAGATGCTCCAGCAGGG + Intronic
969315039 4:6376943-6376965 GAACAGCAGGTGCCCAGAGAGGG + Intronic
971980854 4:33747914-33747936 GAGCAGCAGGTTCTCTCAAAGGG + Intergenic
973635908 4:52862106-52862128 GAGCAGCGGGTGGTCCGAGGCGG - Intergenic
977283007 4:95066031-95066053 GAACAGCAGCTGTCCCAAGAAGG - Intronic
978109469 4:104945238-104945260 GGGGATAAGGTGCTCCAAGAAGG - Intergenic
981580311 4:146243638-146243660 GAGCAGCAGGGCCTTCCAGAAGG + Intergenic
985514813 5:336124-336146 GAGAAGGAAGTGCTCCAGGAGGG - Intronic
985648392 5:1095823-1095845 GGGCAGCACGTGCTCCCAGTAGG + Intronic
986014928 5:3749279-3749301 AGGAAGCAGATGCTCCAAGAAGG - Intergenic
986579951 5:9255551-9255573 GGGCAGAAGGTGGTCCCAGAAGG - Intronic
993941272 5:94062271-94062293 GAGGGGGAGGTGCTTCAAGAAGG + Intronic
994025799 5:95081602-95081624 GAGCAGCAAGTGCTCCGTGCAGG - Intronic
995043292 5:107614586-107614608 GAGTTGCAGGTACTCAAAGATGG - Intronic
995235103 5:109820033-109820055 GAGCAGCAAGTGGTCAATGAAGG - Intronic
997215205 5:132104195-132104217 GAGATGCAGATGCTCCAAGGAGG - Intergenic
997594863 5:135100401-135100423 AAGAAGCTGATGCTCCAAGATGG + Intronic
997868309 5:137484203-137484225 CAGGAGCAGATGCTCCAAGCTGG - Intronic
998078350 5:139254723-139254745 TGGCAGCATGTTCTCCAAGAAGG - Intronic
999053603 5:148550169-148550191 CACCAGCAGGTTCCCCAAGATGG + Exonic
1000138654 5:158380410-158380432 GAGCGGCAGGTGCTTCCACATGG + Intergenic
1001960786 5:175879284-175879306 GCGTAGTAGGTACTCCAAGAGGG + Intronic
1002198267 5:177512817-177512839 GAGCAGCAGGTACTCGTGGATGG + Exonic
1003105526 6:3212095-3212117 GAGAAGCATGAGCTCCATGAAGG + Intergenic
1003171224 6:3723439-3723461 GAGCAGCAGGGGCTCCTAGTGGG - Exonic
1003322355 6:5063321-5063343 GAGCACCAGGTCCTCCCTGAGGG - Intergenic
1004067626 6:12264689-12264711 GGGCAGCATGTGGTCCAGGATGG - Intergenic
1006358650 6:33575342-33575364 GGGCTGCAGGTGCTGCAACATGG + Exonic
1007068687 6:39018797-39018819 TAGTGGCAGGTGCTCCAAGAGGG + Intronic
1007252255 6:40503762-40503784 GGGAAGCAGGTGCTCCTGGAAGG + Intronic
1007412703 6:41674180-41674202 GCCAAGCAGGTGCTCCACGAGGG + Intergenic
1008044225 6:46835329-46835351 GAGCAGCAGGTCTCCGAAGAAGG + Exonic
1008251092 6:49240629-49240651 TGGCAACAGGTCCTCCAAGATGG - Intergenic
1010016405 6:71109563-71109585 TAGAACCAGGTTCTCCAAGATGG + Intergenic
1013610242 6:111787984-111788006 GAACAGCAAGTGCTCTGAGAAGG - Intronic
1015985843 6:138883393-138883415 GAGCAGCAAGTGGTACATGAGGG - Intronic
1016021692 6:139242780-139242802 GATCAGCCTGTGCTCCAACAGGG + Exonic
1016703049 6:147075705-147075727 GTGCAGTATGTGCACCAAGATGG - Intergenic
1016936910 6:149454579-149454601 GAGCAGGAGCTGTGCCAAGAGGG + Intronic
1018273330 6:162103894-162103916 GAGCATAAGATGCTCCGAGAGGG + Intronic
1018351278 6:162961861-162961883 CAGCCTCAGGTGCTCCAAGAAGG - Intronic
1019337588 7:492628-492650 GAGCAGCAGGGGCTCTAGGAGGG + Intergenic
1021973595 7:25989269-25989291 GAGCAGCAGCTGCTCCTTGCTGG + Intergenic
1022530216 7:31062315-31062337 GAGCTGCAGGAGCTCCAAGGGGG - Intronic
1022838114 7:34136152-34136174 GAGCAGCAGGAGCTCCCTGCTGG + Intronic
1023385186 7:39649585-39649607 GACCATCATCTGCTCCAAGATGG - Intronic
1023981755 7:45074500-45074522 GTGCAGCAGGGGCTCCATCAGGG + Intronic
1024020342 7:45362643-45362665 GAGAAGCAGATGCTGCAAGGAGG + Intergenic
1024933750 7:54691085-54691107 GTGCAGCAGGAGCTCAAAGGCGG + Intergenic
1025302035 7:57825845-57825867 GAGCAGTGGGTGCTGCACGAGGG + Intergenic
1027200318 7:76060082-76060104 GAGCAGAAGGTGATCCATGGAGG + Intronic
1028607836 7:92674290-92674312 TAGCAGCTGGTGCTGCAACAGGG - Intronic
1030162533 7:106523801-106523823 CAGCAGCAGGTGCTCCACTGAGG + Intergenic
1031717917 7:125131907-125131929 GAGCAGGAGGTACTCAAGGAAGG + Intergenic
1032013133 7:128359796-128359818 CAGCAGCAGGTCCCCGAAGATGG + Exonic
1032429610 7:131849970-131849992 TGGCTGCAGGTGTTCCAAGAAGG - Intergenic
1032777897 7:135134088-135134110 GGGAAGCAGGTACTACAAGAGGG + Intronic
1033222232 7:139535837-139535859 AAGCAGCAGGAGATTCAAGATGG + Intronic
1034489417 7:151385419-151385441 GGGCAGCCAGTGCTCCAACAGGG + Intronic
1035317520 7:158006092-158006114 GGGCAGCAGGTGCCCCAAGAAGG - Intronic
1035470776 7:159107363-159107385 GAACAGCAGCTGCTCACAGAAGG + Intronic
1036591829 8:10175154-10175176 GAGTGCCAGGTGCTCCAAGATGG - Intronic
1037977738 8:23225150-23225172 GAGCCGCAGGTGCCCCGAAAAGG - Intergenic
1038603679 8:28975923-28975945 GAGTAGCAGGTCCTTAAAGAAGG + Intronic
1040388053 8:46927022-46927044 GAGCAGCAGGTTCTTAGAGAAGG - Intergenic
1041154778 8:54973863-54973885 TAACATCAGGTGCTCCCAGATGG - Intergenic
1041952516 8:63519562-63519584 AAGCAGCATGTGCTCCTAAAGGG + Intergenic
1042080064 8:65041859-65041881 GGGCAGCAGGAGCTCAGAGAAGG - Intergenic
1045742361 8:105376200-105376222 GAGAAGAACGTGCTTCAAGAAGG - Intronic
1045843551 8:106606840-106606862 TAGTAGCAGGTACTCCAACAAGG - Intronic
1047026424 8:120829540-120829562 GAGCTGCAGTTGCTGCTAGAAGG + Intergenic
1049169737 8:141152112-141152134 CTGCAGCAGGTGCTCATAGATGG + Intronic
1053079910 9:35166967-35166989 GAGCTGCATGTGGCCCAAGACGG + Intronic
1053653373 9:40191662-40191684 GAGCAGCAGGTCTCCAAAGAAGG - Intergenic
1054531211 9:66184556-66184578 GAGCAGCAGGTCTCCAAAGAAGG + Intergenic
1054788239 9:69230194-69230216 GAGCAGGAGGGCCTTCAAGAAGG + Exonic
1054920210 9:70536033-70536055 GAGAAGCAAGTCCTCCAAGCCGG - Exonic
1056791078 9:89625721-89625743 GAGAAGCCGGTGGTCCAGGATGG + Intergenic
1057225398 9:93290268-93290290 GAGCTGCATGTGGCCCAAGACGG + Intronic
1057397001 9:94689379-94689401 GAGCAGCAGGTGCTTGCAGCAGG - Intergenic
1058812751 9:108657065-108657087 GAGCAGCAGGAATTCCAAAAAGG + Intergenic
1058815258 9:108676902-108676924 GAGCAGCAGGTGTTCAAGAAAGG - Intergenic
1059448910 9:114357806-114357828 GAGCAGCAAGTATTCCAAGAAGG + Intronic
1059812135 9:117867199-117867221 GGGCAGCAGGTGGTAGAAGATGG + Intergenic
1062049702 9:134440905-134440927 GGGCAGGAGGTGCACCCAGAGGG + Intergenic
1190396351 X:49989028-49989050 GAGCAGCAGGAGTTCAAGGAAGG - Intronic
1192191468 X:68993932-68993954 AATCAGCATGTGCTCCTAGATGG - Intergenic
1193636966 X:83962923-83962945 GAGCTGTGGCTGCTCCAAGAGGG + Intergenic
1198286173 X:135194359-135194381 CAGCAGCAGGGGCTCCCAGAAGG - Intergenic
1198300743 X:135332117-135332139 GAGCAGCAGGTAGGCCAAGAAGG + Intronic
1198508222 X:137322848-137322870 AATCAGCAGGGGCACCAAGATGG - Intergenic
1200873854 Y:8131726-8131748 GAGCTGCTGTTGCTCCAAGAAGG - Intergenic
1201781826 Y:17731404-17731426 GAGCAGCAGTGGCTGCCAGAGGG + Intergenic
1201819727 Y:18174586-18174608 GAGCAGCAGTGGCTGCCAGAGGG - Intergenic
1202070182 Y:20984119-20984141 AAGCATCAGGTTCTCCAAGGAGG - Intergenic
1202176015 Y:22099508-22099530 GAGGAGAAGGTGTTTCAAGATGG + Intergenic
1202215346 Y:22486876-22486898 GAGGAGAAGGTGTTTCAAGATGG - Intergenic