ID: 1151953087

View in Genome Browser
Species Human (GRCh38)
Location 17:77366012-77366034
Sequence CCCTGGGGCCCTTGGTGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 408
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 372}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1151953087_1151953097 24 Left 1151953087 17:77366012-77366034 CCAGGACACCAAGGGCCCCAGGG 0: 1
1: 0
2: 1
3: 34
4: 372
Right 1151953097 17:77366059-77366081 TGAGTTCTAGCCAAGCCTCCTGG 0: 1
1: 0
2: 2
3: 7
4: 150
1151953087_1151953094 -1 Left 1151953087 17:77366012-77366034 CCAGGACACCAAGGGCCCCAGGG 0: 1
1: 0
2: 1
3: 34
4: 372
Right 1151953094 17:77366034-77366056 GACAGCCTGTTTCTCCTGGCTGG 0: 1
1: 0
2: 0
3: 9
4: 216
1151953087_1151953093 -5 Left 1151953087 17:77366012-77366034 CCAGGACACCAAGGGCCCCAGGG 0: 1
1: 0
2: 1
3: 34
4: 372
Right 1151953093 17:77366030-77366052 CAGGGACAGCCTGTTTCTCCTGG 0: 1
1: 0
2: 1
3: 24
4: 279

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1151953087 Original CRISPR CCCTGGGGCCCTTGGTGTCC TGG (reversed) Intronic
900158248 1:1212026-1212048 CCGGGGGGCCCTGGGTCTCCTGG + Exonic
901325697 1:8364026-8364048 CCCTGGGGCCATGGGGCTCCTGG - Intronic
901878984 1:12182898-12182920 CTTTGGGGCCCTTGGAGTCCTGG + Intronic
902107163 1:14047389-14047411 CCATGGGCTCCTGGGTGTCCAGG - Intergenic
902555494 1:17244362-17244384 TCCTGGTGCCCATGGTGGCCAGG - Exonic
902559258 1:17266851-17266873 GCCTGAGTCCCTGGGTGTCCAGG + Intronic
902873642 1:19328497-19328519 CCCTGGGGGCCTTCGACTCCTGG - Intronic
903954740 1:27017536-27017558 CCCTGTTGCCCTGGCTGTCCAGG - Intergenic
904534616 1:31190845-31190867 CCTTGGGAGCCTTGGTGTTCTGG + Intronic
906284302 1:44576585-44576607 CACTGGGGCCCATCCTGTCCTGG - Intronic
906476744 1:46174501-46174523 CCCTGAGACCTTTGGTGGCCTGG - Intronic
907475013 1:54699794-54699816 CCCTGGGCCCTTGGGTGCCCTGG - Intronic
909391581 1:75126963-75126985 CCCTGGGTGCCTTGGTGGCTGGG - Intergenic
909649738 1:77960449-77960471 CCATGGGGCCCATGGGGTACAGG + Exonic
912430158 1:109624619-109624641 CCCTGGGGCCCTGGGGGACAGGG + Intronic
912778258 1:112520642-112520664 CCATAGGGACCATGGTGTCCTGG + Exonic
915400720 1:155619864-155619886 CCCTGGGGCCTGTGTTGCCCAGG + Intergenic
915418195 1:155758551-155758573 CCCAGGGGCCTGTGTTGTCCAGG + Intronic
915997799 1:160581959-160581981 TCCTGGGGCTCTGGGTGGCCAGG + Intergenic
916434828 1:164768367-164768389 CCCTGTGCCCCTCTGTGTCCTGG - Intronic
919704478 1:200663230-200663252 CTCGGGGCCCCTTGGTGTTCTGG - Intronic
919877842 1:201883506-201883528 CCCAGGGAGCCTTGGTGACCAGG - Exonic
919978995 1:202630738-202630760 CCTTGAGGCCTCTGGTGTCCTGG - Intronic
920016246 1:202911958-202911980 CCCTGGAGCACTTGGTGTTTGGG - Intronic
920202546 1:204268425-204268447 ACCTGGGCCCCTTGGTGTGAGGG - Intronic
920375134 1:205504348-205504370 CCCCTGGCGCCTTGGTGTCCTGG + Intergenic
920381006 1:205534544-205534566 TCCTGGAGCCCTCGGTTTCCTGG + Intergenic
922776478 1:228216409-228216431 CCCTGGGGCCGCTGGGGGCCAGG - Exonic
1062767465 10:76474-76496 CCCGGCGGCCCCAGGTGTCCCGG + Intergenic
1062829626 10:597088-597110 CCCTGGAGCCCTGGGTGGACAGG - Intronic
1063134125 10:3201654-3201676 CACTGGGGACCGTGGGGTCCTGG + Intergenic
1063301182 10:4850190-4850212 CTCTGTGGACCTTGGTCTCCAGG - Intergenic
1063485891 10:6420450-6420472 CCATGGGATCCTTGGTTTCCAGG + Intergenic
1067477973 10:46578851-46578873 CCCTGGCGCCCCTGGCGCCCGGG + Intronic
1067616766 10:47762936-47762958 CCCTGGCGCCCCTGGCGCCCGGG - Intergenic
1069246096 10:66208853-66208875 CCCTGGGCCCTTTGGTGACTAGG - Intronic
1069738522 10:70672903-70672925 CGCGGGGGCCCGTGGGGTCCGGG + Intronic
1069793576 10:71038947-71038969 CCCTGGGGCCAGTGATATCCAGG - Intergenic
1071201274 10:83222463-83222485 ACATGAGGCCCTTGGTGCCCAGG + Intergenic
1076183779 10:128431069-128431091 CCCCTGGGTCCTTGGTGCCCCGG + Intergenic
1076363156 10:129904182-129904204 CCCTGGAGGCTTTGGGGTCCTGG - Intronic
1076595487 10:131622518-131622540 ACCTGGGGCCCTGGGTTCCCGGG - Intergenic
1076789590 10:132769725-132769747 CCCTGAGGGCCTTGGCGTCTGGG - Intronic
1076875431 10:133213448-133213470 CCCAGGGGCTCATGGTGTCCGGG - Intronic
1076998344 11:310366-310388 GCCTTGGGCCCAGGGTGTCCCGG - Intronic
1077000398 11:319392-319414 GCCTTGGGCCCAGGGTGTCCCGG + Intergenic
1077101001 11:822300-822322 GAATGGGGCCCTTGGTGGCCGGG + Intronic
1077333626 11:1994049-1994071 CCCTTGGGGTCTTGGTGTCCAGG - Intergenic
1077804047 11:5572024-5572046 CCCTGGAGCACTTGGTGTTTGGG + Intronic
1078435420 11:11320951-11320973 ACAGGGAGCCCTTGGTGTCCTGG - Intronic
1079332080 11:19541808-19541830 CCCTGGGCCACCTGGTGTCCTGG + Intronic
1079411029 11:20187749-20187771 CTCTGTGGCCCTTGCTGTCTTGG - Intergenic
1082771456 11:57210930-57210952 CCCTGGGAACCTTGAGGTCCTGG + Intergenic
1083307479 11:61768885-61768907 CCCTAGGGCCCTGTGTTTCCAGG + Intronic
1083433460 11:62627071-62627093 CTCTGGAGCCCATGGTGTCCAGG - Exonic
1083614836 11:64021249-64021271 CCCTGGGGCCCTTGGGAGGCAGG + Intronic
1083900316 11:65640436-65640458 CCCAGGGGCCACTGGTGTCTGGG - Intronic
1084302527 11:68260916-68260938 CCCTGGGGTCCTGGGTTACCTGG + Intergenic
1084606515 11:70175461-70175483 CCCTGAGGCCCTGGGTGGCTGGG + Intronic
1084953108 11:72677458-72677480 CCCTGGAGCTCCAGGTGTCCAGG + Intergenic
1085123764 11:73983495-73983517 CGCCGGGGCCTTTAGTGTCCTGG - Intergenic
1085161794 11:74354585-74354607 CCCTGGAGCACTTGGTGTTTGGG - Intronic
1085273143 11:75282107-75282129 CCCTGGGGCCCTTGGTCTGATGG - Intronic
1086461931 11:87014622-87014644 CCCTTGGGCCCTTGGATGCCTGG - Intergenic
1088694971 11:112358863-112358885 TCCTGGGGCACTTGGTGGCCTGG + Intergenic
1090453051 11:126823468-126823490 CCCTGGGGCACTTTGAATCCTGG + Intronic
1090795885 11:130135397-130135419 CCCTGGGGTCCCTGGTGTTGGGG + Intronic
1091221312 11:133931421-133931443 CCCTGGAGCCCTGGGTCTGCAGG - Intronic
1202816607 11_KI270721v1_random:49231-49253 CCCTTGGGGTCTTGGTGTCCAGG - Intergenic
1094371671 12:29745273-29745295 CCCTGTGCCCTTTGGTGTTCTGG - Intronic
1094839090 12:34335514-34335536 TCCTGGGGACCCTGGGGTCCGGG + Intergenic
1094840474 12:34340704-34340726 TCCTGGGGACCCTGGGGTCCTGG + Intergenic
1094842059 12:34346331-34346353 TCCTGGGGACCCTGGGGTCCAGG - Intergenic
1096476821 12:51913638-51913660 CCTGGTGGCCCTGGGTGTCCTGG + Exonic
1096614496 12:52824104-52824126 CTCTGGGACCCTTGGAGTCCGGG - Intronic
1098732116 12:74049572-74049594 CCCTGTGGCCGTATGTGTCCAGG + Intergenic
1100830848 12:98515677-98515699 CTCTGGGGTCTTTTGTGTCCGGG + Exonic
1101517004 12:105446094-105446116 CCCTTGGGGCCTTTGTGACCTGG + Intergenic
1101707899 12:107237641-107237663 ACCTTGGGCCCTTGGTGCTCAGG + Intergenic
1102140964 12:110614343-110614365 CCCTGGAGCCCTGGGAGTCCCGG - Exonic
1102305044 12:111798469-111798491 GCCTGCAGGCCTTGGTGTCCTGG + Intronic
1103427021 12:120844794-120844816 CCCGTGGGCCCTTGGCCTCCGGG - Intronic
1104038383 12:125114183-125114205 CCGTGGTGCCCTTGATGTCCTGG + Intronic
1104723440 12:131060091-131060113 CTCTGTGTCCCTTGGAGTCCTGG + Intronic
1104905286 12:132210154-132210176 CCCTGGGGCCCGTCGTCTGCAGG + Intronic
1108409643 13:50133466-50133488 CCCTGGATCCTCTGGTGTCCCGG + Intronic
1111666204 13:91272135-91272157 CCCTGGAGCACTTTGGGTCCAGG - Intergenic
1112004669 13:95243999-95244021 CCCTAGGTTCCTAGGTGTCCTGG - Intronic
1113634322 13:111909552-111909574 CCCTGGGCCCCTCTGTGCCCAGG - Intergenic
1113674173 13:112196513-112196535 CCCTGGGTCCCCTGGTTTCCTGG + Intergenic
1113805516 13:113108714-113108736 CCCGGGGGTCGTGGGTGTCCCGG + Intronic
1113805714 13:113109242-113109264 CCCGGGGGTCGTGGGTGTCCCGG + Intronic
1113923896 13:113929771-113929793 TCCTGAGGCCCCTGGAGTCCCGG + Intergenic
1113944842 13:114038348-114038370 CGCTGGGGCCCTTGTGCTCCGGG + Intronic
1118982010 14:70724764-70724786 CCCTGGGGCCCTCGCTCCCCAGG + Intronic
1119049721 14:71354937-71354959 CCCCCGGGCCCTGGGTCTCCAGG - Intronic
1119547488 14:75482767-75482789 CCCTGTGGAACTTGGGGTCCCGG - Intergenic
1121201460 14:92121666-92121688 CCCTGTTGCCCTTGGTCTCGGGG - Exonic
1121653461 14:95576825-95576847 CCCTGGAGCCCCTGGGGGCCAGG - Intergenic
1121979487 14:98442355-98442377 CTCTGGGGCCATTGGTGTCTTGG + Intergenic
1122716887 14:103701258-103701280 CCCTGCCGCCCTGGCTGTCCCGG - Intronic
1122780629 14:104142000-104142022 CCCTGGGGCTGTTGGAGCCCAGG + Intronic
1122795272 14:104202992-104203014 CCCTTGGCCCCTTTGTGCCCAGG + Intergenic
1123063750 14:105606078-105606100 CCCTGGGACCCTGGGTGCCCAGG + Intergenic
1124049938 15:26187575-26187597 CGCCTGGGCCTTTGGTGTCCAGG - Intergenic
1124494592 15:30178624-30178646 CCTTGAGGCCTCTGGTGTCCTGG - Intergenic
1124748978 15:32360021-32360043 CCTTGAGGCCTCTGGTGTCCTGG + Intergenic
1125578536 15:40770485-40770507 CCCTGGGCCCCATGGAGACCTGG + Exonic
1126412728 15:48388631-48388653 CTCTGGGCCCCTTGATGTCCCGG + Intergenic
1128525030 15:68406532-68406554 CCCTGGGGTGTTTGGTGGCCTGG - Intronic
1129716836 15:77857224-77857246 CCCAGGGGCCCTTGCAGGCCTGG + Intergenic
1130443476 15:83977826-83977848 CCCTGAGGCCCATGGAGGCCCGG - Intronic
1131395863 15:92085419-92085441 CCCCGGGGCACTTGGCTTCCAGG - Intronic
1131459635 15:92609191-92609213 CACTGGGGCCCCTGGTGCTCTGG + Intergenic
1132061471 15:98695826-98695848 CCCTGGAGACCTTTGTGTGCTGG + Intronic
1132419475 15:101652811-101652833 CCCTCGGGCCCTCGTCGTCCCGG - Intergenic
1132506283 16:310904-310926 CCGTGGGGCACTGGTTGTCCTGG - Intronic
1132594163 16:740668-740690 TCCTGTGCCCCATGGTGTCCGGG - Intronic
1132657253 16:1046525-1046547 GCCTGGGGCCCGTGGTGGGCAGG + Intergenic
1132698011 16:1210517-1210539 CCCTGGGGGTCGTGGTGGCCCGG - Intronic
1133096957 16:3453910-3453932 GCGTAGGGCCATTGGTGTCCAGG + Intronic
1133280322 16:4661419-4661441 CCCTGAAGCCCTGTGTGTCCAGG - Intronic
1133284839 16:4685886-4685908 CACTGGGGGCCCTGGTGTCTTGG + Intronic
1133853986 16:9532458-9532480 CCCAGCAGCCCTTTGTGTCCAGG + Intergenic
1133972919 16:10580222-10580244 ACCCGGGGCTCTTGGAGTCCAGG - Intronic
1134460045 16:14422728-14422750 TCCTGGGTCCGTTTGTGTCCAGG + Intergenic
1134853300 16:17499517-17499539 CACTGGGGACTTTGGTGACCTGG + Intergenic
1135990848 16:27217870-27217892 CCCTGGGGTTCTCGGTGGCCTGG + Intronic
1137023711 16:35453886-35453908 CTCTTGAGCCTTTGGTGTCCTGG - Intergenic
1137434373 16:48443579-48443601 ACCAGGGGGCCTTGGTGTGCTGG + Intronic
1138009418 16:53363502-53363524 CCCTTGGGCCCTCTGTCTCCAGG + Intergenic
1138421771 16:56903636-56903658 CCCTCGGTCTCTTGGTCTCCAGG + Intronic
1138590267 16:57995868-57995890 CCCTGGGCCCACTGGTCTCCAGG + Exonic
1139047570 16:63081318-63081340 CCATGGGCCACTTGGAGTCCAGG - Intergenic
1139691648 16:68645526-68645548 CCCTGGGGCCAAGGGAGTCCCGG + Intronic
1139954075 16:70685163-70685185 GCCTGGAGACCTTGGAGTCCTGG + Intronic
1140222932 16:73057672-73057694 CCCGGGAGCCCCTAGTGTCCAGG + Intronic
1140413994 16:74760230-74760252 CCCTCGGGGGCCTGGTGTCCTGG - Intronic
1140889708 16:79274477-79274499 CCCTGGAGACTCTGGTGTCCAGG + Intergenic
1140922571 16:79552631-79552653 CCTTGGGCCCCTCGGTGTTCAGG + Intergenic
1141531346 16:84648765-84648787 CCCTGCGCCCCTTGGTGCCGGGG + Intronic
1142027546 16:87822692-87822714 CTCTGGGGCTCTTCGTCTCCAGG - Intergenic
1142192752 16:88725434-88725456 CCTTGGGGCCCAGGGTGTCCTGG + Exonic
1142234396 16:88915054-88915076 CCCTGGCACCCTGGGAGTCCTGG + Intronic
1142345819 16:89553473-89553495 CCCGGGGGCCCCTGGGCTCCAGG + Intronic
1143026449 17:3944492-3944514 CCCTGGGGCTCTTGGTCTGTGGG - Intronic
1143103978 17:4519371-4519393 CCCACGGGCCCTCGGTGTCCTGG - Intronic
1143199209 17:5100502-5100524 CCCTGGAGCCCATGGCATCCTGG + Intergenic
1144490451 17:15704336-15704358 CCCTGGGGCCCCAGGGGGCCTGG - Intronic
1144945115 17:18965814-18965836 CCCTGGGGCCTGTGAGGTCCTGG - Intronic
1146061020 17:29607453-29607475 GCCAGGGGCCCTTGGTGGACAGG + Intronic
1146160122 17:30555146-30555168 TACTGGGGCCCCTGGTGTCGGGG - Intergenic
1146374444 17:32284825-32284847 CTCTGGGGCCCTTGGTACTCGGG + Intronic
1147690602 17:42312515-42312537 CGCTGGGGCCCTTGGGCTCAGGG + Intergenic
1148160026 17:45444431-45444453 GCCTGGGGCCTTTGGTGCTCAGG - Intronic
1149866240 17:60152534-60152556 CCCTGGGGCCCATCTGGTCCAGG - Intronic
1150391317 17:64791310-64791332 GCCTGGGGCCTTTGGTGCTCAGG - Intergenic
1150410100 17:64935354-64935376 GCCTGGGGCCTTTGGTGCTCAGG - Intergenic
1150675933 17:67245708-67245730 CCCCGGGGCCGTTGGGCTCCGGG + Intronic
1151743848 17:76001187-76001209 CCCTGACCCCCTTGGGGTCCGGG + Intronic
1151870188 17:76831453-76831475 GCCTGAGGACCTTGGTGTTCAGG - Intergenic
1151953087 17:77366012-77366034 CCCTGGGGCCCTTGGTGTCCTGG - Intronic
1152222238 17:79075144-79075166 CCCCGGGGCCCGAGGTTTCCCGG + Intronic
1152869326 17:82743556-82743578 CCCAGGGGGCCTTAGTGCCCAGG - Intronic
1153497825 18:5718011-5718033 TTCTGGGGCGCATGGTGTCCTGG - Intergenic
1155089082 18:22488853-22488875 CCCTGAGGCACTTGCTGGCCAGG + Intergenic
1155237609 18:23836689-23836711 CCCTGGGGCCCTTTCTCTCGAGG + Intronic
1160223845 18:76997370-76997392 CCCTGGGGCCCTGGGGCTTCTGG + Intronic
1160402329 18:78620133-78620155 CCCTGGGGCCATGGAAGTCCAGG + Intergenic
1160785039 19:896430-896452 ACCTGCAGCCCTTGGTGGCCAGG + Intergenic
1160983192 19:1826161-1826183 AGCTGGGGCCCTGGGTGCCCAGG - Intronic
1160983236 19:1826324-1826346 CCCTGGACCCCTGGGTCTCCTGG - Intronic
1161343013 19:3753037-3753059 CCCTGGGGACTTTGGGGACCTGG - Intronic
1161345537 19:3767198-3767220 CCCTGGGCTCCCTGGTGTCCCGG - Intronic
1161473452 19:4472593-4472615 CCCTGGGGGTCTGGGGGTCCTGG + Intronic
1161473500 19:4472711-4472733 CCCTCGGGGCCTGGGGGTCCTGG + Intronic
1162326241 19:10001610-10001632 CCCTGGCTGCCTTGGTCTCCAGG + Exonic
1162536186 19:11263893-11263915 CCCTGGGGCATTTGCTGACCAGG - Intergenic
1162951178 19:14072894-14072916 CGGTGGGGGCCTTCGTGTCCAGG - Intronic
1163310239 19:16509994-16510016 CCTTGGGGCCCGTGGGGGCCGGG + Intronic
1163602486 19:18257446-18257468 CCCCGGGGCCCTCAGTGCCCTGG + Exonic
1164987405 19:32658544-32658566 CCCTGGGGCCTTACGAGTCCTGG - Intronic
1165059051 19:33195899-33195921 TCCAGGGGGCCTGGGTGTCCTGG + Intronic
1165059867 19:33199897-33199919 CCTTGGGGCCCTTGGGGGCCAGG - Intronic
1165423383 19:35733040-35733062 CCCTGGGGCCCCTGGGAGCCAGG - Exonic
1165423388 19:35733047-35733069 CCCAGGGGCCCCAGGGGTCCGGG + Exonic
1165808705 19:38597338-38597360 CCCGGCAGCCTTTGGTGTCCTGG + Exonic
1166159504 19:40941415-40941437 CCCTGGGGGCGCTGGGGTCCAGG - Intergenic
1166520875 19:43479344-43479366 TCCTGGGGCCCATGGTGGCCAGG + Intronic
1167015383 19:46838000-46838022 CCTGGGGGCCCTTGGTGAGCAGG + Intergenic
1167394918 19:49222189-49222211 CCCGTGGGACCTTGGAGTCCAGG + Intergenic
1167705002 19:51076772-51076794 CCCTGGAGCCCCTGTGGTCCAGG - Intergenic
1168300368 19:55401540-55401562 CCCTGGGGCCCCAGGGGGCCCGG - Exonic
1168310836 19:55459762-55459784 CCCTTGGGGCCCGGGTGTCCAGG - Intronic
926269151 2:11352048-11352070 CCATGGAGCCCTTTGGGTCCAGG + Intergenic
927152171 2:20202555-20202577 CCCTGGTGCCCTAAGTCTCCAGG + Exonic
928272131 2:29865921-29865943 CCCAGCGACCCTTGGTGTCTGGG - Intronic
930156446 2:48111795-48111817 CCCTGGAGCCTTTGGGGTTCAGG + Intergenic
931489236 2:62726003-62726025 CCCTGTGTCCCTTGGTCTGCTGG - Intronic
931863205 2:66379132-66379154 ACCTGAGGCTCTTGGTCTCCAGG + Intergenic
932742635 2:74303664-74303686 GCCTGGGGGCTTTGTTGTCCTGG + Intronic
934117414 2:88810643-88810665 CCCTGTGGCCCTTCGAGGCCTGG - Intergenic
934219858 2:90072769-90072791 CACTCTGGCCCTTAGTGTCCTGG + Intergenic
934577394 2:95411562-95411584 CACTGGGGTCTTTGGTATCCTGG - Intronic
934639687 2:96020235-96020257 CACTGGGGTCTTTGGTATCCTGG - Intergenic
934793959 2:97085142-97085164 CACTGGGGTCTTTGGTATCCTGG + Intronic
934921380 2:98347409-98347431 CCCTGGGGGCCTTGGCGCGCAGG + Intronic
935444262 2:103139660-103139682 CCCTGGGTGCCTTCCTGTCCGGG - Intergenic
936062078 2:109301524-109301546 CTCTGGGCACCCTGGTGTCCTGG - Intronic
936228550 2:110679922-110679944 CCATGGAGCCCTCGGTGTCTGGG - Intergenic
937363082 2:121242543-121242565 CCCTGGGGCCCTGGGTGAGGTGG - Intronic
937857673 2:126684372-126684394 CCCTGGAGCCCATGGTGATCAGG + Intronic
938065453 2:128279810-128279832 TTCTGGTGCCCTTGGAGTCCAGG - Intronic
938079140 2:128360031-128360053 CCGTGGGACCCTGAGTGTCCAGG + Intergenic
938370014 2:130762906-130762928 CCCTGGGAACCTTGCTCTCCAGG - Exonic
939099600 2:137880660-137880682 CCCTGGGGGACTCGGTGCCCTGG + Intergenic
943523642 2:188988596-188988618 CCAGGGGGTCCTTGGTATCCTGG - Exonic
945036461 2:205707849-205707871 GTCTGGGGCCCCTGGTGTGCTGG - Intronic
946199608 2:218064232-218064254 CCCTGGGGCCCTCTGCTTCCAGG - Intronic
947151520 2:227121120-227121142 CCCTGTGGCCCTGGTGGTCCTGG + Exonic
947667255 2:231914163-231914185 CACTGGGCCCCTCAGTGTCCAGG + Intergenic
947721774 2:232374101-232374123 CCCTGTGGCCCTTGGTCTTGGGG - Intergenic
947826228 2:233107694-233107716 CCCCCAGGCCCTTGCTGTCCAGG - Intronic
947981780 2:234416644-234416666 CCCTGGAGCCCTCTGTGTCCTGG + Intergenic
948608814 2:239154162-239154184 TCCTGGGGCCCTTGGTGGAAAGG + Intronic
948648619 2:239424866-239424888 CGGGGGAGCCCTTGGTGTCCAGG - Intergenic
948860792 2:240751738-240751760 CCATGTGGCCCTGGGGGTCCAGG + Intronic
948987676 2:241535145-241535167 CCCTGGGCCTCCTGGTGCCCGGG - Intergenic
949067410 2:242001603-242001625 CTCTGGGGACCTCTGTGTCCAGG + Intergenic
949067421 2:242001639-242001661 CCATGGGGACCTCTGTGTCCAGG + Intergenic
949067432 2:242001675-242001697 CCATGGGGACCTCTGTGTCCAGG + Intergenic
1168842377 20:917636-917658 CCCTGGGGGACATGGTCTCCAGG + Intergenic
1169146953 20:3259004-3259026 CTCTGGAGCCCTTGCTGTCCTGG - Intronic
1169475561 20:5928300-5928322 CCATGGAGCCCTTGTCGTCCTGG + Intergenic
1169760759 20:9091047-9091069 CCCTGGGGACCCTGGTCTCTGGG - Intronic
1172165120 20:32894184-32894206 GCATGGGGCCCCTGGTGGCCTGG - Intronic
1172447761 20:35002064-35002086 CCTTGGGGCCCAGGGCGTCCCGG - Exonic
1173227200 20:41168892-41168914 CACTGGGGCCCTTGGACTCTGGG - Intronic
1173972793 20:47165526-47165548 CCCTGCTGCCGTTGGTCTCCAGG + Intronic
1174035356 20:47665401-47665423 CCCTGGGGCCCGGGGAGTGCAGG - Intronic
1175177393 20:57120450-57120472 CCCTGGTGGCATTGCTGTCCTGG + Intergenic
1175379395 20:58552475-58552497 TCCTGGGGGCGTAGGTGTCCAGG - Intergenic
1175899752 20:62355310-62355332 CCTTGGGGCCCTAGGCTTCCAGG - Intronic
1175945952 20:62558848-62558870 CCGTGTGGCGCTTGTTGTCCTGG + Intronic
1176059035 20:63164140-63164162 CAGTGGGTCCCTTGGTGCCCTGG + Intergenic
1176271768 20:64239122-64239144 CCCTGAGGCCTTTGGTGTCCAGG - Intronic
1176284618 21:5012789-5012811 CCTTGCGGCCCCTGGTTTCCAGG + Intergenic
1178815562 21:35925931-35925953 CTCTGTGGCCATTGGTTTCCTGG - Intronic
1179478983 21:41665940-41665962 CCATGGGGTCCTGGGTGTCCTGG + Intergenic
1179872563 21:44250686-44250708 CCTTGCGGCCCCTGGTTTCCAGG - Intronic
1180009405 21:45039999-45040021 CCCTGTAGCCCTGGGTGTGCTGG + Intergenic
1180049442 21:45324642-45324664 CCCTGGGGGCCTTGGACACCGGG - Intergenic
1180079436 21:45480100-45480122 CCTGGAGGCCCTTGGGGTCCTGG - Exonic
1180145689 21:45917409-45917431 CCCTGGGGCTCCTGGTGCCCTGG + Intronic
1180160215 21:45995842-45995864 CCCTGGGGCCTTTCGGGGCCCGG + Intronic
1180160684 21:45997580-45997602 CTCTATGGCCCTGGGTGTCCTGG + Intronic
1180161276 21:45999663-45999685 CCAGGCGGTCCTTGGTGTCCTGG - Exonic
1180180996 21:46118629-46118651 CCCGGGGGCCCTCTGCGTCCTGG - Exonic
1180181690 21:46121076-46121098 CCCTGGGGGCCTCTGGGTCCAGG - Exonic
1180612324 22:17105960-17105982 CGCTGGGGCTCTGGCTGTCCTGG + Intronic
1180969605 22:19808288-19808310 CCCTGAGGCCCCTGGTTTCTGGG - Intronic
1181055549 22:20259028-20259050 CACTGGGGCCTCAGGTGTCCAGG + Intronic
1181082794 22:20425593-20425615 CCCTGGGGCCCTGCGCGCCCAGG + Exonic
1181108589 22:20588774-20588796 TCCTGGGGCCCTTAGGGTGCAGG + Intergenic
1181486489 22:23234858-23234880 CCGGGTGGCCCTTGGTGTCTGGG - Intronic
1182117981 22:27768323-27768345 CCCTGGGGGCCTGGTTCTCCAGG - Intronic
1182427685 22:30283562-30283584 GCCTGAGGCCCTTGGTGAGCCGG + Intergenic
1182902068 22:33906809-33906831 CCCAGGAGCCCTTGGTTTCCTGG + Intronic
1183509663 22:38227410-38227432 TCCTGGAGACCTTGGTGCCCGGG + Intronic
1183927586 22:41217043-41217065 CCACAGGGCCCTTGGGGTCCAGG + Intronic
1184234033 22:43173686-43173708 CCCTGGGGCTCCTGGTCTGCGGG + Intronic
1184782008 22:46654292-46654314 CCCTGAAGCCCTTGGTGGGCGGG - Intronic
1185384206 22:50524324-50524346 CCCTGGGACCCTGGGAGGCCAGG - Exonic
949977374 3:9473367-9473389 CACTGGTGCCCATGGTGTGCAGG + Exonic
953927030 3:46987861-46987883 CACTGGGGCCCAGGGTGCCCCGG + Intronic
954862648 3:53703528-53703550 CTCTGGGGCCCTTTGTGCCTCGG + Intronic
957632880 3:82740723-82740745 CTCTGGGGCCCCTGGAGCCCAGG - Intergenic
960494453 3:118358362-118358384 CCTTGGTGCCATTGCTGTCCTGG - Intergenic
961035360 3:123638043-123638065 TCCTGGGGCACTTGGTGGACTGG - Intronic
961194448 3:124990003-124990025 GCCATGGGCCCTTGGTGTTCTGG - Intronic
965883704 3:173418895-173418917 CCCTGGGCCACATGGGGTCCAGG + Intronic
967995665 3:195164523-195164545 CACTGGGTCCCTTGGAATCCAGG + Intronic
968448350 4:663642-663664 CCCTCGGGCCCTCGGTGGGCGGG - Intronic
968509036 4:987343-987365 CTCTGGGGCCCTGGCTCTCCCGG + Intronic
969214036 4:5708795-5708817 CGGAGGGGCCCTTGGGGTCCTGG - Intronic
969289324 4:6228544-6228566 CAATGGGGCCCCTGCTGTCCTGG + Intergenic
969317555 4:6391146-6391168 TCCTGGGTTCCTGGGTGTCCAGG - Intronic
969493826 4:7514736-7514758 CCCTGTGAGCCTTGGTGTCGGGG + Intronic
969513901 4:7635833-7635855 CCGTCAGGCCCTTGGTGTGCTGG + Intronic
972265205 4:37453360-37453382 CCCTGGGGCCTTTAGGGTGCAGG + Intergenic
974055100 4:56976723-56976745 CGCTGTGGCCCTTGGTGGCCAGG + Exonic
975302515 4:72807391-72807413 CCCTGGAGCACTTGGTGTTTTGG - Intergenic
978260635 4:106753255-106753277 CCCTTGGGCCCTCTGAGTCCTGG + Intergenic
978676712 4:111327169-111327191 CCCTTGGGCCCTTAATGACCAGG - Intergenic
979485539 4:121265916-121265938 CCATGGTGCTTTTGGTGTCCCGG - Intergenic
980901865 4:138912667-138912689 TCCAGGGGCCCTTGGTTTCATGG + Intergenic
985576511 5:675725-675747 CCCTGGGGCCCCTTGAGACCAGG - Intronic
985748561 5:1661544-1661566 CCCAGGGGACCTTGGTGCCAAGG - Intergenic
990886891 5:60604728-60604750 CCCTGGGGTCCATGGTCTCCAGG - Intronic
992685679 5:79197338-79197360 AACTTGGCCCCTTGGTGTCCTGG - Intronic
997295005 5:132763610-132763632 CCCTGAGGACCATGGTGTTCAGG + Intronic
997412710 5:133702475-133702497 CCATGGGGCCCCCGGAGTCCGGG + Intergenic
997646048 5:135482771-135482793 CCCTGGGGCACTAGGAGACCAGG - Intergenic
997976475 5:138444466-138444488 CGCTGGAGCCCTTGGTGTAAGGG - Exonic
998994156 5:147852198-147852220 CTCTGGGGCCCTTGAGGACCTGG - Intergenic
999078010 5:148815508-148815530 ACCTGGTGCCCTAGGTCTCCTGG + Intergenic
999158060 5:149472601-149472623 CACTGGGGCCCTTGGCCTCAAGG + Intergenic
999199882 5:149808334-149808356 CCCTGGGGTCCTTGGATGCCAGG + Intronic
999755886 5:154664015-154664037 ACCTGGGGCCCTTTGAGTCATGG + Intergenic
1001409325 5:171499196-171499218 CCCTTAGGCCATTGGGGTCCAGG - Intergenic
1001543325 5:172554308-172554330 CACTGGGTCCCTTGGGGCCCTGG + Intergenic
1001646041 5:173283163-173283185 CCCTGTGGCTCTGGGCGTCCTGG + Intergenic
1002067192 5:176657795-176657817 AGCTGGGGCCCTTGGTGACTGGG - Exonic
1002523475 5:179803753-179803775 CCGTGGGGCCCTTTATCTCCTGG - Intronic
1002527027 5:179820668-179820690 TCCTGGGGTCCTTGGTGCACCGG + Intronic
1003896765 6:10615437-10615459 GCCTGGGGCCCCAGGTGTTCGGG - Intronic
1004035748 6:11921114-11921136 CCCAAGGGCCCTGGGTGTCCTGG + Intergenic
1005946902 6:30602076-30602098 CCATGGGGCCCCCCGTGTCCAGG + Exonic
1006083441 6:31580645-31580667 CCATGGGGTCCTGGGCGTCCGGG + Exonic
1006115296 6:31773062-31773084 CCATGCTGCCCGTGGTGTCCAGG + Exonic
1006378419 6:33684363-33684385 CCATGAGGTCCTTGGTGTGCTGG - Exonic
1012530196 6:100226398-100226420 CCCTGCGGCCCTTGGCTGCCTGG - Intergenic
1013405142 6:109836839-109836861 CCAAGGGGCCCATGGTGTGCTGG + Intergenic
1015440383 6:133241090-133241112 CCTCGGGGCCCTGGATGTCCCGG - Intronic
1016330519 6:142947535-142947557 CGCTGGGGCCCGCGGCGTCCTGG - Intergenic
1017652884 6:156599272-156599294 GCCTGGGGCCCTTTCTGGCCAGG - Intergenic
1018248551 6:161845226-161845248 GCCAGGGGCTCTTGCTGTCCTGG - Intronic
1018324134 6:162646354-162646376 CCCTGGAGCCCAGGGTGTCAAGG - Intronic
1018633579 6:165841359-165841381 CCCTGTGGCCTTTGCTGACCAGG + Intronic
1019088428 6:169502702-169502724 CACTGGGGCCCTGGGTCACCCGG + Intronic
1019135360 6:169904454-169904476 CCCTGGGGCCTTTTGGGTTCAGG + Intergenic
1019457503 7:1138122-1138144 CCCCGGGGCTCTGGGTCTCCTGG + Exonic
1020006480 7:4786133-4786155 CCTCGGAGCCCTTGGTGTCCTGG + Intronic
1020013903 7:4820304-4820326 CCCTGGGGCTCCTGGGCTCCCGG - Intronic
1023391385 7:39714721-39714743 ACCTGGGCCCCTTTGTGCCCTGG - Intergenic
1023829482 7:44030527-44030549 CCCCTGGGCCCTTGGAGTACAGG - Intergenic
1023904678 7:44513732-44513754 CCCTGGGACCCTTCCTGCCCTGG - Intronic
1024042675 7:45567384-45567406 CACTGGGGCCAATGGAGTCCTGG + Intergenic
1024546728 7:50528662-50528684 CCTTGGGGAGCTTGGTGGCCAGG + Intronic
1024581303 7:50803049-50803071 CCCAGGGGCCCTAAGTGTCTCGG + Intergenic
1026028046 7:66762892-66762914 TGCTGTGGCCCTTGCTGTCCAGG - Intronic
1026986708 7:74559467-74559489 CCCTGGGGCTCTGTGTGTGCGGG - Intronic
1027978202 7:85185589-85185611 AGCTGGGGCCGCTGGTGTCCGGG - Intronic
1029739791 7:102484785-102484807 CCCCTGGGCCCTTGGAGTACAGG - Intronic
1029757790 7:102583964-102583986 CCCCTGGGCCCTTGGAGTACAGG - Intronic
1029775726 7:102683025-102683047 CCCCTGGGCCCTTGGAGTACAGG - Intergenic
1033120451 7:138663294-138663316 CCCTGAGGCCCTTCATGTTCAGG + Intronic
1034338604 7:150338705-150338727 CCCTGAGGCACTGGGTCTCCTGG + Exonic
1036793945 8:11742164-11742186 CGCTGGGGCCCAGGGTGTCAGGG + Intronic
1037507575 8:19547130-19547152 TCATGGAGCCCTTCGTGTCCTGG - Intronic
1037615158 8:20512527-20512549 CCCAGGAGCCCTTGGTGGCATGG - Intergenic
1037820925 8:22134166-22134188 GCCTGGGGCCCTCCGTGTCCTGG - Intergenic
1038596357 8:28890186-28890208 GCCTGGGGCCCATGGTGTTCTGG + Intronic
1039076248 8:33693051-33693073 AGCTGGGCCACTTGGTGTCCCGG + Intergenic
1041029209 8:53718872-53718894 ACCTGGGGCCCCTGATGTGCAGG - Intronic
1045342605 8:101267991-101268013 CCCTGCAGCCTTTGGAGTCCAGG + Intergenic
1045734859 8:105283101-105283123 CCCAGGGGCCCTAGGTCCCCAGG + Intronic
1047192503 8:122690884-122690906 CCCTGGAGGCCTTTGTGACCAGG - Intergenic
1048975116 8:139667112-139667134 CCTTGGGCCACTTTGTGTCCTGG - Intronic
1049243116 8:141548727-141548749 GCCTGGGGCCCTGGGAGTCTGGG - Intergenic
1049262450 8:141646832-141646854 CCCAGGGGCCTCTGGTGCCCCGG + Intergenic
1049916445 9:322516-322538 CCCTGGGAACCTTGCTTTCCTGG + Intronic
1049956939 9:702196-702218 CTCTGTGACCCTTGGTGTCTAGG + Intronic
1050362772 9:4846601-4846623 CCCTGGGTCTCTTGTTGTGCAGG + Intronic
1052193404 9:25683763-25683785 ACCTGGGGCCCTTTGAGTCAAGG - Intergenic
1053422430 9:37987943-37987965 CCCTGGGGGCCCTGGTCACCTGG + Intronic
1054818821 9:69501384-69501406 TCCTGGAGCCCATGTTGTCCTGG - Intronic
1056657437 9:88520890-88520912 CCCTAGTGCCCATGGGGTCCTGG + Intergenic
1056922423 9:90802168-90802190 CCCTGGGGGCCTGGGCGCCCTGG - Intronic
1057046353 9:91889283-91889305 GCCTGGGGCCCTGGGACTCCTGG - Intronic
1057726729 9:97573239-97573261 CCCTGGTGCCCTGGGGGTCCTGG - Intronic
1058700964 9:107599848-107599870 CACTGTGGCCCTTCCTGTCCTGG + Intergenic
1059435843 9:114275747-114275769 CCCTGGCGTCACTGGTGTCCGGG + Exonic
1060113849 9:120925973-120925995 CCCTGGGCTCCTTTGGGTCCTGG + Exonic
1060198825 9:121640134-121640156 CCCAGGAGCCCTGGGAGTCCTGG + Intronic
1060835283 9:126751130-126751152 CTCTGGAGCCCTTGGTGGACAGG - Intergenic
1061001681 9:127906162-127906184 CCCGGGGGCTCTGGGTGACCCGG - Intergenic
1061493065 9:130956877-130956899 CTCTGGGGCCCTTGGAGGCCTGG + Intergenic
1062085964 9:134648641-134648663 CACTGGGGCCCCTGGTGGCAAGG - Intronic
1062268028 9:135696247-135696269 CCCTGGGTCCCTGGGTCTGCTGG - Intronic
1062337740 9:136079844-136079866 CCCCTGGGGCCTTGGGGTCCTGG - Intronic
1062363041 9:136196586-136196608 ACCCCAGGCCCTTGGTGTCCAGG - Exonic
1062368334 9:136222830-136222852 CCCTCGTGCCCTTGCTGTCTCGG - Intronic
1062434250 9:136539675-136539697 CCCTGGCGCCCTTGAAGACCAGG + Intronic
1062452543 9:136621631-136621653 CCCAGGGACCCTGGGTGTCGGGG + Intergenic
1062457563 9:136646706-136646728 CCCTGGGGTCCTGGCTGCCCTGG + Intergenic
1062503461 9:136861169-136861191 CCCTGGGGCACCTGGTGACCTGG - Intronic
1062579717 9:137223855-137223877 CAGTGGGGCCCTTGGGGCCCAGG - Intergenic
1062716162 9:138011223-138011245 GCCCGGGGCCCTAGCTGTCCTGG + Intronic
1187127748 X:16469913-16469935 GGCAGGGGCCCCTGGTGTCCTGG + Intergenic
1187268571 X:17759619-17759641 CCTTGGGGTCCTTGGACTCCTGG + Intergenic
1189244885 X:39555668-39555690 TGATGGGGCCTTTGGTGTCCTGG + Intergenic
1189984633 X:46543477-46543499 CCCTGCGGCCCTTTGAGCCCTGG - Intronic
1190218036 X:48493179-48493201 CCCAGGGGCCCGTGGAATCCTGG - Intergenic
1190745837 X:53321253-53321275 CCCGGGGGCCCTAGGGGGCCCGG + Exonic
1192153188 X:68724460-68724482 CCCTCGCTCCCTTGGTGCCCAGG - Exonic
1192221092 X:69197804-69197826 CCCTGGGGCCTTTGCAGTTCTGG - Intergenic
1192312414 X:70027901-70027923 CCCTGGGGTCCTGGAGGTCCTGG - Exonic
1193358897 X:80556621-80556643 ACCTGAGGCCCTTTGTCTCCTGG - Intergenic
1195754998 X:108191506-108191528 CCCTGAGGCCCTAGGGCTCCTGG + Exonic
1195798639 X:108681858-108681880 CCTTGAGGTCCTTGGGGTCCTGG - Exonic
1196465896 X:115970915-115970937 CTCTGTGGACCTTGGTTTCCTGG - Intergenic
1197980922 X:132217674-132217696 CCCTGGGCCCCTTTGTGTGAAGG - Exonic
1198095507 X:133376289-133376311 CCCTGTGGCCCTGGGTGGCAGGG - Intronic
1199894223 X:152116437-152116459 CCCTGGGATCATTGGTGTCAGGG - Intergenic
1200091068 X:153636272-153636294 CCTTGGGGCCCTTGAGGTTCTGG + Intergenic
1200117856 X:153776999-153777021 ACCTGGGGCCACTGGAGTCCAGG + Intronic
1201194025 Y:11474191-11474213 TCCTGGGGCTCCTGGTGTTCTGG - Intergenic