ID: 1151948369

View in Genome Browser
Species Human (GRCh38)
Location 17:77331712-77331734
Sequence GTGGAGTGCAGAGAATGCAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 284}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151948362_1151948369 10 Left 1151948362 17:77331679-77331701 CCAACTGTGACTGCTCACTGCGG 0: 1
1: 0
2: 1
3: 5
4: 115
Right 1151948369 17:77331712-77331734 GTGGAGTGCAGAGAATGCACCGG 0: 1
1: 0
2: 2
3: 19
4: 284
1151948361_1151948369 13 Left 1151948361 17:77331676-77331698 CCGCCAACTGTGACTGCTCACTG 0: 1
1: 0
2: 2
3: 13
4: 158
Right 1151948369 17:77331712-77331734 GTGGAGTGCAGAGAATGCACCGG 0: 1
1: 0
2: 2
3: 19
4: 284
1151948360_1151948369 27 Left 1151948360 17:77331662-77331684 CCTGGGTGTAGTTTCCGCCAACT 0: 1
1: 0
2: 0
3: 0
4: 38
Right 1151948369 17:77331712-77331734 GTGGAGTGCAGAGAATGCACCGG 0: 1
1: 0
2: 2
3: 19
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151948369 Original CRISPR GTGGAGTGCAGAGAATGCAC CGG Intronic
900149823 1:1173511-1173533 GTGAAGCACAGAGAATGCTCAGG + Intergenic
903115711 1:21176819-21176841 GTTGAGTGAAGAAAATCCACCGG - Exonic
903136161 1:21310614-21310636 GCAGAGTGCAGTGAAAGCACAGG - Intronic
903953306 1:27009036-27009058 GTGGAATGCAGTGAATGCAGTGG + Intronic
904249461 1:29212722-29212744 GTGCAATGCAGAGAATGGTCTGG - Intronic
904970861 1:34418468-34418490 GTGGAGAGAAGAGAATGGGCTGG - Intergenic
905198043 1:36296473-36296495 GAGGGGTGCAGAGGAAGCACTGG - Intronic
905676621 1:39830429-39830451 GTGCAATGCAGAGAATGGATTGG - Intergenic
905690145 1:39936937-39936959 GAGGAGTGGAGAGAAGGGACAGG + Intergenic
906251259 1:44312623-44312645 GTCGGGTGCAGAGGCTGCACTGG - Intronic
907531185 1:55099087-55099109 GTGCAGAGCAGAGAGTGCTCTGG - Intronic
907795605 1:57713514-57713536 GTGGAGTGCATGGAAGGCAAAGG + Intronic
907954509 1:59215382-59215404 GTGGAAGGCAGAGAACGCAACGG + Intergenic
908833601 1:68206468-68206490 GGTGAGTGCAAAGAATGCAGAGG + Intronic
911633914 1:100212987-100213009 GTGCAGTGTAGAGAAAGGACTGG + Intronic
913327345 1:117638445-117638467 GCTGAGTGCAGAGAAAGCCCAGG - Intergenic
914979222 1:152398230-152398252 GTGAAATGCAGAGAAGACACTGG - Intergenic
915567444 1:156723518-156723540 GAGGAGTACAGAGAGTACACTGG - Intronic
917599385 1:176559316-176559338 GTTGAGGGCAGGGAATGCCCAGG + Intronic
918082718 1:181220149-181220171 GTGGAGGGCAGAGACTGCTGGGG - Intergenic
918218605 1:182415474-182415496 GTGGGCTGCAGAGAGTGCACAGG - Intergenic
919546808 1:198932947-198932969 GCACTGTGCAGAGAATGCACAGG - Intergenic
919805240 1:201377573-201377595 GAGGAGAGCAGAGAATGGACGGG - Intronic
921099439 1:211915677-211915699 GGGGAGTGAAGAGAGTGCAAGGG - Intergenic
921167561 1:212517868-212517890 GTGGAGTGAAGAGAAGAGACAGG - Intergenic
923146092 1:231199230-231199252 GTGGAGCACAGAGTAGGCACTGG + Intronic
923303874 1:232670382-232670404 GTGTTGTGCTGAGAATGGACAGG - Intergenic
923360490 1:233206215-233206237 GTGGAGTGCAGAGAGAGAAAAGG + Intronic
923448122 1:234091535-234091557 GAGCAGGGCAGAGAATGCACTGG - Intronic
924942843 1:248824541-248824563 ATGGAGTGCAGAGAAAGGCCTGG - Intronic
1062791797 10:311428-311450 GTTGAGTGCAGAGATTGGCCGGG - Intronic
1063750679 10:8943053-8943075 GTGGAGTCCAAACAATGCAGTGG + Intergenic
1063913189 10:10853429-10853451 GGGGAATTCAGAGAATCCACTGG + Intergenic
1064119126 10:12604039-12604061 TCGGAGTCCAGAGAAGGCACAGG - Intronic
1067184436 10:44014985-44015007 GCGGAGTGGGGAGAATTCACAGG - Intergenic
1068634920 10:59338240-59338262 GTGGAGTCCTTAGCATGCACTGG - Intronic
1069305612 10:66965156-66965178 GTGGAAGGCAGACAATGCCCTGG + Intronic
1070278129 10:75027353-75027375 GTGGACAGCAGAGTAAGCACTGG - Intronic
1070302572 10:75214951-75214973 CTGGAGTGCAGTGAGTGCAGTGG + Intronic
1070627493 10:78061705-78061727 GTGGAGGTCAGAGGATGCGCCGG - Intergenic
1070712376 10:78692061-78692083 CTGTAGGGCAGAGAATGCAGAGG - Intergenic
1070844929 10:79513911-79513933 GTGAGGTGCAGAGGATGCAATGG + Exonic
1070928874 10:80246398-80246420 GTGAGGTGCAGAGGATGCAATGG - Intergenic
1071571916 10:86701825-86701847 TTGGAATGGAGAGAATGCAGAGG + Intronic
1072706748 10:97686712-97686734 GTGGAGTGCAGAGGGTACAGAGG - Intronic
1073215462 10:101833814-101833836 GAGGTGTGGAGAGGATGCACAGG + Intronic
1074823991 10:117201762-117201784 CTGGAGGGCAGAGAATGATCAGG + Intronic
1075721499 10:124590228-124590250 GTGGGGTGCGGAGCAGGCACTGG + Intronic
1076016764 10:127034074-127034096 GGGGAAGGGAGAGAATGCACAGG + Intronic
1076573101 10:131445333-131445355 GCAGAGTGTGGAGAATGCACAGG + Intergenic
1077109566 11:856114-856136 GGGCAGAGCAGAGAATGCATGGG + Intronic
1077502880 11:2917161-2917183 GTGGAGGGCAGAGGATGGTCAGG + Intronic
1077515334 11:2998404-2998426 GTGGAGGGGAGTGACTGCACAGG - Intergenic
1079094788 11:17503196-17503218 AGGGGGTGCAGTGAATGCACAGG + Intronic
1079266309 11:18936439-18936461 CTGGAATCCCGAGAATGCACAGG + Intronic
1080116127 11:28623195-28623217 GTGCAGTGTAGAGACTGGACTGG + Intergenic
1081216340 11:40403904-40403926 GTGGAGTGAAAAAATTGCACTGG - Intronic
1084429709 11:69104423-69104445 GTGCAGTGCAGAGAAATAACGGG - Intergenic
1086971229 11:93083245-93083267 GTGGAGTAAAGAGAACGTACCGG - Intergenic
1088934614 11:114387056-114387078 GTGAAGTGCAGAGGATGTAAAGG + Intergenic
1089435376 11:118460704-118460726 CTGGAGTGCAGTGGATTCACAGG + Intronic
1089614924 11:119689858-119689880 GTGGAGGGAAGAGATTGCTCTGG - Intronic
1089794480 11:120969309-120969331 GTGGATTGGATAGAATGAACTGG + Intronic
1090397775 11:126430588-126430610 TCGGAGTGCAGAAAATGCAAGGG + Intronic
1091334663 11:134757427-134757449 GGGGGGTGCAGAGAAAGAACTGG + Intergenic
1092073744 12:5655797-5655819 GTGGAGTACAAGGAAGGCACTGG - Intronic
1094161214 12:27392996-27393018 GTGGAGGGGAGAGAATACAGAGG - Intronic
1095513648 12:42981418-42981440 GTTGAGTGAATAGAATGCAGTGG + Intergenic
1095817109 12:46435862-46435884 GTGGAGTGCAGAGAATTTTTAGG + Intergenic
1096257283 12:50071162-50071184 ATGGAGTCCAGGGAAGGCACAGG + Intronic
1096279537 12:50240388-50240410 CTGGAGTGTGGAGAATGGACTGG + Intronic
1097119818 12:56722718-56722740 TTGGAGTGGCGAGAATACACTGG + Intronic
1098538902 12:71629203-71629225 CTGGAGTGCAGTGAGTGCAGTGG + Intronic
1098886242 12:75963511-75963533 GTGGAGTGGAGAGTCTGGACAGG - Intergenic
1100137464 12:91571212-91571234 GTGAAGATCAGAGAAAGCACAGG + Intergenic
1103513064 12:121488569-121488591 GAGTAGTGCAGAGAATGACCTGG + Intronic
1103813376 12:123633704-123633726 GTGGAGTGCGGGGAGTGCGCCGG - Exonic
1105028668 12:132867560-132867582 GTGGAGTGCACAGAAGGCCCTGG + Intronic
1105830799 13:24161492-24161514 GTGGACTGCAGGGAATGCATTGG + Intronic
1108988193 13:56621983-56622005 GGGGAGGGCAGAGAAAACACTGG + Intergenic
1110509572 13:76333658-76333680 GTGGAGTGCTGTGACTGCAGGGG + Intergenic
1112367844 13:98771025-98771047 GTGGAATGCAGGGGATTCACTGG - Intergenic
1112562824 13:100529073-100529095 GTGAGGTGAACAGAATGCACAGG - Intronic
1113787719 13:113011398-113011420 GTGCAGTGCAGATGATGGACAGG + Intronic
1113997004 14:16097033-16097055 GTGGAGTGAATGGAATGCAATGG - Intergenic
1114444160 14:22775445-22775467 TTGAAGAGCAGAGAAGGCACTGG + Exonic
1114811970 14:25911542-25911564 ATGGGGTGCTGAGAAGGCACAGG - Intergenic
1117087897 14:52220346-52220368 CTGGAGTGCATGGAATGCAGTGG + Intergenic
1117513839 14:56480713-56480735 GTGAAGTCCAGGGAATGGACAGG - Intergenic
1118262339 14:64259369-64259391 CTGGAGGGCAGCGACTGCACTGG - Intronic
1119041222 14:71276474-71276496 TTGGATTGCACAGAATGCATGGG - Intergenic
1123923526 15:25087442-25087464 GTGAAGTGCAGAGGAAACACAGG - Intergenic
1123942511 15:25223438-25223460 GAGGAGCGCAAAGAAAGCACTGG - Intergenic
1124360280 15:29031912-29031934 GTGAAGTGCAGGCCATGCACAGG + Intronic
1124456328 15:29846116-29846138 GTGCAGTGTAGAGAATGCATTGG - Intronic
1124627858 15:31319407-31319429 GTGGAGAGGAGAGATTTCACTGG + Intergenic
1127163124 15:56212594-56212616 GTTGAGGGCAGAGAATGTATGGG + Intronic
1129770874 15:78202696-78202718 GTGCAGTGCAGAACATGAACTGG + Intronic
1130050990 15:80483586-80483608 GTGGAGAGCAGAGGATGTATGGG - Intronic
1130151636 15:81315814-81315836 GTGGAGTGCAGACGATGCTAAGG + Intronic
1131266678 15:90919610-90919632 GTGGAGAGCAGAGAAGGGGCAGG - Intronic
1132322408 15:100935637-100935659 GTGGGAGGAAGAGAATGCACTGG + Intronic
1132918524 16:2368928-2368950 GTGAAGGACAGAGGATGCACAGG - Intergenic
1134166175 16:11931547-11931569 GTGAGGTGCTGAGAATGCAATGG + Intronic
1135311565 16:21408972-21408994 GTGTGGTGCTGAGAATGCAATGG + Intronic
1135364517 16:21841424-21841446 GTGTGGTGCTGAGAATGCAATGG + Intronic
1135447326 16:22529925-22529947 GTGTGGTGCTGAGAATGCAATGG - Intronic
1135913028 16:26578604-26578626 GTGGAGTGGAGAGAAGGCAGTGG + Intergenic
1136150728 16:28346881-28346903 GTGTGGTGCTGAGAATGCAATGG + Intronic
1136166965 16:28460719-28460741 GTGTGGTGCTGAGAATGCAATGG + Intronic
1136196011 16:28654313-28654335 GTGTGGTGCTGAGAATGCAATGG - Intronic
1136212349 16:28768436-28768458 GTGTGGTGCTGAGAATGCAATGG - Intronic
1136257070 16:29048348-29048370 GTGTGGTGCTGAGAATGCAATGG - Intronic
1136308270 16:29387968-29387990 GTGTGGTGCTGAGAATGCAATGG + Intronic
1136321687 16:29489506-29489528 GTGTGGTGCTGAGAATGCAATGG + Intronic
1136436367 16:30229476-30229498 GTGTGGTGCTGAGAATGCAATGG + Intronic
1137390440 16:48076733-48076755 GTGAAGTGAAGAGATTGGACTGG + Intergenic
1138023813 16:53506492-53506514 GGGGATTGAAGAGAATGAACTGG - Intergenic
1138270834 16:55694812-55694834 GTGGAGTGGACTGCATGCACTGG + Intronic
1139196111 16:64920461-64920483 CTGCAGTGGAAAGAATGCACTGG - Intergenic
1139514713 16:67446284-67446306 GGGGAGTGCAGAGCAAGCAGGGG - Intronic
1139855967 16:69980396-69980418 GTGAGGTGCTGAGAATGCAATGG + Intergenic
1140366761 16:74387683-74387705 GTGTGGTGCTGAGAATGCAATGG - Intronic
1140485383 16:75289252-75289274 GTGGAGTCCAGAGACTCCCCTGG - Intergenic
1141788408 16:86216943-86216965 GTGGATTGCTGAGAAGGCAGAGG - Intergenic
1143064462 17:4234551-4234573 CTGGAATGCAGTGAATGCAGTGG + Intronic
1144191474 17:12850575-12850597 GTGGAGTGGAGAGAGGGCCCAGG + Intronic
1147602214 17:41753797-41753819 GTGGAGTAGAAAGAAGGCACTGG + Intergenic
1148530628 17:48387338-48387360 GTGGAGGGAAGAGAGTGCACAGG - Intronic
1149516919 17:57287829-57287851 AAGGAGTGCAAGGAATGCACTGG + Intronic
1151660037 17:75514268-75514290 GTGGAGTGCAGAGGATGAGCAGG + Intronic
1151948369 17:77331712-77331734 GTGGAGTGCAGAGAATGCACCGG + Intronic
1152468895 17:80480129-80480151 GGGGAGTGTAGAGAAGGCAAAGG + Intergenic
1152631762 17:81413705-81413727 CTGGAGTGCAGGGAAGCCACAGG - Intronic
1153561539 18:6376191-6376213 GTGGGCTGCAGTGAGTGCACAGG - Intronic
1154117437 18:11623604-11623626 GTGAGGTGCTGAGAATGCAATGG + Intergenic
1154312002 18:13274049-13274071 GAGGAGAGAAGAGAAGGCACTGG - Intronic
1155025201 18:21934726-21934748 GGGGAGGGCAGAGAGTCCACAGG - Intergenic
1155435361 18:25807104-25807126 CTGGAGTGCAGGGAGTGCAGTGG + Intergenic
1155904435 18:31432130-31432152 GTGGGATGCAGAGAAAGCAGTGG + Intergenic
1157082086 18:44536243-44536265 GTGGAGTGCCAAGACTGGACTGG - Intergenic
1160032475 18:75274384-75274406 GTGTAGTGGAGAAAATGCAGAGG + Intronic
1160509290 18:79444353-79444375 GTGCAGTGCAGAGAAGGAACGGG - Intronic
1164949300 19:32322970-32322992 GTGGTGTGCAGACATTGGACTGG - Intergenic
1165373019 19:35421687-35421709 CTGTAGTGCAGAAAGTGCACAGG - Intergenic
1165739902 19:38198915-38198937 CTGGAGTGCAGTGAGTGCAGTGG - Intronic
1165905098 19:39188955-39188977 GTGGGGTGAAGAGAATGAAGGGG - Intergenic
926742487 2:16124441-16124463 CAGGACTGCAGAGCATGCACAGG - Intergenic
927240259 2:20914747-20914769 GTGGAGGGCAATGAATGCCCTGG + Intergenic
927639430 2:24837376-24837398 GTTGAGTGCAGGGAAGACACTGG + Intronic
927842816 2:26456206-26456228 GAAGACTGCAGAGAATGGACGGG + Intronic
928976097 2:37087954-37087976 ATGGGGTGCAGAGAATGGACTGG + Intronic
929021739 2:37560301-37560323 GAGGAGGACAGAGAATGCATTGG - Intergenic
929083949 2:38149128-38149150 GTGGACTTCAGAGGCTGCACGGG - Intergenic
929119797 2:38475233-38475255 GAGGAGGGCAGGGAATGCAGAGG + Intergenic
930216290 2:48700763-48700785 GTTGAGAGCAGAGAAAGCAGTGG + Intronic
931054888 2:58458435-58458457 CTGGAGTGCAGTGAGTGCAGTGG + Intergenic
932075018 2:68654756-68654778 CTGGAGTGCAGTGAGTGCAGTGG - Intronic
932653715 2:73588263-73588285 CTGGACTGCAGAGACTGCAGGGG - Intronic
932775353 2:74525172-74525194 GTGGTGTGCAGAGTTTGCGCTGG - Exonic
933587906 2:84200177-84200199 ATGGGGTGGAGAGAATGGACAGG + Intergenic
934564105 2:95328968-95328990 GGGGAGGGCAGAGAATGGATGGG + Intronic
935593667 2:104863566-104863588 GTGGATTTCAGAGAAAGCCCGGG - Intergenic
935836014 2:107054379-107054401 GAGGATTGGAGAGAATTCACTGG + Intergenic
936236704 2:110748335-110748357 GTGGAGTGCCCAGGATGCAGGGG + Intronic
937321056 2:120960996-120961018 CTGGAGAGCGGAGAATTCACTGG + Intronic
938071364 2:128310189-128310211 GTGGAGGGCAGGGAATCCATAGG - Intronic
938339110 2:130523703-130523725 GAGGAGAGGAGAGAAGGCACAGG - Intronic
938350728 2:130597047-130597069 GAGGAGAGGAGAGAAGGCACAGG + Intronic
938886060 2:135649902-135649924 GAGGACTGCAGAGGATGAACAGG - Intronic
938979723 2:136514616-136514638 GTGTAGTTCAGGGACTGCACGGG + Intergenic
939619930 2:144406595-144406617 CTGGAGTGCAGAGGATGAAAGGG + Intronic
939855538 2:147354531-147354553 CTGGAAAGCACAGAATGCACTGG + Intergenic
939989904 2:148867666-148867688 GAGGGGTGCAGAGACTTCACTGG + Intergenic
942424989 2:175850074-175850096 GTAGAGTGGAGAGAATGTTCAGG + Intergenic
945042341 2:205752718-205752740 GTGGAGAGCAGAGAAAGAAGTGG - Intronic
948621352 2:239236665-239236687 CTGGAGAACAGAGAAGGCACTGG + Intronic
948637695 2:239349834-239349856 ATGGAGAGCAGAGAATGGGCTGG + Intronic
948805011 2:240450122-240450144 GACGAGTGCAGATAAAGCACGGG - Intronic
1171008856 20:21495718-21495740 GAGGAGTGCGGTGGATGCACAGG + Intergenic
1172113959 20:32562984-32563006 GTGGAGGGCAGAGAGTGGAGGGG + Intronic
1172605826 20:36212959-36212981 AAGGAGTGCAGGGAATGGACTGG - Intronic
1174742724 20:53031481-53031503 GTGGAGTGCAGCAAGTGAACAGG + Intronic
1174782179 20:53399962-53399984 GTAGAGTGCAGAGTATAGACTGG + Intronic
1174855223 20:54038289-54038311 GTGGAGTCTAGAGAATAAACAGG - Intronic
1175555418 20:59850972-59850994 CTGGAAAGCAGAGAATGGACTGG - Intergenic
1175618533 20:60423804-60423826 CTGGAGTGCAGTGAGTGCAGTGG + Intergenic
1176132378 20:63501847-63501869 GGGGAGGGCAGGGAAAGCACAGG - Intergenic
1177610554 21:23442249-23442271 GTGGAGGGCAGAGAAAGAGCAGG + Intergenic
1177707536 21:24727138-24727160 GATGAGTACAAAGAATGCACTGG - Intergenic
1178495942 21:33086236-33086258 ATGCAGTGCAGAGAAGGGACCGG + Intergenic
1178894532 21:36548067-36548089 GGGGAGTGCAGTGAATCCAAGGG - Intronic
1179426436 21:41282991-41283013 GTGTAGTGCAGAGAAAGAGCTGG - Intergenic
1179830235 21:43991982-43992004 GTGGAGTGCAGAGCAAGGGCTGG + Intergenic
1182710358 22:32318843-32318865 TTGGAGTGGAGAGAATGAAAAGG - Intergenic
1183012255 22:34956506-34956528 GTGGAGTGAAGTGAAGGAACAGG - Intergenic
1183721668 22:39566313-39566335 GTGGATGGCTGAGCATGCACTGG - Intergenic
1203298120 22_KI270736v1_random:57723-57745 GTGGAGTGGAGGGAATGGAGTGG + Intergenic
1203298131 22_KI270736v1_random:57767-57789 GTGGAGTGGAGGGAATGGAGTGG + Intergenic
1203304815 22_KI270736v1_random:101752-101774 GTGGAGTGAACAGAGTGCAATGG + Intergenic
1203308586 22_KI270736v1_random:126685-126707 GTGGAGTGGAAAGAATGGACTGG + Intergenic
949285027 3:2392344-2392366 GTGGAGAACAGAGATTGCAAAGG - Intronic
950544235 3:13629338-13629360 GTGGAGTGCACAGAGGGCAGGGG - Intronic
950548318 3:13652156-13652178 CTGGAGTGCAGGGAGTGGACGGG - Intergenic
954747407 3:52794974-52794996 GTGGAGTGAAGAGGAGGCAGAGG + Intronic
955023907 3:55148629-55148651 GTAAAGTGCAGAGACTGGACTGG + Intergenic
958666557 3:97146811-97146833 CAGTAGTGCAGAGAATGAACTGG - Intronic
958712296 3:97732021-97732043 CTGCAGTGCGGAGAGTGCACTGG - Intronic
959936278 3:112032569-112032591 GTGGAGTGCTGATAATGCCAAGG - Intergenic
960264528 3:115605293-115605315 GGGGATTGCTGAGAATGCCCAGG + Intergenic
961780411 3:129317271-129317293 TGGGGGTGCAGAGAAGGCACAGG + Intergenic
961905617 3:130260066-130260088 ATGGAGTACAGTGCATGCACTGG + Intergenic
962584053 3:136823633-136823655 CTGGAGTGCAGTGAGTGCAGTGG + Intronic
963868791 3:150391258-150391280 GTGGTGTGAAGACAAAGCACTGG - Intergenic
964077232 3:152706407-152706429 GTGGAGTGGAGAGAAAGAAAGGG - Intergenic
964278553 3:155035751-155035773 GTGGAGGGGAGAGGCTGCACCGG + Intronic
964392308 3:156210717-156210739 GTGGGGAGCAGAGAAAGCCCAGG - Intronic
965442101 3:168727319-168727341 GTGGAGTTCTGAGGATGCGCAGG - Intergenic
965836178 3:172855597-172855619 CAGCAGTGCAGAGGATGCACTGG + Intergenic
966253109 3:177888820-177888842 GTGGAGTGCAGTTCATGCAATGG - Intergenic
969615556 4:8250800-8250822 GTAGAGTGCAGCCCATGCACGGG - Intergenic
969946769 4:10791236-10791258 GTGGAGTTGGGAGAAAGCACAGG - Intergenic
975830493 4:78363478-78363500 GGGGAGCACAGAGAAGGCACGGG - Intronic
976226034 4:82796645-82796667 GTGGTGTTCAGAGAGTGCTCAGG - Intronic
977886373 4:102256874-102256896 GTGGGGTGCAGGGAAACCACAGG + Intronic
978604164 4:110460949-110460971 CTGGAGTGCAGGGAATGCAGTGG - Intronic
980187102 4:129475745-129475767 GTGGAGTGCGGGGAATGAGCAGG - Intergenic
985379101 4:189373501-189373523 GAGGAGTGCAGGAAATGCAAAGG + Intergenic
985983023 5:3488149-3488171 GGGGAGGGCAGAGAAGACACAGG + Intergenic
988781009 5:34521870-34521892 GTGGAGGGCAGAGGATGCCAGGG - Intergenic
988785826 5:34564741-34564763 GTGCAGTGCAGAGACAACACGGG + Intergenic
992528194 5:77631093-77631115 GTGCAGTGCACAGAATGTGCAGG - Intronic
993203714 5:84850104-84850126 GTGGAGTGGAGAGATTAGACTGG + Intergenic
997342226 5:133153657-133153679 TTGGAGTGAAGAAAATGCCCAGG + Intergenic
997522360 5:134531187-134531209 GTGGAGTACAGCGTGTGCACAGG + Intronic
1001295285 5:170494762-170494784 GTGGAGGGAAGAGAAAGAACTGG - Intronic
1002314469 5:178334115-178334137 GTGGAGGGCAGAGAAGACCCAGG - Intronic
1002808786 6:604893-604915 GTTGAGTGCAGAGAATACCAGGG - Intronic
1003388908 6:5695363-5695385 CTGGAAGGCAGAGAAAGCACTGG - Intronic
1003625203 6:7735073-7735095 GTGGAGTGGAGTGGATTCACAGG + Intronic
1003856849 6:10285058-10285080 GTGCAGTGCTGAGCATGCAAAGG - Intergenic
1004610146 6:17232201-17232223 GTAGAGTGTAGAGAGTGCAAGGG + Intergenic
1005042895 6:21615329-21615351 GTGGGGAGCAGGGAATTCACTGG + Intergenic
1005635744 6:27751704-27751726 TTGGAGTCCAGAGAATGCATTGG - Intergenic
1006057478 6:31396147-31396169 GTGGGGTGCAGAAAACGCCCTGG - Intergenic
1006069905 6:31490804-31490826 GTGGGGTGCAGAAAACGCCCTGG - Intergenic
1007302985 6:40882437-40882459 GTGGAGTGGAGAAAAACCACTGG + Intergenic
1007755798 6:44098609-44098631 CTGGAGTGCAGGGAATGTAGTGG + Intergenic
1008778348 6:55069169-55069191 GTCCAGTCCAGAGAAGGCACTGG - Intergenic
1012052249 6:94361210-94361232 GTAGAGGACAGAGAAAGCACAGG - Intergenic
1016697582 6:147015921-147015943 GCAGAGTGCAGAGACAGCACTGG - Intergenic
1019051516 6:169187079-169187101 GTGCCGTGCAGAGGCTGCACGGG - Intergenic
1019631484 7:2052055-2052077 GTGGAATGCAGGGGGTGCACAGG - Intronic
1020452415 7:8335177-8335199 GGGGACTGGAGAAAATGCACAGG + Intergenic
1021524821 7:21575175-21575197 GTGCAGTGAAAAGAATGCAGGGG - Intronic
1022951326 7:35340741-35340763 GTGGAGTACAGAAAATGCGAAGG - Intergenic
1024819676 7:53312625-53312647 CTGGAGTGCAGGGAGTGCAGTGG - Intergenic
1027444437 7:78256275-78256297 ATGGAGTGCAGAGAATGAGGCGG + Exonic
1028315223 7:89393343-89393365 GTGGAGTGCACAAAATTCTCGGG + Intergenic
1029372031 7:100156389-100156411 GTGGACCCCAGAGCATGCACAGG - Exonic
1032002640 7:128275478-128275500 CTGAAGTGTGGAGAATGCACTGG + Intergenic
1032738758 7:134717558-134717580 GTGTGATGCAGAGAAAGCACTGG + Intergenic
1033118503 7:138646936-138646958 GTGCACTGCATAGAAGGCACTGG + Intronic
1033646275 7:143307012-143307034 GTGGAGAGCTGAGAAGGCCCAGG - Exonic
1033812364 7:145030895-145030917 GTGGGTTGCAGAGAAAGCAGAGG + Intergenic
1035105805 7:156440830-156440852 GTGGAGTGTGGAAAAAGCACAGG - Intergenic
1035430281 7:158814945-158814967 GGAGAGAGCAGAGAATGCAAGGG + Intronic
1036002603 8:4624877-4624899 GTGGTGGGCAGAGAAGGCACTGG + Intronic
1036283053 8:7417670-7417692 GTGGAAAGCAGAGAAAGCCCTGG - Intergenic
1036338416 8:7893849-7893871 GTGGAAAGCAGAGAAAGCCCTGG + Intergenic
1036765842 8:11548911-11548933 CTGGAGGGCAGAGAATCCGCAGG - Intronic
1037945131 8:22984871-22984893 TTGGAGTGCAGTGAGTGCAATGG - Intronic
1038697575 8:29819661-29819683 GGGGAGGGCAGAGAGGGCACAGG - Intergenic
1040682436 8:49828699-49828721 GTGGAGTGGAGTGGATGAACTGG + Intergenic
1041792203 8:61709483-61709505 GTGCAGTGCAGAGCAGACACTGG + Intronic
1042027705 8:64441597-64441619 TTGGAATGCAGAGAGTGCTCAGG - Intergenic
1044475796 8:92624997-92625019 GTGTAGTGAAAAGAAAGCACAGG - Intergenic
1045773731 8:105776191-105776213 GGGGAGTTTAGGGAATGCACCGG + Intronic
1046312551 8:112457309-112457331 ATGGAGTGAAGAGAATTCACAGG + Intronic
1048357806 8:133667715-133667737 GTGGAGTGGAGAGAAAGAAGGGG - Intergenic
1049808643 8:144553184-144553206 GTGGAGTGCAGAGTGTGCCAGGG - Intronic
1050457179 9:5845569-5845591 GTGGAGTGCAGTTAATCCACAGG - Intergenic
1052983193 9:34464199-34464221 ATGCAGTGTAGAGAATGGACTGG - Intronic
1055052582 9:71995143-71995165 CTGGAATGCAGAGGATTCACGGG + Intergenic
1056788947 9:89613055-89613077 GTGGAATGCATGGAGTGCACGGG + Intergenic
1057585086 9:96321725-96321747 GAGGAGGGCAGAGAACGCAGGGG + Intronic
1057804572 9:98211077-98211099 GGGGTGTGCAGAGACAGCACAGG + Intronic
1059123566 9:111662745-111662767 GTGGAGTGAAGATAATAAACAGG + Intronic
1059407146 9:114108340-114108362 GTGGATTGAAGAGGATGGACCGG - Intergenic
1060296975 9:122349578-122349600 GTGTAGTGCACAGACTCCACAGG + Intergenic
1060492426 9:124094700-124094722 GTGGATGTCAGAGAATCCACAGG + Intergenic
1060795187 9:126508294-126508316 GGGAAGTGCAGAGGATGAACAGG - Intergenic
1060867840 9:127013851-127013873 GCAGAGAGCAGAAAATGCACAGG - Intronic
1061216378 9:129224315-129224337 GCTGAGTGCTGAGAATGCATGGG + Intergenic
1061222403 9:129259848-129259870 GTGGACTGCAGAGATTCCAGAGG - Intergenic
1062518419 9:136947360-136947382 GAGGTGTGCAGAGAGTGCAGTGG - Intronic
1203351289 Un_KI270442v1:83406-83428 GTGGAGTGGAGAGGATGGAGTGG + Intergenic
1185670111 X:1802215-1802237 GTGGAGGGCTGAGACTTCACTGG - Intergenic
1188101309 X:26091419-26091441 GAGTAGAGCAGAAAATGCACAGG - Intergenic
1192537242 X:71938718-71938740 ATGGAGTGAAGAGAATGCACTGG + Intergenic
1192606591 X:72525366-72525388 GGGAGGTGCAGAGAAGGCACTGG - Intronic
1193297745 X:79852442-79852464 GTGGAGTCCAGAGAATCCACAGG + Intergenic
1194514413 X:94833629-94833651 CTGGAGTGCAGAAAATGAATGGG + Intergenic
1201113221 Y:10815835-10815857 GTGGAGTGGAGGGAATGGAGTGG - Intergenic
1201139120 Y:11013793-11013815 GTGGAGTGGAGAGAATGGAGTGG - Intergenic
1201141777 Y:11034437-11034459 GTGGAGTGAGGAGACTGCAGAGG - Intergenic