ID: 1151951144

View in Genome Browser
Species Human (GRCh38)
Location 17:77354797-77354819
Sequence GGACGCAAAGTGCAACAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 52}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151951144_1151951150 8 Left 1151951144 17:77354797-77354819 CCTGCTTGTTGCACTTTGCGTCC 0: 1
1: 0
2: 0
3: 10
4: 52
Right 1151951150 17:77354828-77354850 GTTGACCCCTGGCCGGTGCTGGG 0: 1
1: 0
2: 0
3: 8
4: 107
1151951144_1151951149 7 Left 1151951144 17:77354797-77354819 CCTGCTTGTTGCACTTTGCGTCC 0: 1
1: 0
2: 0
3: 10
4: 52
Right 1151951149 17:77354827-77354849 CGTTGACCCCTGGCCGGTGCTGG 0: 1
1: 0
2: 0
3: 2
4: 66
1151951144_1151951148 1 Left 1151951144 17:77354797-77354819 CCTGCTTGTTGCACTTTGCGTCC 0: 1
1: 0
2: 0
3: 10
4: 52
Right 1151951148 17:77354821-77354843 TGAGGACGTTGACCCCTGGCCGG 0: 1
1: 0
2: 1
3: 5
4: 108
1151951144_1151951146 -3 Left 1151951144 17:77354797-77354819 CCTGCTTGTTGCACTTTGCGTCC 0: 1
1: 0
2: 0
3: 10
4: 52
Right 1151951146 17:77354817-77354839 TCCTTGAGGACGTTGACCCCTGG 0: 1
1: 0
2: 0
3: 9
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151951144 Original CRISPR GGACGCAAAGTGCAACAAGC AGG (reversed) Intronic
901914151 1:12485312-12485334 GCACGCAAACTGAAACAGGCAGG + Intronic
912583876 1:110744181-110744203 GGACTCAAAGTGTCACAAGATGG + Intergenic
917427291 1:174928107-174928129 GGAAGTAGAGTGCAACAAGAAGG - Intronic
920498705 1:206472996-206473018 GGACGCACAGCACAACAAGAGGG - Intronic
921445670 1:215244187-215244209 AGAAGCAAAGTGAAACAAGCAGG + Intergenic
924297261 1:242600061-242600083 GGAAGTAAAGTACAATAAGCTGG - Intergenic
1067939301 10:50640155-50640177 GGACTCAAAGTCTAACAAGGTGG - Intergenic
1072219324 10:93314538-93314560 GGCAGCAAAGAGCAACAAGGAGG + Intronic
1072578378 10:96720284-96720306 GGACGCAAACAGAAGCAAGCGGG + Intronic
1075606019 10:123809199-123809221 GGCCCCAAAGTGCAAGAAGTAGG + Intronic
1083355884 11:62065786-62065808 CGTCACAAAGTGCCACAAGCTGG + Intergenic
1086900974 11:92367121-92367143 GAAGGCAAAGTGCTACAGGCAGG - Intronic
1095971224 12:47903269-47903291 TGACTCAAACTGCAAAAAGCTGG - Intronic
1099747933 12:86731615-86731637 GGAAACAAAGTGCCACAAGCTGG - Intronic
1101426502 12:104592606-104592628 GGACGCAAAGTGCTATAATCTGG - Intronic
1102259005 12:111432078-111432100 GGACACAAAGTGAAAAAAGCAGG - Intronic
1105940052 13:25140055-25140077 AGAAGCCAAGTGCAGCAAGCTGG - Intergenic
1107164655 13:37270271-37270293 GGATGAAAATTGCAAAAAGCAGG - Intergenic
1110414839 13:75240544-75240566 GGATGTAAAGTGTAACAAGGGGG - Intergenic
1114393423 14:22334803-22334825 GGAGGCACAGTGCTACGAGCAGG + Intergenic
1120589134 14:86354734-86354756 GGAAGAAAAGAGCAACAAGAGGG - Intergenic
1123149548 14:106167636-106167658 ACACGTGAAGTGCAACAAGCAGG - Intergenic
1124055666 15:26238761-26238783 GGACTCAAAGAGCAACCTGCAGG + Intergenic
1125167996 15:36732355-36732377 GGAATCAAGGTGCAACAAACAGG - Intronic
1125430645 15:39589855-39589877 GAACGCCAAGTGCAACTACCTGG + Exonic
1145712441 17:26990017-26990039 TGATGCTAAGTGAAACAAGCCGG - Intergenic
1147504470 17:41001874-41001896 AGACGCAAACTGCACCAAGCTGG - Intergenic
1151758262 17:76086952-76086974 AGATGCAAAGTGCAAAAAACAGG + Intronic
1151951144 17:77354797-77354819 GGACGCAAAGTGCAACAAGCAGG - Intronic
1156083332 18:33367175-33367197 GCATGCAATGTGAAACAAGCAGG + Intronic
1161194532 19:2978837-2978859 GGACGCAAAGTGCAGGGAGCGGG - Intronic
1164594053 19:29522055-29522077 GGAGGCAAAGTGCTCCTAGCAGG + Intergenic
931232503 2:60386761-60386783 GGACCCAAAGGTCAACAGGCTGG + Intergenic
931403093 2:61949972-61949994 GGACACAAAATGAAACAAACAGG + Intronic
935637249 2:105258817-105258839 GGATGCACATTGCAACAGGCAGG - Intergenic
936529208 2:113263695-113263717 GGAGGCACAGTGCAAAAAGAAGG + Intronic
938963483 2:136363709-136363731 GGAAGAAAAGTCCAGCAAGCTGG + Intergenic
946205194 2:218100957-218100979 GGACCCTAAGTGCAAGCAGCCGG + Intergenic
947956396 2:234195820-234195842 TGAAGCAAAGTGCCACAAGCTGG + Intergenic
1173531913 20:43776286-43776308 GGTAACAAAGTGCCACAAGCGGG + Intergenic
1178859146 21:36274628-36274650 AGAAGCAAAGTGCAACAGGAAGG + Intronic
1183943267 22:41308769-41308791 GGAGGCAAAGTGCAAGGGGCAGG - Intronic
951893156 3:27585558-27585580 GAACTCAAAATGCAACCAGCAGG + Intergenic
955624474 3:60902697-60902719 GGAAGCAAAGTGCAACTAAGTGG + Intronic
960556114 3:119032597-119032619 GGATGTAAAGTGGAACAGGCAGG - Intronic
961904145 3:130244905-130244927 GGACTCAAAGTCCACCAAGATGG - Intergenic
965236136 3:166125740-166125762 GGACCCAAAGAGCAACAAGGTGG - Intergenic
974619227 4:64334753-64334775 GGATGCATAAAGCAACAAGCTGG + Intronic
979091028 4:116482769-116482791 GGACCCAAAGTGCTACATTCAGG + Intergenic
985404029 4:189618127-189618149 GGAAGAAAATTTCAACAAGCCGG - Intergenic
991244641 5:64497329-64497351 GGATGCAAAGTGGAAGAAGCAGG - Intergenic
999732999 5:154490046-154490068 GGACACAAAATTCAACACGCTGG + Intergenic
1008666690 6:53723668-53723690 GGAAACAAAGTCCAATAAGCAGG + Intergenic
1015306227 6:131711222-131711244 GGATGTAAAGTGTAACAAGAGGG - Intronic
1028215384 7:88125906-88125928 GAACCCAAGGTGCCACAAGCAGG - Intronic
1046209636 8:111052594-111052616 GTACGCTAAGTGAAAAAAGCTGG - Intergenic
1052365798 9:27610934-27610956 GGATGTAAAGTGTAACAAGGGGG - Intergenic
1055669865 9:78593819-78593841 GCACGTAAAGTGCAAGAAGCAGG + Intergenic
1057962066 9:99466262-99466284 GGACTCAAATTGCAGCAAGAGGG + Intergenic
1059235471 9:112757261-112757283 TTATGCTAAGTGCAACAAGCCGG - Intronic
1061905894 9:133697080-133697102 GGACTCAAAGTGCTAAAATCAGG + Intronic
1203781600 EBV:104085-104107 GCACTCCAAGTGCAACAATCTGG + Intergenic
1189913057 X:45830297-45830319 GGAAACAAATTGCAACAAACTGG + Intergenic